omnigenome 0.3.22a0__py3-none-any.whl → 0.3.24a0__py3-none-any.whl

omnigenome-0.3.24a0.dist-info/METADATA

@@ -0,0 +1,354 @@
+Metadata-Version: 2.4
+Name: omnigenome
+Version: 0.3.24a0
+Summary: OmniGenome: A comprehensive toolkit for genome analysis.
+Home-page: https://github.com/yangheng95/OmniGenBench
+Author: Yang, Heng
+Author-email: hy345@exeter.ac.uk
+License: Apache-2.0
+Platform: Windows
+Platform: Linux
+Platform: Mac OS-X
+Classifier: Development Status :: 3 - Alpha
+Classifier: Intended Audience :: Science/Research
+Classifier: License :: OSI Approved :: Apache Software License
+Classifier: Programming Language :: Python :: 3.10
+Classifier: Programming Language :: Python :: 3.11
+Classifier: Programming Language :: Python :: 3.12
+Classifier: Operating System :: OS Independent
+Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
+Requires-Python: >=3.10
+Description-Content-Type: text/markdown
+License-File: LICENSE
+Requires-Dist: omnigenbench>=0.3.3
+Requires-Dist: findfile>=2.0.0
+Requires-Dist: autocuda>=0.16
+Requires-Dist: metric-visualizer>=0.9.6
+Requires-Dist: termcolor
+Requires-Dist: gitpython
+Requires-Dist: torch>=2.6.0
+Requires-Dist: pandas
+Requires-Dist: viennarna
+Requires-Dist: scikit-learn
+Requires-Dist: accelerate
+Requires-Dist: transformers>=4.46.0
+Requires-Dist: packaging
+Requires-Dist: peft
+Requires-Dist: dill
+Provides-Extra: dev
+Requires-Dist: dill; extra == "dev"
+Requires-Dist: pytest; extra == "dev"
+Dynamic: author
+Dynamic: author-email
+Dynamic: classifier
+Dynamic: description
+Dynamic: description-content-type
+Dynamic: home-page
+Dynamic: license
+Dynamic: license-file
+Dynamic: platform
+Dynamic: provides-extra
+Dynamic: requires-dist
+Dynamic: requires-python
+Dynamic: summary
+
+[//]: # (![favicon.png](asset/favicon.png))
+
+[//]: # (<h3 align="center">OmniGenBench provides an all-in-one solution for genomic foundation model finetuning, inference, deployment and automated benchmarking, designed for research and applications in genomics.</h3>)
+
+<div align="center">
+
+  <a href="https://omnigenbenchdoc.readthedocs.io/en/latest/">
+    <img src="https://img.shields.io/readthedocs/omnigenbench?logo=readthedocs&logoColor=white" alt="Documentation Status" />
+  </a>
+
+  <a href="https://pypi.org/project/omnigenome/">
+    <img src="https://img.shields.io/pypi/v/omnigenome?color=blue&label=PyPI" alt="PyPI" />
+  </a>
+
+  <a href="https://pepy.tech/project/omnigenome">
+    <img src="https://static.pepy.tech/badge/omnigenome" alt="PyPI Downloads" />
+  </a>
+
+  <a href="https://pypi.org/project/omnigenbench/">
+    <img src="https://img.shields.io/pypi/pyversions/omnigenbench" alt="Python Versions (omnigenbench)" />
+  </a>
+
+  <a href="https://github.com/yangheng95/omnigenome/blob/main/LICENSE">
+    <img src="https://img.shields.io/github/license/yangheng95/omnigenome" alt="License" />
+  </a>
+
+</div>
+<h3 align="center">
+  <a href="#installation">📦 Installation</a>
+  <span> · </span>
+  <a href="#quick-start">🚀 Getting Started</a>
+  <span> · </span>
+  <a href="#supported-models">🧬 Model Support</a>
+  <span> · </span>
+  <a href="#benchmarks">📊 Benchmarks </a>
+  <span> · </span>
+  <a href="#tutorials">🧪 Application Tutorials</a>
+  <span> · </span>
+  <a href="https://arxiv.org/pdf/2505.14402">📚 Paper</a>
+</h3>
+
+
+## 🔍 What You Can Do with OmniGenBench?
