offtracker 2.7.7__zip → 2.7.10__zip

offtracker-2.7.10/PKG-INFO

@@ -0,0 +1,189 @@
+Metadata-Version: 2.1
+Name: offtracker
+Version: 2.7.10
+Summary: Tracking-seq data analysis
+Home-page: https://github.com/Lan-lab/offtracker
+Author: Runda Xu
+Author-email: runda.xu@foxmail.com
+Requires-Python: >=3.6.0
+Description-Content-Type: text/markdown
+License-File: LICENSE.txt
+
+
+# OFF-TRACKER
+
+OFF-TRACKER is an end to end pipeline of Tracking-seq data analysis for detecting off-target sites of any genome editing tools that generate double-strand breaks (DSBs) or single-strand breaks (SSBs).
+
+## System requirements
+
+* Linux/Unix 
+* Python >= 3.6
+
+## Dependency
+
+```bash
+# We recommend creating a new enviroment using mamba/conda to avoid compatibility problems
+# If you don't use mamba, just replace the code with conda 
+mamba create -n offtracker -c bioconda blast snakemake pybedtools
+```
+
+
+## Installation 
+
+```bash
+# Activate the environment
+conda activate offtracker
+
+# Direct installation with pip
+pip install offtracker
+
+# (Alternative) Download the offtracker from github
+git clone https://github.com/Lan-lab/offtracker.git 
+cd offtracker
+pip install .
+```
+
+
+## Before analyzing samples
+
+```bash
+# Build blast index (only need once for each genome)
+makeblastdb -input_type fasta -title hg38 -dbtype nucl -parse_seqids \
+-in /Your_Path_To_Reference/hg38_genome.fa \
+-out /Your_Path_To_Reference/hg38_genome.blastdb \
+-logfile /Your_Path_To_Reference/hg38_genome.blastdb.log
+
+# Build chromap index (only need once for each genome)
+chromap -i -r /Your_Path_To_Reference/hg38_genome.fa \
+-o /Your_Path_To_Reference/hg38_genome.chromap.index
+
+# Generate candidate regions by sgRNA sequence (need once for each genome and sgRNA)
+# --name: the name of the sgRNA, which will be used in the following analysis
+offtracker_candidates.py -t 8 -g hg38 \
+-r /Your_Path_To_Reference/hg38_genome.fa \
+-b /Your_Path_To_Reference/hg38_genome.blastdb \
+--name 'VEGFA2' --sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG' \
+-o /Your_Path_To_Candidates
+
+```
+
+## Strand-specific mapping of Tracking-seq data 
+
+```bash
+# Generate snakemake config file 
+# --subfolder: If different samples are in seperate folders, set this to 1
+# if -o is not set, the output will be in the same folder as the fastq files
+offtracker_config.py -t 8 -g hg38 --blacklist hg38 \
+-r /Your_Path_To_Reference/hg38_genome.fa \
+-i /Your_Path_To_Reference/hg38_genome.chromap.index \
+-f /Your_Path_To_Fastq \
+-o /Your_Path_To_Output \ 
+--subfolder 0 
+
+# Run the snakemake program
+cd /Your_Path_To_Fastq
+snakemake -np # dry run
+nohup snakemake --cores 16 1>snakemake.log 2>snakemake.err &
+
+## about cores
+# --cores of snakemake must be larger than -t of offtracker_config.py
+# parallel number = cores/t
+
+## about output
+# This part will generate "*.fw.scaled.bw" and ".rv.scaled.bw" for IGV visualization
+# "*.fw.bed" and "*.rv.bed" are used in the next part.
+```
+
+
+## Analyzing the genome-wide off-target sites
+
+```bash
+# In this part, multiple samples in the same condition can be analyzed in a single run by pattern recogonization of sample names
+
+offtracker_analysis.py -g hg38 --name "VEGFA2" \
+--exp 'Cas9_VEGFA2' \
+--control 'WT' \
+--outname 'Cas9_VEGFA_293' \
+-f /Your_Path_To_Output \
+--seqfolder /Your_Path_To_Candidates
+
+# --name: the same gRNA name you set when running offtracker_candidates.py
+# --exp/--control: add one or multiple patterns of file name in regular expressions
+# If multiple samples meet the pattern, their signals will be averaged. Thus, only samples with the same condition should be included in a single analysis.
+
+# This step will generate Offtracker_result_{outname}.csv
+# Default FDR is 0.05, which can be changed by --fdr. This will empirically make the threshold of Track score around 2.
+# Sites with Track score >=2, which is a empirical threshold, are output regardless of FDR.
+# Intermediate files are saved in ./temp folder, which can be deleted.
