offtracker 2.13.2__zip → 2.14.0__zip

offtracker-2.13.2/README.md → offtracker-2.14.0/offtracker.egg-info/PKG-INFO

@@ -1,247 +1,273 @@
-# Offtracker
-
-Offtracker is an end to end pipeline of Tracking-seq data analysis for detecting off-target sites of any genome editing tools that generate double-strand breaks (DSBs) or single-strand breaks (SSBs).
-
-## System requirements
-
-* Linux/Unix 
-* Python >= 3.6
-
-## Dependency
-
-```bash
-# We recommend creating a new environment using mamba/conda to avoid compatibility problems
-# If you don't use mamba, just replace the code with conda 
-# Windows systems may not be compatible with pybedtools.
-mamba create -n offtracker -c bioconda blast snakemake pybedtools deeptools chromap
-```
-
-
-## Installation 
-
-
-```bash
-# Activate the environment
-conda activate offtracker
-
-# Direct installation with pip
-pip install offtracker
-
-# (Alternative) Download the offtracker from github
-git clone https://github.com/Lan-lab/offtracker.git 
-cd offtracker
-pip install .
-```
-
-
-## Before analyzing samples
-
-**Important: Do not use hard-masked genome.fa**, in which repeats are masked by capital Ns and reads should have been mapped to these region (e.g. MHC region) will be lost. Besides, the genome.fa **should not** contain alternate loci like chr2_KI270776v1_alt and chr6_GL000256v2_alt, which may cause multi-mappings and the reads may be discarded.
-
-For example, https://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz is soft-masked genome with alternate loci. https://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.masked.gz is hard-masked genome. **Do not** use these two as reference genome.
-
-http://cistrome.org/~galib/MAESTRO/references/scATAC/Refdata_scATAC_MAESTRO_GRCh38_1.1.0.tar.gz is the genome used for the example data.
-
-```bash
-# The following command can be used to check whether alternate loci of chr6 are present in the reference genome.
-grep "^>chr6" genome.fa
-```
-
-```bash
-# Build chromap index (only need once for each genome)
-chromap -i -r /Your_Path_To_Reference/hg38_genome.fa \
--o /Your_Path_To_Reference/hg38_genome.chromap.index
-
-# Build blast index (only need once for each genome)
-makeblastdb -input_type fasta -title hg38 -dbtype nucl -parse_seqids \
--in /Your_Path_To_Reference/hg38_genome.fa \
--out /Your_Path_To_Reference/hg38_genome.blastdb \
--logfile /Your_Path_To_Reference/hg38_genome.blastdb.log
-
-# Generate candidate regions by sgRNA sequence (need once for each genome and sgRNA)
-# --name: a user-defined name of the sgRNA, which will be used in the following analysis.
-offtracker_candidates.py -t 8 -g hg38 \
--r /Your_Path_To_Reference/hg38_genome.fa \
--b /Your_Path_To_Reference/hg38_genome.blastdb \
---name 'VEGFA2' --sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG' \
--o /Your_Path_To_Candidates_Folder
-
-# if analyzing Cas12a, whose pam is upstream of the sgRNA, add this:
---pam_location 'upstream'
-
-```
-
-
-## Quality control and adapter trimming
-
-```bash
-# Generate snakemake config file for quality control and adapter trimming.
-offtracker_qc.py -t 4 \
--f /Your_Path_To_Input_Folder \
---subfolder 0
-
-cd /Your_Path_To_Input_Folder/Trimmed_data
-snakemake -np # dry run to check whether everything is alright
-nohup snakemake --cores 16 1>${outdir}/sm_qc.log 2>&1 &
-
-"""
-Set “--subfolder 0” if the file structure is like: 
-| - Input_Folder
-  | - sample1_R1.fastq.gz
-  | - sample1_R2.fastq.gz
-  | - sample2_R1.fastq.gz
-  | - sample2_R2.fastq.gz
-Set “--subfolder 1” if the file structure is like:
-| - Input_Folder
-  | - Sample1_Folder
-    | - sample1_R1.fastq.gz
-    | - sample1_R2.fastq.gz
-  | - Sample2_Folder
-    | - sample2_R1.fastq.gz
-    | - sample2_R2.fastq.gz
-
-The script “offtracker_qc.py” will create a “Trimmed_data” folder under /Your_Path_To_Input_Folder. 
-If “-o /Your_Path_To_Output” is set, the output will be redirected to /Your_Path_To_Output.
