pydna 5.5.0__py3-none-any.whl → 5.5.2__py3-none-any.whl

pydna/__init__.py

@@ -132,111 +132,104 @@ See this repository for a collection of
 """
 
 
-from pydna.utils import open_folder as _open_folder
-from pathlib import Path as _Path
+# from pydna.utils import open_folder as _open_folder
+# from pathlib import Path as _Path
 import os as _os
-import logging as _logging
-import logging.handlers as _handlers
-import appdirs as _appdirs
-import configparser as _configparser
-import tempfile as _tempfile
+
+# import logging as _logging
+# import logging.handlers as _handlers
+# import appdirs as _appdirs
+# import configparser as _configparser
+# import tempfile as _tempfile
 from pydna._pretty import PrettyTable as _PrettyTable
 
 
 __author__ = "Björn Johansson"
-__copyright__ = "Copyright 2013 - 2021 Björn Johansson"
+__copyright__ = "Copyright 2013 - 2023 Björn Johansson"
 __credits__ = ["Björn Johansson", "Mark Budde"]
 __license__ = "BSD"
 __maintainer__ = "Björn Johansson"
 __email__ = "bjorn_johansson@bio.uminho.pt"
 __status__ = "Development"  # "Production" #"Prototype"
-__version__ = "5.5.0"
+__version__ = "5.5.2"
 
 
-# create config directory
-_os.environ["pydna_config_dir"] = _os.getenv("pydna_config_dir", _appdirs.user_config_dir("pydna"))
-config_dir = _Path(_os.environ["pydna_config_dir"])
-config_dir.mkdir(parents=True, exist_ok=True)
+# obtain config directory from env or appdirs
+# _os.environ["pydna_config_dir"] = _os.getenv("pydna_config_dir", _appdirs.user_config_dir("pydna"))
+# config_dir = _Path(_os.environ["pydna_config_dir"])
+# config_dir.mkdir(parents=True, exist_ok=True)
 
 # set path for the pydna.ini file
-_ini_path = config_dir / "pydna.ini"
+# _ini_path = config_dir / "pydna.ini"
 
 # define user_data_dir
-user_data_dir = _Path(_appdirs.user_data_dir("pydna"))
-
-default_ini = {
-    "ape": "put/path/to/ape/here",
-    "cached_funcs": "pydna.genbank.genbank.nucleotide",
-    "data_dir": str(user_data_dir),
-    "email": "someone@example.com",
-    "enzymes": str(user_data_dir / "enzymes.md"),
-    "log_dir": _appdirs.user_log_dir("pydna"),
-    "loglevel": str(_logging.WARNING),
-    "primers": str(user_data_dir / "primers.md"),
-    "assembly_limit": str(10),
-}
+# user_data_dir = _Path(_appdirs.user_data_dir("pydna"))
+
+# default_ini = {
+#     "ape": "put/path/to/ape/here",
+#     "cached_funcs": "pydna.genbank.genbank.nucleotide",
+#     "data_dir": str(user_data_dir),
+#     "email": "someone@example.com",
+#     "enzymes": str(user_data_dir / "enzymes.md"),
+#     "log_dir": _appdirs.user_log_dir("pydna"),
+#     "loglevel": str(_logging.WARNING),
+#     "primers": str(user_data_dir / "primers.md"),
+#     "assembly_limit": str(10),
+# }
+
+# ini = default_ini.copy()
 
 # initiate a config parser instance
-_parser = _configparser.ConfigParser()
+# _parser = _configparser.ConfigParser()
 
 # if a pydna.ini exists, it is read
-if _ini_path.exists():
-    _parser.read(_ini_path)
-else:  # otherwise it is created with default settings
-    _parser["main"] = default_ini
-    _temp_ini_file = _tempfile.NamedTemporaryFile(dir=_ini_path.parent, delete=False)
-    _temp_ini_path = _Path(_temp_ini_file.name)
-    try:
-        _temp_ini_file.close()
-        with _temp_ini_path.open("w", encoding="utf-8") as f:  # TODO needs encoding?
-            _parser.write(f)
-        _temp_ini_path.replace(_ini_path)
-    finally:
-        _temp_ini_path.unlink(missing_ok=True)
-
+# if _ini_path.exists():
+#     _parser.read(_ini_path)
 # pydna related environmental variables are set
 # from pydna.ini if they are not set already
-_main = _parser["main"]
+# _main = _parser["main"]
+# ini.update(_main)
 