+# Keeping the intermediate files can make the analysis faster if involving previously analyzed samples (e.g. using the same control samples for different analyses)
+```
+
+## Off-target sequences visualization
+
+```bash
+# After get the Offtracker_result_{outname}.csv, you can visualize the off-target sites with their genomic sequence with the following command:
+
+offtracker_plot.py --result Your_Offtracker_Result_CSV \
+--sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG'
+
+# The default output is a pdf file with Offtracker_result_{outname}.pdf
+# Change the suffix of the output file to change the format (e.g.: .png)
+# The orange dash line indicates the empirical threshold of Track score = 2
+# Empirically, the off-target sites with Track score < 2 are less likely to be real off-target sites.
+```
+
+
+## Note1
+
+The default setting only includes chr1-chr22, chrX, chrY, and chrM. Please make sure the reference genome contains "chr" at the beginning. 
+
+Currently, this software is only ready-to-use for mm10 and hg38. For any other genome, e.g., hg19, please add genome size file named "hg19.chrom.sizes" to .\offtracker\mapping and instal manually. Besides, add "--blacklist none" or "--blacklist Your_Blacklist" (e.g., ENCODE blacklist) when running offtracker_config.py, because we only provide blacklists for mm10 and hg38.
+
+If you have a requirement for species other than human/mouse, please post an issue.
+
+## Note2
+
+The FDRs in the Tracking-seq result do not reflect the real off-target probability.
+It is strongly recommended to observe the "fw.scaled.bw" and "rv.scaled.bw" using genome browser like IGV to visually inspect each target location from the Tracking-seq result.
+
+
+
+# Example Data
+
+Here are example data that contains reads of chr6 from HEK293T cells edited with Cas9 + sgRNA VEGFA2 and wild type cells:
+
+https://figshare.com/articles/dataset/WT_HEK239T_chr6/25956034
+
+It takes about 5-10 minutes to run the mapping (offtracker_config.py & snakemake) of example data with -t 8 and --cores 16 (2 parallel tasks)
+
+## Signal visualization
+
+After mapping, there will be 4 .bw files in the output folder:
+```bash
+Cas9_VEGFA2_chr6.fw.scaled.bw
+
+Cas9_VEGFA2_chr6.rv.scaled.bw
+
+WT_chr6.fw.scaled.bw
+
+WT_chr6.rv.scaled.bw
+```
+These files can be visualized in genome browser like IGV:
+
+![signal](https://github.com/Lan-lab/offtracker/blob/main/example_output/signals_example.png?raw=true)
+
+
+## Whole genome off-target analysis
+
+For analyzing the signals (offtracker_analysis.py), it takes about 3-5 minutes and outputs a file named "Offtracker_result_{outname}.csv"
+
+After that, you can visualize the off-target sites with their genomic sequence (offtracker_plot.py) and get an image like this:
+
+![offtarget](https://github.com/Lan-lab/offtracker/blob/main/example_output/sequences_example.png?raw=true)
+
+# Citation
+
+
+
+
+

offtracker-2.7.10/README.md

@@ -0,0 +1,177 @@
+# OFF-TRACKER
+
+OFF-TRACKER is an end to end pipeline of Tracking-seq data analysis for detecting off-target sites of any genome editing tools that generate double-strand breaks (DSBs) or single-strand breaks (SSBs).
+
+## System requirements
+
+* Linux/Unix 
+* Python >= 3.6
+
+## Dependency
+
+```bash
+# We recommend creating a new enviroment using mamba/conda to avoid compatibility problems
+# If you don't use mamba, just replace the code with conda 
+mamba create -n offtracker -c bioconda blast snakemake pybedtools
+```
+
+
+## Installation 
+
+```bash
+# Activate the environment
+conda activate offtracker
+
+# Direct installation with pip
+pip install offtracker
+
+# (Alternative) Download the offtracker from github
+git clone https://github.com/Lan-lab/offtracker.git 
+cd offtracker
+pip install .
+```
+
+
+## Before analyzing samples
+
+```bash
+# Build blast index (only need once for each genome)
+makeblastdb -input_type fasta -title hg38 -dbtype nucl -parse_seqids \
+-in /Your_Path_To_Reference/hg38_genome.fa \
+-out /Your_Path_To_Reference/hg38_genome.blastdb \
+-logfile /Your_Path_To_Reference/hg38_genome.blastdb.log
+
+# Build chromap index (only need once for each genome)
+chromap -i -r /Your_Path_To_Reference/hg38_genome.fa \
+-o /Your_Path_To_Reference/hg38_genome.chromap.index
+
+# Generate candidate regions by sgRNA sequence (need once for each genome and sgRNA)
+# --name: the name of the sgRNA, which will be used in the following analysis
+offtracker_candidates.py -t 8 -g hg38 \
+-r /Your_Path_To_Reference/hg38_genome.fa \
+-b /Your_Path_To_Reference/hg38_genome.blastdb \
+--name 'VEGFA2' --sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG' \
+-o /Your_Path_To_Candidates
+
+```
+
+## Strand-specific mapping of Tracking-seq data 
+
+```bash
+# Generate snakemake config file 
+# --subfolder: If different samples are in seperate folders, set this to 1
+# if -o is not set, the output will be in the same folder as the fastq files
+offtracker_config.py -t 8 -g hg38 --blacklist hg38 \
+-r /Your_Path_To_Reference/hg38_genome.fa \
+-i /Your_Path_To_Reference/hg38_genome.chromap.index \
+-f /Your_Path_To_Fastq \
+-o /Your_Path_To_Output \ 
+--subfolder 0 
+
+# Run the snakemake program
+cd /Your_Path_To_Fastq
+snakemake -np # dry run
+nohup snakemake --cores 16 1>snakemake.log 2>snakemake.err &
+
+## about cores
+# --cores of snakemake must be larger than -t of offtracker_config.py
+# parallel number = cores/t
+
+## about output
+# This part will generate "*.fw.scaled.bw" and ".rv.scaled.bw" for IGV visualization
+# "*.fw.bed" and "*.rv.bed" are used in the next part.