-"""
-```
-
-## Strand-specific mapping of Tracking-seq data 
-
-```bash
-
-# Generate snakemake config file for mapping
-# Results will be generated in /Your_Path_To_Output, if -o is not set, the output will be in the same folder as the fastq files
-offtracker_config.py -t 8 -g hg38 --blacklist hg38 \
--r /Your_Path_To_Reference/hg38_genome.fa \
--i /Your_Path_To_Reference/hg38_genome.chromap.index \
--f /Your_Path_To_Trimmed_Data \
--o /Your_Path_To_Output \ 
---subfolder 0 
-
-# Warning: Do not contain "fastq" or "fq" in the folder name, otherwise the program may treat the folder as a fastq file
-# This problem may be fixed in the future
-
-# Run the snakemake program
-cd /Your_Path_To_Fastq
-snakemake -np # dry run
-nohup snakemake --cores 16 1>sm_mapping.log 2>sm_mapping.err &
-
-## about cores
-# --cores of snakemake must be larger than -t of offtracker_config.py
-# parallel number = cores/t
-
-## about output
-# This part will generate "*.fw.scaled.bw" and ".rv.scaled.bw" for IGV visualization
-# "*.fw.bed" and "*.rv.bed" are used in the next part.
-```
-
-
-## Analyzing the genome-wide off-target sites
-
-```bash
-# In this part, multiple samples in the same condition can be analyzed in a single run by pattern recognition of sample names
-
-offtracker_analysis.py -g hg38 --name "VEGFA2" \
---exp 'Cas9_VEGFA2' \
---control 'WT' \
---outname 'Cas9_VEGFA_293' \
--f /Your_Path_To_Output \
---seqfolder /Your_Path_To_Candidates
-
-# --name: the same gRNA name you set when running offtracker_candidates.py
-# --exp/--control: add one or multiple patterns of file name in regular expressions
-# If multiple samples meet the pattern, their signals will be averaged. Thus, only samples with the same condition should be included in a single analysis.
-
-# This step will generate Offtracker_result_{outname}.csv
-# Default FDR is 0.05, which can be changed by --fdr. This will empirically make the threshold of Track score around 2.
-# Sites with Track score >=2, which is a empirical threshold, are output regardless of FDR.
-# Intermediate files are saved in ./temp folder, which can be deleted.
-# Keeping the intermediate files can make the analysis faster if involving previously analyzed samples (e.g. using the same control samples for different analyses)
-```
-
-## Off-target sequences visualization
-
-```bash
-# After get the Offtracker_result_{outname}.csv, you can visualize the off-target sites with their genomic sequence with the following command:
-
-offtracker_plot.py --result Your_Offtracker_Result_CSV \
---sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG'
-
-# The default output is a pdf file with Offtracker_result_{outname}.pdf
-# Assigning a specific output file with another suffix can change the format. e.g., "--output Offtracker_plot.png" will generate a png file.
-# The orange dash line indicates the empirical threshold of Track score = 2
-# Empirically, the off-target sites with Track score < 2 are less likely to be real off-target sites.
-```
-
-
-## Note1, when not using hg38 or mm10
-
-The default setting only includes chr1-chr22, chrX, chrY, and chrM. (only suitable for human and mouse) \
-If you are using reference genomes without "chr" at the beginning, or want to analyze all chromosomes or other species, you can set "--ignore_chr" when running offtracker_config.py to skip chromosome filter.
-
-Currently, this software is only ready-to-use for mm10 and hg38. For any other genome, e.g., hg19, please add a genome size file named "hg19.chrom.sizes" to .\offtracker\utility. Besides, add "--blacklist none" or "--blacklist Your_Blacklist" (e.g., ENCODE blacklist) when running offtracker_config.py, because we only include blacklists for mm10 and hg38.
-
-## Note2
-
-The FDRs in the Tracking-seq result do not reflect the real off-target probability.
-It is strongly recommended to observe the "fw.scaled.bw" and "rv.scaled.bw" using genome browser like IGV to visually inspect each target location from the Tracking-seq result.
-
-
-
-# Example Data
-
-Here are example data that contains reads of chr6 from HEK293T cells edited with Cas9 + sgRNA VEGFA_site_2 (VEGFA2) and reads of chr6 from wild type HEK293T cells:
-
-https://figshare.com/articles/dataset/WT_HEK239T_chr6/25956034
-
-It takes about 5-10 minutes to run the mapping (offtracker_config.py & snakemake) of example data with -t 8 and --cores 16 (2 parallel tasks)
-
-## Signal visualization
-
-After mapping, there will be 4 .bw files in the output folder:
-```bash
-Cas9_VEGFA2_chr6.fw.scaled.bw
-
-Cas9_VEGFA2_chr6.rv.scaled.bw
-
-WT_chr6.fw.scaled.bw
-
-WT_chr6.rv.scaled.bw
-```
-These files can be visualized in genome browser like IGV:
-
-![signal](https://github.com/Lan-lab/offtracker/blob/main/example_output/signals_example.png?raw=true)
-
-The signal (coverage) for each sample is normalized to 1e7/total_reads. As only reads mapping to chr6 were extracted in the example data, the signal range is much higher than that of the whole genome samples. 