-for key in default_ini:
-    _os.environ[f"pydna_{key}"] = _os.getenv(f"pydna_{key}", _main.get(key, default_ini[key]))
 
-logdir = _Path(_os.environ["pydna_log_dir"])
+# for key, value in ini.items():
+#     _os.environ[f"pydna_{key}"] = _os.getenv(f"pydna_{key}", value)
+
+# logdir = _Path(_os.environ["pydna_log_dir"])
 
 # create log directory if not present
-logdir.mkdir(parents=True, exist_ok=True)
-_logmsg = "Log directory {}".format(logdir)
+# logdir.mkdir(parents=True, exist_ok=True)
+# _logmsg = "Log directory {}".format(logdir)
 
 # create logger
-_logger = _logging.getLogger("pydna")
-_logger.setLevel(int(_os.environ["pydna_loglevel"]))
-_hdlr = _handlers.RotatingFileHandler(
-    logdir / "pydna.log",
-    mode="a",
-    maxBytes=10 * 1024 * 1024,
-    backupCount=10,
-    encoding="utf-8",
-)
-
-_formatter = _logging.Formatter(("%(asctime)s %(levelname)s" " %(funcName)s %(message)s"))
-_hdlr.setFormatter(_formatter)
-_logger.addHandler(_hdlr)
-_logger.info(_logmsg)
-_logger.info("Environmental variable pydna_ape          = %s", _os.environ["pydna_ape"])
-_logger.info("Environmental variable pydna_cached_funcs = %s", _os.environ["pydna_cached_funcs"])
-_logger.info("Environmental variable pydna_data_dir     = %s", _os.environ["pydna_data_dir"])
-_logger.info("Environmental variable pydna_email        = %s", _os.environ["pydna_email"])
-_logger.info("Environmental variable pydna_log_dir      = %s", _os.environ["pydna_log_dir"])
-_logger.info("Environmental variable pydna_loglevel     = %s", _os.environ["pydna_loglevel"])
-_logger.info("Environmental variable pydna_primers      = %s", _os.environ["pydna_primers"])
-_logger.info(
-    "Environmental variable pydna_assembly_limit = %s",
-    _os.environ["pydna_assembly_limit"],
-)
+# _logger = _logging.getLogger("pydna")
+# _logger.setLevel(int(_os.environ["pydna_loglevel"]))
+# _hdlr = _handlers.RotatingFileHandler(
+#     logdir / "pydna.log",
+#     mode="a",
+#     maxBytes=10 * 1024 * 1024,
+#     backupCount=10,
+#     encoding="utf-8",
+# )
+
+# _formatter = _logging.Formatter(("%(asctime)s %(levelname)s" " %(funcName)s %(message)s"))
+# _hdlr.setFormatter(_formatter)
+# _logger.addHandler(_hdlr)
+# _logger.info(_logmsg)
+# _logger.info("Environmental variable pydna_ape          = %s", _os.environ["pydna_ape"])
+# _logger.info("Environmental variable pydna_cached_funcs = %s", _os.environ["pydna_cached_funcs"])
+# _logger.info("Environmental variable pydna_data_dir     = %s", _os.environ["pydna_data_dir"])
+# _logger.info("Environmental variable pydna_email        = %s", _os.environ["pydna_email"])
+# _logger.info("Environmental variable pydna_log_dir      = %s", _os.environ["pydna_log_dir"])
+# _logger.info("Environmental variable pydna_loglevel     = %s", _os.environ["pydna_loglevel"])
+# _logger.info("Environmental variable pydna_primers      = %s", _os.environ["pydna_primers"])
+# _logger.info(
+#     "Environmental variable pydna_assembly_limit = %s",
+#     _os.environ["pydna_assembly_limit"],
+# )
 