+
+- 🧬 **Benchmark effortlessly** — Run automated and reproducible evaluations for genomic foundation models  
+- 🧠 **Understand your models** — Explore interpretability across diverse tasks and species  
+- ⚙️ **Run tutorials instantly** — Use click-to-run guides for genomic sequence modeling  
+- 🚀 **Fine-tune and infer efficiently** — Accelerated workflows for fine-tuning and inference on GFMs on downstream tasks
+
+## Installation
+
+### Requirements
+Before installing OmniGenBench, ensure you have the following:
+- **Python**: 3.10 or higher (3.12 recommended for best compatibility)
+- **PyTorch**: 2.6.0 or higher (with CUDA support for GPU acceleration)
+- **Transformers**: 4.46.0 or higher (HuggingFace library)
+
+### PyPI Installation (Recommended)
+Install the latest stable release from PyPI:
+```bash
+# Create dedicated conda environment (recommended)
+conda create -n omnigen_env python=3.12
+conda activate omnigen_env
+
+# Install OmniGenBench
+pip install omnigenbench -U
+```
+
+### Source Installation (For Development)
+Clone the repository and install in editable mode for development:
+```bash
+git clone https://github.com/yangheng95/OmniGenBench.git
+cd OmniGenBench
+pip install -e .
+```
+
+**Note**: For RNA structure prediction and design features, ViennaRNA is required. Install via conda: `conda install -c bioconda viennarna`
+
+## Quick Start
+*OmniGenBench provides unified interfaces for model inference, automated benchmarking, and fine-tuning across 30+ genomic foundation models and 80+ standardized tasks.*
+
+### Auto-inference via CLI
+Run inference with fine-tuned models on genomic sequences:
+```bash
+# Single sequence inference (TF binding prediction)
+ogb autoinfer \
+    --model yangheng/ogb_tfb_finetuned \
+    --sequence "ATCGATCGATCGATCG" \
+    --output-file predictions.json
+
+# Batch inference from file (translation efficiency prediction)
+ogb autoinfer \
+    --model yangheng/ogb_te_finetuned \
+    --input-file sequences.json \
+    --batch-size 64 \
+    --output-file results.json
+```
+
+### Auto-inference via Python API
+Programmatic inference with three-line workflow:
+```python
+from omnigenbench import ModelHub
+
+# Load fine-tuned model from HuggingFace Hub
+model = ModelHub.load("yangheng/ogb_tfb_finetuned")
+
+# Predict transcription factor binding (919 TFs, multi-label classification)
+outputs = model.inference("ATCGATCGATCGATCGATCGATCGATCGATCG" * 10)
+print(outputs)
+# {'predictions': array([1, 0, 1, ...]), 
+#  'probabilities': array([0.92, 0.15, 0.87, ...])}
+
+# Interpret results
+import numpy as np
+binding_sites = np.where(outputs['predictions'] == 1)[0]
+print(f"Predicted binding: {len(binding_sites)}/919 transcription factors")
+```
+**More Examples**: See [Getting Started Guide](docs/GETTING_STARTED.md) and [AutoInfer Examples](examples/autoinfer_examples/) for advanced usage patterns.
+
+### Auto-benchmark via CLI
+Automated benchmarking with statistical rigor (multi-seed evaluation):
+```bash
+# Evaluate model on RGB benchmark (12 RNA tasks) with 3 random seeds
+ogb autobench \
+    --model yangheng/OmniGenome-186M \
+    --benchmark RGB \
+    --seeds 0 1 2 \
+    --trainer accelerate
+
+# Legacy command (still supported for backward compatibility)
+# autobench --model_name_or_path "yangheng/OmniGenome-186M" --benchmark "RGB"
+```
+**Output**: Results include mean ± standard deviation for each metric (e.g., MCC: 0.742 ± 0.015, F1: 0.863 ± 0.009)
+
+**Visualization**: See [AutoBench GIF](asset/AutoBench.gif) for workflow demonstration.