+```
+
+
+## Analyzing the genome-wide off-target sites
+
+```bash
+# In this part, multiple samples in the same condition can be analyzed in a single run by pattern recogonization of sample names
+
+offtracker_analysis.py -g hg38 --name "VEGFA2" \
+--exp 'Cas9_VEGFA2' \
+--control 'WT' \
+--outname 'Cas9_VEGFA_293' \
+-f /Your_Path_To_Output \
+--seqfolder /Your_Path_To_Candidates
+
+# --name: the same gRNA name you set when running offtracker_candidates.py
+# --exp/--control: add one or multiple patterns of file name in regular expressions
+# If multiple samples meet the pattern, their signals will be averaged. Thus, only samples with the same condition should be included in a single analysis.
+
+# This step will generate Offtracker_result_{outname}.csv
+# Default FDR is 0.05, which can be changed by --fdr. This will empirically make the threshold of Track score around 2.
+# Sites with Track score >=2, which is a empirical threshold, are output regardless of FDR.
+# Intermediate files are saved in ./temp folder, which can be deleted.
+# Keeping the intermediate files can make the analysis faster if involving previously analyzed samples (e.g. using the same control samples for different analyses)
+```
+
+## Off-target sequences visualization
+
+```bash
+# After get the Offtracker_result_{outname}.csv, you can visualize the off-target sites with their genomic sequence with the following command:
+
+offtracker_plot.py --result Your_Offtracker_Result_CSV \
+--sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG'
+
+# The default output is a pdf file with Offtracker_result_{outname}.pdf
+# Change the suffix of the output file to change the format (e.g.: .png)
+# The orange dash line indicates the empirical threshold of Track score = 2
+# Empirically, the off-target sites with Track score < 2 are less likely to be real off-target sites.
+```
+
+
+## Note1
+
+The default setting only includes chr1-chr22, chrX, chrY, and chrM. Please make sure the reference genome contains "chr" at the beginning. 
+
+Currently, this software is only ready-to-use for mm10 and hg38. For any other genome, e.g., hg19, please add genome size file named "hg19.chrom.sizes" to .\offtracker\mapping and instal manually. Besides, add "--blacklist none" or "--blacklist Your_Blacklist" (e.g., ENCODE blacklist) when running offtracker_config.py, because we only provide blacklists for mm10 and hg38.
+
+If you have a requirement for species other than human/mouse, please post an issue.
+
+## Note2
+
+The FDRs in the Tracking-seq result do not reflect the real off-target probability.
+It is strongly recommended to observe the "fw.scaled.bw" and "rv.scaled.bw" using genome browser like IGV to visually inspect each target location from the Tracking-seq result.
+
+
+
+# Example Data
+
+Here are example data that contains reads of chr6 from HEK293T cells edited with Cas9 + sgRNA VEGFA2 and wild type cells:
+
+https://figshare.com/articles/dataset/WT_HEK239T_chr6/25956034
+
+It takes about 5-10 minutes to run the mapping (offtracker_config.py & snakemake) of example data with -t 8 and --cores 16 (2 parallel tasks)
+
+## Signal visualization
+
+After mapping, there will be 4 .bw files in the output folder:
+```bash
+Cas9_VEGFA2_chr6.fw.scaled.bw
+
+Cas9_VEGFA2_chr6.rv.scaled.bw
+
+WT_chr6.fw.scaled.bw
+
+WT_chr6.rv.scaled.bw
+```
+These files can be visualized in genome browser like IGV:
+
+![signal](https://github.com/Lan-lab/offtracker/blob/main/example_output/signals_example.png?raw=true)
+
+
+## Whole genome off-target analysis
+
+For analyzing the signals (offtracker_analysis.py), it takes about 3-5 minutes and outputs a file named "Offtracker_result_{outname}.csv"
+
+After that, you can visualize the off-target sites with their genomic sequence (offtracker_plot.py) and get an image like this:
+
+![offtarget](https://github.com/Lan-lab/offtracker/blob/main/example_output/sequences_example.png?raw=true)
+
+# Citation
+
+
+
+
+