omnigenome 0.3.20a0__py3-none-any.whl → 0.3.22a0__py3-none-any.whl

{omnigenome-0.3.20a0.dist-info → omnigenome-0.3.22a0.dist-info}/METADATA

@@ -1,6 +1,6 @@
 Metadata-Version: 2.4
 Name: omnigenome
-Version: 0.3.20a0
+Version: 0.3.22a0
 Summary: OmniGenome: A comprehensive toolkit for genome analysis.
 Home-page: https://github.com/yangheng95/OmniGenBench
 Author: Yang, Heng
@@ -52,9 +52,9 @@ Dynamic: requires-dist
 Dynamic: requires-python
 Dynamic: summary
 
-![favicon.png](asset/favicon.png)
+[//]: # (![favicon.png](asset/favicon.png))
 
-<h3 align="center">OmniGenBench provides an all-in-one solution for genomic foundation model finetuning, inference, deployment and automated benchmarking, designed for research and applications in genomics.</h3>
+[//]: # (<h3 align="center">OmniGenBench provides an all-in-one solution for genomic foundation model finetuning, inference, deployment and automated benchmarking, designed for research and applications in genomics.</h3>)
 
 <div align="center">
 
@@ -124,15 +124,43 @@ pip install -e .
 ```
 
 ## Quick Start
-`OmniGenBench is available for diverse models and benchmark suites, please refer to the  following sections for more details.`
+`OmniGenBench is available for diverse models and benchmark suites, please refer to the following sections for more details.`
+
+### Auto-inference via CLI
+Run inference with fine-tuned models on genomic sequences:
+```bash
+# Single sequence inference
+ogb autoinfer --model yangheng/ogb_tfb_finetuned --sequence "ATCGATCGATCGATCG" --output-file predictions.json
+
+# Batch inference from file
+ogb autoinfer --model yangheng/ogb_te_finetuned --input-file sequences.json --batch-size 64 --output-file results.json
+
+# Legacy command (still supported)
+autoinfer --model yangheng/ogb_tfb_finetuned --sequence "ATCGATCGATCG"
+```
+
+### Auto-inference via Python API
+Or use the Python API for programmatic inference:
+```python
+from omnigenbench import ModelHub
+
+model = ModelHub.load("yangheng/ogb_tfb_finetuned")
+outputs = model.inference("ATCGATCGATCGATCGATCGATCGATCGATCG")
+print(outputs)  # {'predictions': array([1, 0, 1, ...]), 'probabilities': array([0.92, 0.15, ...])}
+```
+You can find more examples in the [Getting Started Guide](docs/GETTING_STARTED.md) and [AutoInfer Examples](examples/autoinfer_examples/).
+
 ### Auto-benchmark via CLI
 The following command will download the model from the Hugging Face model hub and run the benchmark on the RGB benchmark:
 ```bash
+# New unified command
+ogb autobench --model yangheng/OmniGenome-186M --benchmark RGB --trainer accelerate
+
+# Legacy command (still supported)
 autobench --model_name_or_path "yangheng/OmniGenome-186M" --benchmark "RGB" --trainer accelerate
 ```
 You can find a visualization of AutoBench [here](asset/AutoBench.gif).
 
-
 ### Auto-benchmark via Python API
 Or you can use the following python code to run the auto-benchmark:
 ```python

omnigenome-0.3.22a0.dist-info/RECORD

@@ -0,0 +1,7 @@
+omnigenome/__init__.py,sha256=2JNoPrnv-1lYXkBiuHBYVXp1OJiRD8c9j65qFeXJtQY,9436
+omnigenome-0.3.22a0.dist-info/licenses/LICENSE,sha256=oQoefBV6siHctF0ET-OO3EaSZgtqGtf-wdIAmokS8iY,11560
+omnigenome-0.3.22a0.dist-info/METADATA,sha256=Z8pqBMfX0aGOuCZ-SmPGPHBJtgjZQNafPwUsOB6mIHs,11520
+omnigenome-0.3.22a0.dist-info/WHEEL,sha256=lTU6B6eIfYoiQJTZNc-fyaR6BpL6ehTzU3xGYxn2n8k,91
+omnigenome-0.3.22a0.dist-info/entry_points.txt,sha256=uu40UgMPxY65ASdRbrhkwH94r7CIYgyG_iDBmqFQbD8,84
+omnigenome-0.3.22a0.dist-info/top_level.txt,sha256=LVFxm_WPaxjj9KnAqdW94W4D4lbOk30gdsaKlJiSzTo,11
+omnigenome-0.3.22a0.dist-info/RECORD,,

omnigenome-0.3.20a0.dist-info/RECORD

@@ -1,7 +0,0 @@
-omnigenome/__init__.py,sha256=2JNoPrnv-1lYXkBiuHBYVXp1OJiRD8c9j65qFeXJtQY,9436
-omnigenome-0.3.20a0.dist-info/licenses/LICENSE,sha256=oQoefBV6siHctF0ET-OO3EaSZgtqGtf-wdIAmokS8iY,11560
-omnigenome-0.3.20a0.dist-info/METADATA,sha256=V3BwmtiALsj06c7qVDo5eE93HMxhh2HyCqv0k5861uk,10344
-omnigenome-0.3.20a0.dist-info/WHEEL,sha256=lTU6B6eIfYoiQJTZNc-fyaR6BpL6ehTzU3xGYxn2n8k,91
-omnigenome-0.3.20a0.dist-info/entry_points.txt,sha256=uu40UgMPxY65ASdRbrhkwH94r7CIYgyG_iDBmqFQbD8,84
-omnigenome-0.3.20a0.dist-info/top_level.txt,sha256=LVFxm_WPaxjj9KnAqdW94W4D4lbOk30gdsaKlJiSzTo,11
-omnigenome-0.3.20a0.dist-info/RECORD,,