+
+### Auto-benchmark via Python API
+Programmatic benchmarking with flexible configuration:
+```python
+from omnigenbench import AutoBench
+
+# Initialize benchmark
+gfm = 'LongSafari/hyenadna-medium-160k-seqlen-hf'
+benchmark = "RGB"  # Options: RGB, BEACON, PGB, GUE, GB
+bench_size = 8
+seeds = [0, 1, 2, 3, 4]  # Multi-seed for statistical rigor
+
+# Run automated evaluation
+bench = AutoBench(
+    benchmark=benchmark,
+    model_name_or_path=gfm,
+    overwrite=False  # Skip completed tasks
+)
+bench.run(autocast=False, batch_size=bench_size, seeds=seeds)
+```
+**Advanced Usage**: See [Benchmarking with LoRA](examples/autobench_gfm_evaluation/benchmarking_with_lora.ipynb) for parameter-efficient fine-tuning during evaluation.
+
+
+## Supported Models
+
+OmniGenBench provides plug-and-play evaluation for **30+ genomic foundation models**, covering both **RNA** and **DNA** modalities across multiple species. All models integrate seamlessly with the framework's automated benchmarking and fine-tuning workflows.
+
+### Representative Models
+
+| Model          | Params | Pre-training Corpus                        | Key Features                                          |
+|----------------|--------|--------------------------------------------|-------------------------------------------------------|
+| **OmniGenome** | 186M   | 54B plant RNA+DNA tokens                   | Multi-modal encoder, structure-aware, plant-specialized |
+| **Agro-NT-1B** | 985M   | 48 edible-plant genomes                    | Billion-scale DNA LM with NT-V2 k-mer vocabulary     |
+| **RiNALMo**    | 651M   | 36M ncRNA sequences                        | Largest public RNA LM with FlashAttention-2          |
+| **DNABERT-2**  | 117M   | 32B DNA tokens, 136 species (BPE)          | Second-generation DNA BERT with byte-pair encoding   |
+| **RNA-FM**     | 96M    | 23M ncRNA sequences                        | High performance on RNA structure prediction tasks   |
+| **RNA-MSM**    | 96M    | Multi-sequence alignments                  | MSA-based evolutionary modeling for RNA              |
+| **NT-V2**      | 96M    | 300B DNA tokens (850 species)              | Hybrid k-mer vocabulary, cross-species               |
+| **HyenaDNA**   | 47M    | Human reference genome                     | Long-context (160k-1M tokens) autoregressive model   |
+| **SpliceBERT** | 19M    | 2M pre-mRNA sequences                      | Fine-grained splice-site recognition                 |
+| **Caduceus**   | 1.9M   | Human chromosomes                          | Ultra-compact reverse-complement equivariant DNA LM  |
+| **RNA-BERT**   | 0.5M   | 4,000+ ncRNA families (Rfam)               | Compact RNA BERT with nucleotide-level masking       |
+
+**Complete Model List**: See Appendix E of the [paper](https://arxiv.org/pdf/2505.14402) for all 30+ supported models, including PlantRNA-FM, UTR-LM, MP-RNA, CALM, and more.
+
+**Model Access**: All models are available on HuggingFace Hub and can be loaded with `ModelHub.load("model-name")`.
+
+## Benchmarks
+
+OmniGenBench supports **five curated benchmark suites** covering both **sequence-level** and **structure-level** genomics tasks across species. All benchmarks are automatically downloaded from HuggingFace Hub on first use.