-
-## Whole genome off-target analysis
-
-For analyzing the signals (offtracker_analysis.py), it takes about 3-5 minutes and outputs a file named "Offtracker_result_{outname}.csv"
-
-After that, you can visualize the off-target sites with their genomic sequence (offtracker_plot.py) and get an image like this:
-
-![offtarget](https://github.com/Lan-lab/offtracker/blob/main/example_output/sequences_example.png?raw=true)
-
-
-After finishing the pipeline, if “chr6:31400832-31400854” and “chr6:31495044-31495066” are missing in the plot, it is most likely due to either:
-
-•	Using a hard-masked reference genome (where repeats are replaced with 'N's)
-
-•	The presence of alternate loci (e.g., chr6_GL000256v2_alt) in the genome.
-
-These two off-target sites locate in the region of MHC class I chain-related protein A and B (MICA and MICB), which is polymorphic (resulting in alternate loci in contigs like “chr6_GL000256v2_alt”) and contains interspersed repeats (resulting in sequences masked by capital 'N's in a hard-masked genome). Please try again with unmasked or soft-masked genome without alternate loci.
-
-
-
-# Citation
-
-If you use Tracking-seq or OFF-TRACKER in your research, please cite the following paper:
-
-Zhu, M., Xu, R., Yuan, J., Wang, J. et al. Tracking-seq reveals the heterogeneity of off-target effects in CRISPR–Cas9-mediated genome editing. Nat Biotechnol (2024). https://doi.org/10.1038/s41587-024-02307-y
-
-The signal visualization of .bw file here was generated by the Integrative Genomics Viewer (IGV) software. The signal visualization in the Tracking-seq article above was generated by either IGV or pyGenomeTracks:
-
-Robinson, J., Thorvaldsdóttir, H., Winckler, W. et al. Integrative genomics viewer. Nat Biotechnol 29, 24–26 (2011). https://doi.org/10.1038/nbt.1754
-
-Lopez-Delisle L, Rabbani L, Wolff J, Bhardwaj V, Backofen R, Grüning B, Ramírez F, Manke T. pyGenomeTracks: reproducible plots for multivariate genomic data sets. Bioinformatics. 2020 Aug 3:btaa692. doi: 10.1093/bioinformatics/btaa692.
-
+Metadata-Version: 2.1
+Name: offtracker
+Version: 2.14.0
+Summary: Tracking-seq data analysis
+Home-page: https://github.com/Lan-lab/offtracker
+Author: Runda Xu
+Author-email: xrd18@tsinghua.org.cn
+Requires-Python: >=3.6.0
+Description-Content-Type: text/markdown
+License-File: LICENSE.txt
+
+
+# Offtracker
+
+Offtracker is an end to end pipeline of Tracking-seq data analysis for detecting off-target sites of any genome editing tools that generate double-strand breaks (DSBs) or single-strand breaks (SSBs).
+
+## System requirements
+
+* Linux/Unix 
+* Python >= 3.6
+
+## Dependency
+
+```bash
+# We recommend creating a new environment using mamba/conda to avoid compatibility problems
+# If you don't use mamba, just replace the code with conda 
+# Windows systems may not be compatible with pybedtools.
+mamba create -n offtracker -c bioconda blast snakemake pybedtools deeptools chromap
+```
+
+
+## Installation 
+
+
+```bash
+# Activate the environment
+conda activate offtracker
+
+# Direct installation with pip
+pip install offtracker
+
+# (Alternative) Download the offtracker from github
+git clone https://github.com/Lan-lab/offtracker.git 
+cd offtracker
+pip install .
+```
+
+
+## Before analyzing samples
+
+**Important: Do not use hard-masked genome.fa**, in which repeats are masked by capital Ns and reads should have been mapped to these region (e.g. MHC region) will be lost. Besides, the genome.fa **should not contain alternate loci** like chr2_KI270776v1_alt and chr6_GL000256v2_alt, which may cause multi-mappings and the reads may be discarded.
+
+
+**!! Do not use any of these two .fa files !!** \
+For example, https://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz is soft-masked genome with alternate loci. https://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.masked.gz is hard-masked genome. **Do not** use these two as reference genome. \
+**!! Do not use any of these two .fa files !!** 
+
+
+
+http://cistrome.org/~galib/MAESTRO/references/scATAC/Refdata_scATAC_MAESTRO_GRCh38_1.1.0.tar.gz is the genome used for the example data.
+
+
+```bash
+# The following command can be used to check whether alternate loci of chr6 are present in the reference genome.
+grep "^>chr6" genome.fa
+```
+
+```bash
+# Build chromap index (only need once for each genome)
+chromap -i -r /Your_Path_To_Reference/hg38_genome.fa \
+-o /Your_Path_To_Reference/hg38_genome.chromap.index
+
+# