pydna 5.5.1__py3-none-any.whl → 5.5.2__py3-none-any.whl

pydna/myprimers.py

@@ -1,219 +0,0 @@
-#!/usr/bin/env python3
-# -*- coding: utf-8 -*-
-# Copyright 2013-2023 by Björn Johansson.  All rights reserved.
-# This code is part of the Python-dna distribution and governed by its
-# license.  Please see the LICENSE.txt file that should have been included
-# as part of this package.
-"""
-Provides a practical way to access a list of primer sequences in a text file.
-
-The path of a text file can be specified in the pydna.ini file or by the
-´pydna_primers´ environment variable.
-
-The file is expected to contain sequences in FASTA, Genbank or EMBL formats or
-any format readable by the parse_primers function.
-
-The primer list is expected to follow the convension below. The primer name is
-expected to begin with the number.
-
-can have the format below for example:
-
-::
-
-    >2_third_primer
-    tgagtagtcgtagtcgtcgtat
-
-    >1_second_primer
-    tgatcgtcatgctgactatactat
-
-    >0_first_primer
-    ctaggatcgtagatctagctg
-    ...
-
-The primerlist funtion returns a list of :class:`pydna.primer.Primer` objects
-primerdict returns a dict where the key is the id of the object.
-"""
-
-import os as _os
-import re as _re
-from typing import Iterable
-from pathlib import Path
-import copy as _copy
-from keyword import iskeyword as _iskeyword
-from pydna.parsers import parse_primers as _parse_primers
-from pydna._pretty import pretty_str as _pretty_str
-from collections import UserList as _UserList
-from pydna.utils import open_folder as _open_folder
-from builtins import __dict__ as _kw
-
-
-class PrimerList(_UserList):
-    """Read a text file with primers.
-
-    The primers can be of any format readable by the parse_primers
-    function. Lines beginning with # are ignored. Path defaults to
-    the path given by the pydna_primers environment variable.
-
-    The primer list does not accept new primers. Use the
-    assign_numbers_to_new_primers method and paste the new
-    primers at the top of the list.
-
-    The primer list remembers the numbers of accessed primers.
-    The indices of accessed primers are stored in the .accessed
-    property.
-    """
-
-    def __init__(
-        self,
-        initlist: Iterable = None,
-        path: (str, Path) = None,
-        *args,
-        identifier: str = "p",
-        **kwargs,
-    ):
-        if initlist:
-            self.data = initlist
-            self.path = None
-        else:
-            self.path = Path(path or _os.environ["pydna_primers"])
-            self.path.parent.mkdir(parents=True, exist_ok=True)
-            self.data = _parse_primers(self.path.read_text())[::-1]
-        # super().__init__(*args, **kwargs)
-        self.accessed_indices = []
-        if identifier.isidentifier() and not _iskeyword(identifier) and identifier not in _kw:
-            self.identifier = identifier
-        else:
-            raise ValueError(f"{identifier} is not a valid identifier.")
-
-    def __getitem__(self, i):
-        """Save indices of accessed items."""
-        if isinstance(i, slice):
-            result = self.__class__(self.data[i])
-            for ind in range(i.start, i.stop, i.step or 1):
-                if ind not in self.accessed_indices:
-                    self.accessed_indices.append(ind)
-        else:
-            try:
-                result = self.data[i]
-            except IndexError as e:
-                raise (e)
-            else:
-                if i not in self.accessed_indices:
-                    self.accessed_indices.append(i)
-        return result
-
-    def __setitem__(self, i, item):
-        """Items already present can be set to the same value."""
-        if abs(i) > len(self):
-            raise IndexError(f"index {i} does not exist.")
-        else:
-            if str(item.seq).lower() != str(self.data[i].seq).lower():
-                raise ValueError("Cannot change existing primer.")
-        if i not in self.accessed_indices:
-            self.accessed_indices.append(i)
-
-    @property
-    def accessed(self):
-        """docstring."""
-        return [self.data[i] for i in self.accessed_indices]
-
-    def assign_numbers(self, lst: list):
-        """Find new primers in lst.
-
-        Returns a string containing new primers with their assigned
-        numbers. This string can be copied and pasted to the primer
-        text file.
-        """
-        new = []
-        found = []
-        oldstrs = [str(p.seq).upper() for p in self.data]
-        # no = len(oldstrs)
-        no, *rest = self.data[-1].name.split("_")
-        no = int(no) + 1
-        for p in lst[::-1]:
-            try:
-                i = oldstrs.index(str(p.seq).upper())
-            except ValueError:
-                i = no + len(new)
-                # suffix = p.id.removeprefix(f"{str(i)}_") # use this after removing python 3.8
-                suffix = p.id[len(f"{str(i)}_") :] if p.id.startswith(f"{str(i)}_") else p.id
-                # suffix.lstrip("_")
-                newprimer = _copy.copy(p)
-                newprimer.id = f"{i}_{suffix}"
-                new.append(newprimer)
-            else:
-                found.append(self[i])
-        new = new[::-1]
-        newold = new + found
-        return _pretty_str("\n".join([p.format("primer") for p in newold]))
-
-    def pydna_code_from_list(self, lst: list):
-        """Pydna code for a list of primer objects."""
-        indices = []
-        prstrs = [str(p.seq).upper() for p in self.data]
-        err = None
-        for p in lst:
-            try:
-                prstrs.index(str(p.seq).upper())
-            except ValueError as e:
-                print(f"{p.format('primer')}")
-                err = e
-            else:
-                indices.append(self.data.index(p))
-        if err:
-            raise ValueError("At least one primer not in list.")
-
-        curly = "{}"
-        msg = "from pydna.parsers import parse_primers\n\n"
-        msg += f"{self.identifier} = {curly}\n\n"
-        msg += ", ".join(f"{self.identifier}[{i}]" for i in indices)
-        msg += " = parse_primers('''\n\n"
-        msg += "\n".join(self[i].format("primer") for i in indices)
-        msg += "\n''')"
-        return _pretty_str(msg)
-
-    def open_folder(self):
-        """Open folder where primer file is located."""
-        if self.path:
-            _open_folder(self.path.parent)
-        else:
-            raise ValueError("path property not set.")
-
-    code = pydna_code_from_list
-
-
-def check_primer_numbers(pl: list = None):
-    """Find primers whose number do not match position in list."""
-    if not pl:
-        pl = PrimerList()
-    primers_with_wrong_number = []
-    for i, p in enumerate(pl):
-        if not p.name.startswith(str(i)):
-            primers_with_wrong_number.append(p)
-    return primers_with_wrong_number
-
-
-def undefined_sequence(pl: list = None):
-    """Primers in list with N or n instead of a sequence."""
-    if not pl:
-        pl = PrimerList()
-    return [p for p in pl if _re.match("N+", str(p.seq.upper()))]
-
-
-def find_duplicate_primers(pl: list = None):
-    """Find a list of lists with duplicated primer sequences."""
-    if not pl:
-        pl = PrimerList()
-    pg = {}
-    for p in pl:
-        pg.setdefault(str(p.seq).upper(), []).append(p)
-    return [pl for ps, pl in pg.items() if len(pl) > 1]
-
-
-if __name__ == "__main__":
-    cache = _os.getenv("pydna_cache")
-    _os.environ["pydna_cache"] = "nocache"
-    import doctest
-
-    doctest.testmod(verbose=True, optionflags=doctest.ELLIPSIS)
-    _os.environ["pydna_cache"] = cache

pydna-5.5.1.dist-info/RECORD

@@ -1,44 +0,0 @@
-pydna/__init__.py,sha256=_BLqB7eQOWvmMql1-tqh-BSkXMYerYFDdAYpwAAxWEw,13391
-pydna/_pretty.py,sha256=eMjYTy19AUTA-nntiYEql3FPVe4WzTLSZ4f0Jd6SLfo,1172
-pydna/_thermodynamic_data.py,sha256=9_w-97DpkbsWbJGHVijscMvUS_SFt7GxzrxspMRPZSg,10903
-pydna/all.py,sha256=i2dR9cAccr3AdtAMMeH4jazpVjxWjfvu8LB3LD9hwgY,2099
-pydna/amplicon.py,sha256=09_R_-LNFydsTR9GxNtcFDVjypglp28mbWpnrOJEcq0,5466
-pydna/amplify.py,sha256=fjj0GU9Hx7_fzCaqrb1n5T2gQ7mvm5frraQ7b64zdFA,18965
-pydna/assembly.py,sha256=Rewf15nWeeUeMwJl5Laxm4nms_UC3zXI7qMtEbBGRpE,19532
-pydna/codon.py,sha256=Nxa_03n2wxXKACkzi55bUN1t5xUU_DBRRwh_ZLIb9_o,2568
-pydna/common_sub_strings.py,sha256=JD0gXGMymcQCsQtq1OlKuI4QIykKXbo5-OJ8N9XAuuE,11841
-pydna/conftest.py,sha256=T5-WmHWLZH3U3ifxnbxd_oOiIFibIrkYpwNacCHlvsY,999
-pydna/contig.py,sha256=aNKtXGaHY0c70tEEMHk_9lDMk9DQzjFRO6LK-GPtdwc,7991
-pydna/crispr.py,sha256=VbOe_nDVmdhlnYvnnmukJJhRMZr1gk1UK6qOJCCs988,3824
-pydna/design.py,sha256=IE04UXQqAkpX1leTZN8KPJjdd9gj1Es_4HNcTZML5Dw,28781
-pydna/download.py,sha256=uFoAvWYXr1C30071p9OweMdemvKO-1F2pB5CHo2k31U,1307
-pydna/dseq.py,sha256=-iOK3uHplIgYfwbImHzJA2aZ8uXsBwXZbWwkO01-IMM,53601
-pydna/dseqrecord.py,sha256=qVWbAWT672TNYAx_R_TDqbTnlxbL2mN-c-I14PyetR0,47238
-pydna/editor.py,sha256=Au3kZ5DYqa6MYB3kXJePHOJOioSJ5w7jtlZ8kfHvKm8,3471
-pydna/fakeseq.py,sha256=eGeivoppQ8vSPQqggxFXARmUhU6oEBfdnIkGDR_v9UQ,1449
-pydna/fusionpcr.py,sha256=uRuHbwmZ2H5SThDUYW-KwxMB1DwqA2Khof7KXiMdxN8,2783
-pydna/gateway.py,sha256=bZUASiC93WKwofnqBmG6cKahxXHnXHA26K64BAf8HMM,8447
-pydna/gel.py,sha256=yCPXNlF-3HzPVjQxa_NZjpC9UXTPfZBzCmW9m5kWkHo,3554
-pydna/genbank.py,sha256=mPtictXh-oOEdj2H6MtDYP2eaJK7vnap-QS33pEMRIk,8933
-pydna/genbankfile.py,sha256=wpCBYTysYqFwrGBIN8ean2MAAocdA_7OJ9avHEho9fw,1652
-pydna/genbankfixer.py,sha256=D2-I30fIPMndyefNzOaeAYbu6LGHC_SnOyjxJhhMfYw,20695
-pydna/genbankrecord.py,sha256=EWRQ9EB7xzIAVqk7ico0bL_JSjR92LXt0UTSQ0HztEI,5771
-pydna/goldengate.py,sha256=Fmkbb4kkau9h1o6I-MiQZ0rNHwmD4-1IK0BJaL1MblI,1774
-pydna/ladders.py,sha256=2SaTq7_Y8XLvEBK0UqgkB9aWePzG0g84cPiNtJfggx0,3574
-pydna/ligate.py,sha256=41YYBcZxGl1PzABZoi-zkRlRcR6sYCzT4rp5HE45A9Q,2205
-pydna/myenzymes.py,sha256=v9e9JnykCw6lqoZ4zNcW6cH3DGtGxl0O1WXzJkyhhyk,1834
-pydna/myprimers.py,sha256=JtpdejRP6MkKplLv-p5NCMzxBTepYN0CVHSxxP3ms3Q,7362
-pydna/parsers.py,sha256=UlG5xh4EsNNPaPK4SoEE6KL52YxkQfLvKJiDm3DB5s4,6927
-pydna/primer.py,sha256=7AYWIhr1YbjG0Gak94bU6bTlsRUgWCIbKTndgsgWZ2M,2533
-pydna/readers.py,sha256=dsihpjRopxWeeab1bRAK4TRHMBLYK_SpK1j2llHrHk0,1850
-pydna/seq.py,sha256=Qwbx1uo-JIYXIuySXevNtxoDgohENHTTTCjPMnn4yjo,7703
-pydna/seqrecord.py,sha256=oz2YZR3_tkNj7YgdWmJr0MyREJZvCgvmq1g8hzuzNyQ,23530
-pydna/sequence_picker.py,sha256=jYbGUparKyIhDD30BzT2x-olnPpDjv-xvyaeIk6_V4E,1659
-pydna/threading_timer_decorator_exit.py,sha256=D91kqjKSavWDnXyc1Fo-CwPYtbmR2DjTXnBYSRXKmSA,2793
-pydna/tm.py,sha256=YVXgDMB_AxNyzPR9fYT1YWlfy80paKTl2r0bkLFNxU8,11330
-pydna/user_cloning.py,sha256=VSpYX1tdbcD_PzEt69Jz6Lud-yAkYMVXnzVd4v2usnE,692
-pydna/utils.py,sha256=7CQ8tkVcTcNY_k1eBbP242ax3X2MMZGZ1cPhHcDY8y4,22084
-pydna-5.5.1.dist-info/LICENSE.txt,sha256=u8QfcsnNXZM0UCexerK_MvyA2lPWgeGyUtSYXvLG6Oc,6119
-pydna-5.5.1.dist-info/METADATA,sha256=mJGG_H_ccfb97ELbilQYUxFvjIVBNYt7X2Tdwe2Pp0Y,24485
-pydna-5.5.1.dist-info/WHEEL,sha256=b4K_helf-jlQoXBBETfwnf4B04YC67LOev0jo4fX5m8,88
-pydna-5.5.1.dist-info/RECORD,,