+
+| Suite        | Focus                       | #Tasks / Datasets        | Representative Tasks                                   |
+|--------------|-----------------------------|--------------------------|--------------------------------------------------------|
+| **RGB**      | RNA structure + function    | 12 tasks (SN-level)      | Secondary structure, solvent accessibility, degradation |
+| **BEACON**   | RNA (multi-domain)          | 13 tasks                 | Base pairing, mRNA design, RNA contact prediction      |
+| **PGB**      | Plant long-range DNA        | 7 categories             | PolyA signal, enhancer, chromatin, splice site (up to 50kb context) |
+| **GUE**      | DNA general understanding   | 36 datasets (9 tasks)    | TF binding, core promoter, enhancer, epigenetics       |
+| **GB**       | Classic DNA classification  | 9 datasets               | Human/mouse enhancers, promoter variant classification |
+
+**Evaluation Protocol**: All benchmarks follow standardized protocols with multi-seed evaluation (typically 3-5 runs) for statistical rigor. Results report mean ± standard deviation for each metric.
+
+**Accessing Benchmarks**: Use `AutoBench(benchmark="RGB")` or `ogb autobench --benchmark RGB` to automatically download and evaluate on any suite.
+
+
+## Tutorials
+
+### RNA Design
+
+RNA design is the inverse problem of RNA structure prediction: given a target secondary structure (in dot-bracket notation), design RNA sequences that fold into that structure. OmniGenBench provides both CLI and Python API for RNA sequence design using genetic algorithms enhanced with masked language modeling.
+
+#### CLI Usage
+```bash
+# Basic RNA design for a simple hairpin structure
+ogb rna_design --structure "(((...)))"
+
+# Design with custom parameters for better results
+ogb rna_design \
+    --structure "(((...)))" \
+    --model yangheng/OmniGenome-186M \
+    --mutation-ratio 0.3 \
+    --num-population 200 \
+    --num-generation 150 \
+    --output-file results.json
+
+# Design complex structure (stem-loop-stem)
+ogb rna_design \
+    --structure "(((..(((...)))..)))" \
+    --num-population 300 \
+    --num-generation 200 \
+    --output-file complex_design.json
+```
+
+**Note**: RNA design is now available through the unified `ogb` command interface.
+
+#### Python API Usage
+```python
+from omnigenbench import OmniModelForRNADesign
+
+# Initialize model
+model = OmniModelForRNADesign(model="yangheng/OmniGenome-186M")
+
+# Design sequences for target structure
+sequences = model.design(
+    structure="(((...)))",      # Target structure in dot-bracket notation
+    mutation_ratio=0.5,          # Mutation rate for genetic algorithm
+    num_population=100,          # Population size
+    num_generation=100           # Number of generations
+)
+
+print(f"Designed {len(sequences)} sequences:")
+for seq in sequences[:5]:
+    print(f"  {seq}")
+```
+
+**Key Features:**
+- 🧬 Multi-objective genetic algorithm with MLM-guided mutations
+- ⚡ Automatic GPU acceleration for large populations
+- 📊 Real-time progress tracking with early termination
+- 🎯 Returns multiple optimal solutions (up to 25 sequences)
+- 💾 JSON output format for downstream analysis
+
+**Common Structure Patterns:**
+- Simple hairpin: `"(((...)))"`
+- Stem-loop-stem: `"(((..(((...)))..)))"`
+- Multi-loop: `"(((...(((...)))..(((...))).)))"`
+- Long stem: `"((((((((....))))))))"`
+
+The comprehensive tutorials of RNA Design can be found in:
+- [RNA Design Examples](examples/rna_sequence_design/rna_design_examples.py) - Comprehensive examples
+- [RNA Design README](examples/rna_sequence_design/README.md) - Detailed documentation
+- [RNA Design Tutorial](examples/rna_sequence_design/RNA_Design_Tutorial.ipynb) - Interactive notebook
+
+You can find a visual demo of RNA Design [here](asset/RNADesign-Demo.gif).
+
+### RNA Secondary Structure Prediction
+
+RNA secondary structure prediction is a fundamental problem in computational biology,
+where the goal is to predict the secondary structure of an RNA sequence.
+In this demo, we show how to use OmniGenBench to predict the secondary structure of RNA sequences using a pre-trained model.
+The tutorials of RNA Secondary Structure Prediction can be found in
+[Secondary_Structure_Prediction_Tutorial.ipynb](examples/rna_secondary_structure_prediction/Secondary_Structure_Prediction_Tutorial.ipynb).
+
+You can find a visual example of RNA Secondary Structure Prediction [here](asset/RNASSP-Demo.gif).
+
+### More Tutorials
+Please find more usage tutorials in [examples](examples).
+
+## Citation
+```bibtex
+@article{yang2024omnigenbench,
+      title={OmniGenBench: A Modular Platform for Reproducible Genomic Foundation Models Benchmarking}, 
+      author={Heng Yang and Jack Cole, Yuan Li, Renzhi Chen, Geyong Min and Ke Li},
+      year={2024},
+      eprint={https://arxiv.org/abs/2505.14402},
+      archivePrefix={arXiv},
+      primaryClass={q-bio.GN},
+      url={https://arxiv.org/abs/2505.14402}, 
+}
+```
+## License
+OmniGenBench is licensed under the Apache License 2.0. See the LICENSE file for more information.
+
+
+## Contribution
+We welcome contributions to OmniGenBench! If you have any ideas, suggestions, or bug reports, please open an issue or submit a pull request on GitHub.

omnigenome-0.3.24a0.dist-info/RECORD

@@ -0,0 +1,7 @@
+omnigenome/__init__.py,sha256=2JNoPrnv-1lYXkBiuHBYVXp1OJiRD8c9j65qFeXJtQY,9436
+omnigenome-0.3.24a0.dist-info/licenses/LICENSE,sha256=oQoefBV6siHctF0ET-OO3EaSZgtqGtf-wdIAmokS8iY,11560
+omnigenome-0.3.24a0.dist-info/METADATA,sha256=02jVbily5lRdBnVrK6raLl6XNzODYp1arc7nRLFVlTc,15484
+omnigenome-0.3.24a0.dist-info/WHEEL,sha256=lTU6B6eIfYoiQJTZNc-fyaR6BpL6ehTzU3xGYxn2n8k,91
+omnigenome-0.3.24a0.dist-info/entry_points.txt,sha256=uu40UgMPxY65ASdRbrhkwH94r7CIYgyG_iDBmqFQbD8,84
+omnigenome-0.3.24a0.dist-info/top_level.txt,sha256=LVFxm_WPaxjj9KnAqdW94W4D4lbOk30gdsaKlJiSzTo,11
+omnigenome-0.3.24a0.dist-info/RECORD,,

omnigenome-0.3.22a0.dist-info/METADATA

@@ -1,253 +0,0 @@
-Metadata-Version: 2.4
-Name: omnigenome
-Version: 0.3.22a0
-Summary: OmniGenome: A comprehensive toolkit for genome analysis.
-Home-page: https://github.com/yangheng95/OmniGenBench
-Author: Yang, Heng
-Author-email: hy345@exeter.ac.uk
-License: Apache-2.0
-Platform: Windows
-Platform: Linux
-Platform: Mac OS-X
-Classifier: Development Status :: 3 - Alpha
-Classifier: Intended Audience :: Science/Research
-Classifier: License :: OSI Approved :: Apache Software License
-Classifier: Programming Language :: Python :: 3.10
-Classifier: Programming Language :: Python :: 3.11
-Classifier: Programming Language :: Python :: 3.12
-Classifier: Operating System :: OS Independent
-Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
-Requires-Python: >=3.10
-Description-Content-Type: text/markdown
-License-File: LICENSE
-Requires-Dist: omnigenbench>=0.3.3
-Requires-Dist: findfile>=2.0.0
-Requires-Dist: autocuda>=0.16
-Requires-Dist: metric-visualizer>=0.9.6
-Requires-Dist: termcolor
-Requires-Dist: gitpython
-Requires-Dist: torch>=2.6.0
-Requires-Dist: pandas
-Requires-Dist: viennarna
-Requires-Dist: scikit-learn
-Requires-Dist: accelerate
-Requires-Dist: transformers>=4.46.0
-Requires-Dist: packaging
-Requires-Dist: peft
-Requires-Dist: dill
-Provides-Extra: dev
-Requires-Dist: dill; extra == "dev"
-Requires-Dist: pytest; extra == "dev"
-Dynamic: author
-Dynamic: author-email
-Dynamic: classifier
-Dynamic: description
-Dynamic: description-content-type
-Dynamic: home-page
-Dynamic: license
-Dynamic: license-file
-Dynamic: platform
-Dynamic: provides-extra
-Dynamic: requires-dist
-Dynamic: requires-python
-Dynamic: summary
-
-[//]: # (![favicon.png](asset/favicon.png))
-
-[//]: # (<h3 align="center">OmniGenBench provides an all-in-one solution for genomic foundation model finetuning, inference, deployment and automated benchmarking, designed for research and applications in genomics.</h3>)
-
-<div align="center">
-
-  <a href="https://omnigenbenchdoc.readthedocs.io/en/latest/">
-    <img src="https://img.shields.io/readthedocs/omnigenbench?logo=readthedocs&logoColor=white" alt="Documentation Status" />
-  </a>
-
-  <a href="https://pypi.org/project/omnigenome/">
-    <img src="https://img.shields.io/pypi/v/omnigenome?color=blue&label=PyPI" alt="PyPI" />
-  </a>
-
-  <a href="https://pepy.tech/project/omnigenome">
-    <img src="https://static.pepy.tech/badge/omnigenome" alt="PyPI Downloads" />
-  </a>
-
-  <a href="https://pypi.org/project/omnigenbench/">
-    <img src="https://img.shields.io/pypi/pyversions/omnigenome" alt="Python Version" />
-  </a>
-
-  <a href="https://github.com/yangheng95/omnigenome/blob/main/LICENSE">
-    <img src="https://img.shields.io/github/license/yangheng95/omnigenome" alt="License" />
-  </a>
-
-</div>
-<h3 align="center">
-  <a href="#installation">📦 Installation</a>
-  <span> · </span>
-  <a href="#quick-start">🚀 Getting Started</a>
-  <span> · </span>
-  <a href="#supported-models">🧬 Model Support</a>
-  <span> · </span>
-  <a href="#benchmarks">📊 Benchmarks </a>
-  <span> · </span>
-  <a href="#tutorials">🧪 Application Tutorials</a>
-  <span> · </span>
-  <a href="https://arxiv.org/pdf/2505.14402">📚 Paper</a>
-</h3>
-
-
-## 🔍 What You Can Do with OmniGenBench?
-
-- 🧬 **Benchmark effortlessly** — Run automated and reproducible evaluations for genomic foundation models  
-- 🧠 **Understand your models** — Explore interpretability across diverse tasks and species  
-- ⚙️ **Run tutorials instantly** — Use click-to-run guides for genomic sequence modeling  
-- 🚀 **Fine-tune and infer efficiently** — Accelerated workflows for fine-tuning and inference on GFMs on downstream tasks
-
-## Installation
-
-### Requirements
-Before installing OmniGenoBench, you need to install the following dependencies: 
-- Python 3.10+
-- PyTorch 2.5+
-- Transformers 4.46.0+
-
-### PyPI Installation
-To install OmniGenoBench, you can use pip:
-```bash
-pip install omnigenbench -U
-```
-
-### Source Installation
-Or you can clone the repository and install it from source:
-```bash
-git clone https://github.com/yangheng95/OmniGenBench.git
-cd OmniGenBench
-pip install -e .
-```
-
-## Quick Start
-`OmniGenBench is available for diverse models and benchmark suites, please refer to the following sections for more details.`
-
-### Auto-inference via CLI
-Run inference with fine-tuned models on genomic sequences:
-```bash
-# Single sequence inference
-ogb autoinfer --model yangheng/ogb_tfb_finetuned --sequence "ATCGATCGATCGATCG" --output-file predictions.json
-
-# Batch inference from file
-ogb autoinfer --model yangheng/ogb_te_finetuned --input-file sequences.json --batch-size 64 --output-file results.json
-
-# Legacy command (still supported)
-autoinfer --model yangheng/ogb_tfb_finetuned --sequence "ATCGATCGATCG"
-```
-
-### Auto-inference via Python API
-Or use the Python API for programmatic inference:
-```python
-from omnigenbench import ModelHub
-
-model = ModelHub.load("yangheng/ogb_tfb_finetuned")
-outputs = model.inference("ATCGATCGATCGATCGATCGATCGATCGATCG")
-print(outputs)  # {'predictions': array([1, 0, 1, ...]), 'probabilities': array([0.92, 0.15, ...])}
-```
-You can find more examples in the [Getting Started Guide](docs/GETTING_STARTED.md) and [AutoInfer Examples](examples/autoinfer_examples/).
-
-### Auto-benchmark via CLI
-The following command will download the model from the Hugging Face model hub and run the benchmark on the RGB benchmark:
-```bash
-# New unified command
-ogb autobench --model yangheng/OmniGenome-186M --benchmark RGB --trainer accelerate
-
-# Legacy command (still supported)
-autobench --model_name_or_path "yangheng/OmniGenome-186M" --benchmark "RGB" --trainer accelerate
-```
-You can find a visualization of AutoBench [here](asset/AutoBench.gif).
-
-### Auto-benchmark via Python API
-Or you can use the following python code to run the auto-benchmark:
-```python
-from omnigenbench import AutoBench
-gfm = 'LongSafari/hyenadna-medium-160k-seqlen-hf'
-# benchmark could be "RGB", "GB", "PGB", "GUE", which will be downloaded from the Hugging Face model hub
-benchmark = "RGB"
-bench_size = 8
-seeds = [0, 1, 2, 3, 4]
-bench = AutoBench(benchmark=benchmark, model_name_or_path=gfm, overwrite=False)
-bench.run(autocast=False, batch_size=bench_size, seeds=seeds)
-```
-You can find an example of AutoBench via Python API [here](examples/autobench_gfm_evaluation/benchmarking_with_lora.ipynb).
-
-
-## Supported Models
-
-
-OmniGenBench provides plug-and-play evaluation for over **30 genomic foundation models**, covering both **RNA** and **DNA** modalities. The following are highlights:
-
-| Model          | Params | Pre-training Corpus                        | Highlights                                          |
-|----------------|--------|--------------------------------------------|-----------------------------------------------------|
-| **OmniGenome** | 186M   | 54B plant RNA+DNA tokens                   | Multi-modal, structure-aware encoder                |
-| **Agro-NT-1B** | 985M   | 48 edible-plant genomes                    | Billion-scale DNA LM w/ NT-V2 k-mer vocab           |
-| **RiNALMo**    | 651M   | 36M ncRNA sequences                        | Largest public RNA LM; FlashAttention-2             |
-| **DNABERT-2**  | 117M   | 32B DNA tokens, 136 species (BPE)          | Byte-pair encoding; 2nd-gen DNA BERT                |
-| **RNA-FM**     | 96M    | 23M ncRNA sequences                        | High performance on RNA structure tasks             |
-| **RNA-MSM**    | 96M    | Multi-sequence alignments                  | MSA-based evolutionary RNA LM                       |
-| **NT-V2**      | 96M    | 300B DNA tokens (850 species)              | Hybrid k-mer vocabulary                             |
-| **HyenaDNA**   | 47M    | Human chromosomes                          | Long-context autoregressive model (1Mb)             |
-| **SpliceBERT** | 19M    | 2M pre-mRNA sequences                      | Fine-grained splice-site recognition                |
-| **Caduceus**   | 1.9M   | Human chromosomes                          | Ultra-compact DNA LM (RC-equivariant)               |
-| **RNA-BERT**   | 0.5M   | 4,000+ ncRNA families                      | Small BERT with nucleotide masking                  |
-| *...and more*  | —      | See Appendix E of the paper                | Includes PlantRNA-FM, UTR-LM, MP-RNA, CALM, etc.    |
-
-## Benchmarks
-
-OmniGenBench supports five curated benchmark suites covering both **sequence-level** and **structure-level** genomics tasks across species.
-
-| Suite        | Focus                       | #Tasks / Datasets        | Sample Tasks                                         |
-|--------------|-----------------------------|--------------------------|------------------------------------------------------|
-| **RGB**      | RNA structure + function    | 12 tasks (SN-level)      | RNA secondary structure, SNMR, degradation prediction |
-| **BEACON**   | RNA (multi-domain)          | 13 tasks                 | Base pairing, mRNA design, RNA contact maps         |
-| **PGB**      | Plant long-range DNA        | 7 categories             | PolyA, enhancer, chromatin access, splice site      |
-| **GUE**      | DNA general tasks           | 36 datasets (9 tasks)    | TF binding, core promoter, enhancer detection       |
-| **GB**       | Classic DNA classification  | 9 datasets               | Human/mouse enhancer, promoter variant classification|
-
-
-## Tutorials
-
-### RNA Design
-RNA design is a fundamental problem in synthetic biology,
-where the goal is to design RNA sequences that fold into a target structure.
-In this demo, we show how to use OmniGenoBench to design RNA sequences 
-that fold into a target structure using a pre-trained model.
-The tutorials of RNA Design Demo can be found in [RNA_Design_Tutorial.ipynb](examples/rna_sequence_design/RNA_Design_Tutorial.ipynb).
-
-You can find a visual example of RNA Design [here](asset/RNADesign-Demo.gif).
-
-### RNA Secondary Structure Prediction
-
-RNA secondary structure prediction is a fundamental problem in computational biology,
-where the goal is to predict the secondary structure of an RNA sequence.
-In this demo, we show how to use OmniGenoBench to predict the secondary structure of RNA sequences using a pre-trained model.
-The tutorials of RNA Secondary Structure Prediction can be found in
-[Secondary_Structure_Prediction_Tutorial.ipynb](examples/rna_secondary_structure_prediction/Secondary_Structure_Prediction_Tutorial.ipynb).
-
-You can find a visual example of RNA Secondary Structure Prediction [here](asset/RNASSP-Demo.gif).
-
-### More Tutorials
-Please find more usage tutorials in [examples](examples).
-
-## Citation
-```bibtex
-@article{yang2024omnigenbench,
-      title={OmniGenBench: A Modular Platform for Reproducible Genomic Foundation Models Benchmarking}, 
-      author={Heng Yang and Jack Cole, Yuan Li, Renzhi Chen, Geyong Min and Ke Li},
-      year={2024},
-      eprint={https://arxiv.org/abs/2505.14402},
-      archivePrefix={arXiv},
-      primaryClass={q-bio.GN},
-      url={https://arxiv.org/abs/2505.14402}, 
-}
-```
-## License
-OmniGenBench is licensed under the Apache License 2.0. See the LICENSE file for more information.
-
-
-## Contribution
-We welcome contributions to OmniGenBench! If you have any ideas, suggestions, or bug reports, please open an issue or submit a pull request on GitHub.

omnigenome-0.3.22a0.dist-info/RECORD

@@ -1,7 +0,0 @@
-omnigenome/__init__.py,sha256=2JNoPrnv-1lYXkBiuHBYVXp1OJiRD8c9j65qFeXJtQY,9436
-omnigenome-0.3.22a0.dist-info/licenses/LICENSE,sha256=oQoefBV6siHctF0ET-OO3EaSZgtqGtf-wdIAmokS8iY,11560
-omnigenome-0.3.22a0.dist-info/METADATA,sha256=Z8pqBMfX0aGOuCZ-SmPGPHBJtgjZQNafPwUsOB6mIHs,11520
-omnigenome-0.3.22a0.dist-info/WHEEL,sha256=lTU6B6eIfYoiQJTZNc-fyaR6BpL6ehTzU3xGYxn2n8k,91
-omnigenome-0.3.22a0.dist-info/entry_points.txt,sha256=uu40UgMPxY65ASdRbrhkwH94r7CIYgyG_iDBmqFQbD8,84
-omnigenome-0.3.22a0.dist-info/top_level.txt,sha256=LVFxm_WPaxjj9KnAqdW94W4D4lbOk30gdsaKlJiSzTo,11
-omnigenome-0.3.22a0.dist-info/RECORD,,