 # create cache directory if not present
 
-_Path(_os.environ["pydna_data_dir"]).mkdir(parents=True, exist_ok=True)
+# _Path(_os.environ["pydna_data_dir"]).mkdir(parents=True, exist_ok=True)
 
 # find out if optional dependecies for gel module are in place
 #
@@ -264,7 +257,7 @@ _Path(_os.environ["pydna_data_dir"]).mkdir(parents=True, exist_ok=True)
 #    _logger.info("gel simulation is available," " optional dependencies were found.")
 #
 
-_logger.info("__version__ = %s", __version__)
+# _logger.info("__version__ = %s", __version__)
 
 
 class _PydnaWarning(Warning):
@@ -304,74 +297,74 @@ class _PydnaDeprecationWarning(_PydnaWarning):
     pass
 
 
-def open_current_folder():
-    """Open the current working directory.
+# def open_current_folder():
+#     """Open the current working directory.
 
-    Opens in the default file manager. The location for this folder is
-    given by the :func:`os.getcwd` function
-    """
-    return _open_folder(_os.getcwd())
+#     Opens in the default file manager. The location for this folder is
+#     given by the :func:`os.getcwd` function
+#     """
+#     return _open_folder(_os.getcwd())
 
 
-_logger.info("Current working directory = os.getcwd() = %s", _os.getcwd())
+# _logger.info("Current working directory = os.getcwd() = %s", _os.getcwd())
 
 
-def open_cache_folder():
-    """Open the pydna cache folder.
+# def open_cache_folder():
+#     """Open the pydna cache folder.
 
-    Opens in the default file manager. The location for this folder is stored
-    in the *pydna_data_dir* environmental variable.
-    """
-    return _open_folder(_os.environ["pydna_data_dir"])
+#     Opens in the default file manager. The location for this folder is stored
+#     in the *pydna_data_dir* environmental variable.
+#     """
+#     return _open_folder(_os.environ["pydna_data_dir"])
 
 
-def open_config_folder():
-    """Open the pydna configuration folder.
+# def open_config_folder():
+#     """Open the pydna configuration folder.
 
-    Opens in the default file manager. The location for this folder is stored
-    in the *pydna_config_dir* environmental variable.
+#     Opens in the default file manager. The location for this folder is stored
+#     in the *pydna_config_dir* environmental variable.
 
-    The `pydna.ini` file can be edited to make pydna quicker to use.
-    See the documentation of the :class:configparser.ConfigParser´ class.
+#     The `pydna.ini` file can be edited to make pydna quicker to use.
+#     See the documentation of the :class:configparser.ConfigParser´ class.
 
-    Below is the content of a typical `pydna.ini` file on a Linux
-    system.
+#     Below is the content of a typical `pydna.ini` file on a Linux
+#     system.
 
-    ::
+#     ::
 
-        [main]
-        loglevel=30
-        email=myemail@example.org
-        data_dir=/home/bjorn/.local/share/pydna
-        log_dir=/home/bjorn/.cache/pydna/log
-        ape=tclsh /home/bjorn/.ApE/AppMain.tcl
-        cached_funcs=Genbank_nucleotide
-        primers=/home/bjorn/Dropbox/wikidata/PRIMERS.txt
-        enzymes=/home/bjorn/Dropbox/wikidata/RestrictionEnzymes.txt
+#         [main]
+#         loglevel=30
+#         email=myemail@example.org
+#         data_dir=/home/user/.local/share/pydna
+#         log_dir=/home/user/.cache/pydna/log
+#         ape=tclsh /path/to/ape/AppMain.tcl
+#         cached_funcs=Genbank_nucleotide
+#         primers=/path/to/primers/PRIMERS.txt
+#         enzymes=/path/to/enzymes/RestrictionEnzymes.txt
 
-    The email address is set to someone@example.com by default. If you change
-    this to you own address, the :func:`pydna.genbank.genbank` function can be
-    used to download sequences from Genbank directly without having to
-    explicitly add the email address.
+#     The email address is set to someone@example.com by default. If you change
+#     this to you own address, the :func:`pydna.genbank.genbank` function can be
+#     used to download sequences from Genbank directly without having to
+#     explicitly add the email address.
 
-    Pydna can cache results from the following functions or methods:
+#     Pydna can cache results from the following functions or methods:
 
-    - :func:`pydna.genbank.Genbank.nucleotide`   Genbank_nucleotide
-    - :func:`pydna.amplify.Anneal`               amplify_Anneal
-    - :func:`pydna.assembly.Assembly`            assembly_Assembly
-    - :func:`pydna.download.download_text`       download.download_text
-    - :func:`pydna.dseqrecord.Dseqrecord.synced` Dseqrecord_synced
+#     - :func:`pydna.genbank.Genbank.nucleotide`   Genbank_nucleotide
+#     - :func:`pydna.amplify.Anneal`               amplify_Anneal
+#     - :func:`pydna.assembly.Assembly`            assembly_Assembly
+#     - :func:`pydna.download.download_text`       download.download_text
+#     - :func:`pydna.dseqrecord.Dseqrecord.synced` Dseqrecord_synced
 
-    These can be added separated by a comma to the cached_funcs entry
-    in **pydna.ini** file or the pydna_cached_funcs environment variable.
+#     These can be added separated by a comma to the cached_funcs entry
+#     in **pydna.ini** file or the pydna_cached_funcs environment variable.
 
-    """
-    return _open_folder(_os.environ["pydna_config_dir"])
+#     """
+#     return _open_folder(_os.environ["pydna_config_dir"])
 
 
-def open_log_folder():
-    """docstring."""
-    return _open_folder(_os.environ["pydna_log_dir"])
+# def open_log_folder():
+#     """docstring."""
+#     return _open_folder(_os.environ["pydna_log_dir"])
 
 
 def get_env():
@@ -403,14 +396,3 @@ def logo():
         f = Figlet()
         message = f.renderText(message)
     return _pretty_str(message)
-
-
-if __name__ == "__main__":
-    import os as _os
-
-    cached = _os.getenv("pydna_cached_funcs", "")
-    _os.environ["pydna_cached_funcs"] = ""
-    import doctest
-
-    doctest.testmod(verbose=True, optionflags=doctest.ELLIPSIS)
-    _os.environ["pydna_cached_funcs"] = cached

pydna/_pretty.py

@@ -7,8 +7,7 @@ for for nicer string output in the IPython shell and Jupyter notebook.
 """
 
 from prettytable import PrettyTable as _Pt
-from prettytable import MARKDOWN as _md
-
+from prettytable import TableStyle as _TableStyle
 from copy import copy as _copy
 from typing import List as _List
 
@@ -33,16 +32,5 @@ class PrettyTable(_Pt):
 
     def _repr_markdown_(self) -> pretty_str:
         c = _copy(self)
-        c.set_style(_md)
+        c.set_style(_TableStyle.MARKDOWN)
         return pretty_str(c.get_string())
-
-
-if __name__ == "__main__":
-    import os as _os
-
-    cached = _os.getenv("pydna_cached_funcs", "")
-    _os.environ["pydna_cached_funcs"] = ""
-    import doctest
-
-    doctest.testmod(verbose=True, optionflags=doctest.ELLIPSIS)
-    _os.environ["pydna_cached_funcs"] = cached

pydna/all.py

@@ -18,10 +18,8 @@ ttt
 Dseqrecord(-3)
 >>> from pydna.all import __all__
 >>> __all__
-['Anneal', 'pcr', 'Assembly', 'genbank', 'Genbank', 'download_text\
-', 'Dseqrecord', 'Dseq', 'read', 'read_primer', 'parse', 'parse_primers\
-', 'ape', 'primer_design', 'assembly_fragments', 'circular_assembly_fragments\
-', 'eq', 'gbtext_clean', 'PrimerList']
+['Anneal', 'pcr', 'Assembly', 'genbank', 'Genbank', 'download_text', 'Dseqrecord',
+'Dseq', 'read', 'read_primer', 'parse', 'parse_primers', 'primer_design', 'assembly_fragments', 'eq', 'gbtext_clean']
 >>>
 """
 
@@ -39,13 +37,13 @@ __all__ = [
     "read_primer",
     "parse",
     "parse_primers",
-    "ape",
+    # "ape",
     "primer_design",
     "assembly_fragments",
-    "circular_assembly_fragments",
+    # "circular_assembly_fragments",
     "eq",
     "gbtext_clean",
-    "PrimerList",
+    # "PrimerList",
 ]
 
 
@@ -61,21 +59,13 @@ from pydna.readers import read
 from pydna.readers import read_primer
 from pydna.parsers import parse
 from pydna.parsers import parse_primers
-from pydna.editor import ape
+
+# from pydna.editor import ape
 from pydna.design import primer_design
 from pydna.design import assembly_fragments
-from pydna.design import circular_assembly_fragments
+
+# from pydna.design import circular_assembly_fragments
 from pydna.utils import eq
 from pydna.genbankfixer import gbtext_clean
-from pydna.myprimers import PrimerList
-
-
-if __name__ == "__main__":
-    import os as _os
-
-    cached = _os.getenv("pydna_cached_funcs", "")
-    _os.environ["pydna_cached_funcs"] = ""
-    import doctest
 
-    doctest.testmod(verbose=True, optionflags=doctest.ELLIPSIS)
-    _os.environ["pydna_cached_funcs"] = cached
+# from pydna.myprimers import PrimerList

pydna/amplicon.py

@@ -18,10 +18,11 @@ from pydna.dseqrecord import Dseqrecord as _Dseqrecord
 from pydna.seqrecord import SeqRecord as _SeqRecord
 import textwrap as _textwrap
 import copy as _copy
-import logging as _logging
 
+# import logging as _logging
 
-_module_logger = _logging.getLogger("pydna." + __name__)
+
+# _module_logger = _logging.getLogger("pydna." + __name__)
 
 
 class Amplicon(_Dseqrecord):
@@ -43,7 +44,15 @@ class Amplicon(_Dseqrecord):
 
     """
 
-    def __init__(self, record, *args, template=None, forward_primer=None, reverse_primer=None, **kwargs):
+    def __init__(
+        self,
+        record,
+        *args,
+        template=None,
+        forward_primer=None,
+        reverse_primer=None,
+        **kwargs,
+    ):
         super().__init__(record, *args)
         self.template = template
         self.forward_primer = forward_primer
@@ -83,7 +92,10 @@ class Amplicon(_Dseqrecord):
         r.template = self.template.rc()
         r.forward_primer = _copy.copy(self.reverse_primer)
         r.reverse_primer = _copy.copy(self.forward_primer)
-        r.forward_primer.position, r.reverse_primer.position = r.reverse_primer.position, r.forward_primer.position
+        r.forward_primer.position, r.reverse_primer.position = (
+            r.reverse_primer.position,
+            r.forward_primer.position,
+        )
         return r
 
     rc = reverse_complement
@@ -123,21 +135,25 @@ class Amplicon(_Dseqrecord):
         fzc = tp.seq.crick[::-1][fp.position - fp._fp : fp.position]
         rzc = tp.seq.crick[::-1][rp.position : rp.position + rp._fp]
         f = f"""
-            {" " *ft}5{faz}...{raz}3
+            {" " * ft}5{faz}...{raz}3
              {sp3}{"|" * rp._fp}
             {sp3}3{rp.seq[::-1]}5
             5{fp.seq}3
-             {"|" *fp._fp:>{len(fp)}}
-            {" " *ft}3{fzc}...{rzc}5
+             {"|" * fp._fp:>{len(fp)}}
+            {" " * ft}3{fzc}...{rzc}5
             """
         # breakpoint()
         return _pretty_str(_textwrap.dedent(f).strip("\n"))
 
     def set_forward_primer_footprint(self, length):
-        self.forward_primer = _Primer(self.forward_primer.tail + self.seq[:length], footprint=length)
+        self.forward_primer = _Primer(
+            self.forward_primer.tail + self.seq[:length], footprint=length
+        )
 
     def set_reverse_primer_footprint(self, length):
-        self.reverse_primer = _Primer(self.reverse_primer.tail + self.seq[:length], footprint=length)
+        self.reverse_primer = _Primer(
+            self.reverse_primer.tail + self.seq[:length], footprint=length
+        )
 
     def program(self):
         return _program(self)
@@ -147,14 +163,3 @@ class Amplicon(_Dseqrecord):
 
     def primers(self):
         return self.forward_primer, self.reverse_primer
-
-
-if __name__ == "__main__":
-    import os as _os
-
-    cached = _os.getenv("pydna_cached_funcs", "")
-    _os.environ["pydna_cached_funcs"] = ""
-    import doctest
-
-    doctest.testmod(verbose=True, optionflags=doctest.ELLIPSIS)
-    _os.environ["pydna_cached_funcs"] = cached

pydna/amplify.py

@@ -30,10 +30,12 @@ import itertools as _itertools
 import re as _re
 import copy as _copy
 import operator as _operator
-import os as _os
-import logging as _logging
 
-_module_logger = _logging.getLogger("pydna." + __name__)
+# import os as _os
+
+# import logging as _logging
+
+# _module_logger = _logging.getLogger("pydna." + __name__)
 
 _table = {  # IUPAC Ambiguity Codes for Nucleotide Degeneracy and U for Uracile
     "A": "A",
@@ -112,7 +114,9 @@ def _annealing_positions(primer, template, limit):
         results = []
         for match_start in positions:
             tm = template[match_start + limit : match_start + limit + length].lower()
-            footprint = len(list(_itertools.takewhile(lambda x: x[0] == x[1], zip(tail, tm))))
+            footprint = len(
+                list(_itertools.takewhile(lambda x: x[0] == x[1], zip(tail, tm)))
+            )
             results.append((match_start, footprint + limit))
         return results
     return []
@@ -343,11 +347,19 @@ class Anneal(object):  # ), metaclass=_Memoize):
             for rp in self.reverse_primers:
                 if self.template.circular:
                     shift = fp.position - fp._fp
-                    tpl = self.template.shifted(shift)  # shift template so that it starts where the fp starts anneling
-                    fp.position = fp._fp  # New position of fp becomes the footprint length
-                    rp.position = (rp.position - shift) % len(self.template)  # Shift the rp position as well
+                    tpl = self.template.shifted(
+                        shift
+                    )  # shift template so that it starts where the fp starts anneling
+                    fp.position = (
+                        fp._fp
+                    )  # New position of fp becomes the footprint length
+                    rp.position = (rp.position - shift) % len(
+                        self.template
+                    )  # Shift the rp position as well
                     feats = tpl[: rp.position + rp._fp].features
-                elif fp.position <= rp.position:  # pcr products only formed if fp anneals forward of rp
+                elif (
+                    fp.position <= rp.position
+                ):  # pcr products only formed if fp anneals forward of rp
                     feats = self.template[
                         fp.position - fp._fp : rp.position + rp._fp
                     ].features  # Save features covered by primers
@@ -361,10 +373,16 @@ class Anneal(object):  # ), metaclass=_Memoize):
                 if tpl.circular and fp.position == rp.position:
                     prd = _Dseqrecord(fp) + _Dseqrecord(rp).reverse_complement()
                 else:
-                    prd = _Dseqrecord(fp) + tpl[fp.position : rp.position] + _Dseqrecord(rp).reverse_complement()
+                    prd = (
+                        _Dseqrecord(fp)
+                        + tpl[fp.position : rp.position]
+                        + _Dseqrecord(rp).reverse_complement()
+                    )
                 prd.features = feats
                 full_tmpl_features = [
-                    f for f in self.template.features if f.location.start == 0 and f.location.end == len(self.template)
+                    f
+                    for f in self.template.features
+                    if f.location.start == 0 and f.location.end == len(self.template)
                 ]
                 new_identifier = ""
                 if full_tmpl_features:
@@ -383,10 +401,14 @@ class Anneal(object):  # ), metaclass=_Memoize):
                     or self.kwargs.get("name")
                     or f"{len(prd)}bp_PCR_prod"[:16]
                 )
-                prd.id = _identifier_from_string(new_identifier)[:16] or self.kwargs.get("id") or f"{len(prd)}bp"[:16]
-                prd.description = self.kwargs.get("description") or "pcr_product_{}_{}".format(
-                    fp.description, rp.description
+                prd.id = (
+                    _identifier_from_string(new_identifier)[:16]
+                    or self.kwargs.get("id")
+                    or f"{len(prd)}bp"[:16]
                 )
+                prd.description = self.kwargs.get(
+                    "description"
+                ) or "pcr_product_{}_{}".format(fp.description, rp.description)
 
                 amplicon = _Amplicon(
                     prd,
@@ -405,7 +427,9 @@ class Anneal(object):  # ), metaclass=_Memoize):
 
     def __repr__(self):
         """returns a short string representation"""
-        return "Reaction(products = {})".format(len(self.forward_primers * len(self.reverse_primers)))
+        return "Reaction(products = {})".format(
+            len(self.forward_primers * len(self.reverse_primers))
+        )
 
     def __str__(self):
         """returns a short report describing if or where primer
@@ -419,13 +443,17 @@ class Anneal(object):  # ), metaclass=_Memoize):
         )
         if self.forward_primers:
             for p in self.forward_primers:
-                mystring += "{name} anneals forward (--->) at {pos}\n".format(name=p.name, pos=p.position)
+                mystring += "{name} anneals forward (--->) at {pos}\n".format(
+                    name=p.name, pos=p.position
+                )
         else:
             mystring += "No forward primers anneal...\n"
         # mystring +="\n"
         if self.reverse_primers:
             for p in self.reverse_primers:
-                mystring += "{name} anneals reverse (<---) at {pos}\n".format(name=p.name, pos=p.position)
+                mystring += "{name} anneals reverse (<---) at {pos}\n".format(
+                    name=p.name, pos=p.position
+                )
         else:
             mystring += "No reverse primers anneal...\n"
         return _pretty_str(mystring.strip())
@@ -508,7 +536,8 @@ tatcgactgtatcatctgatagcac")
             pass
         else:
             raise TypeError(
-                "arguments need to be a string, Bio.Seq, SeqRecord" ", Primer, Dseqrecord or Amplicon object"
+                "arguments need to be a string, Bio.Seq, SeqRecord"
+                ", Primer, Dseqrecord or Amplicon object"
             )
         new.append(s)
 
@@ -526,12 +555,3 @@ tatcgactgtatcatctgatagcac")
     elif len(anneal_primers.products) == 0:
         raise ValueError(f"No PCR product! {anneal_primers.report()}")
     raise ValueError(f"PCR not specific! {format(anneal_primers.report())}")
-
-
-if __name__ == "__main__":
-    cached = _os.getenv("pydna_cached_funcs", "")
-    _os.environ["pydna_cached_funcs"] = ""
-    import doctest
-
-    doctest.testmod(verbose=True, optionflags=doctest.ELLIPSIS)
-    _os.environ["pydna_cached_funcs"] = cached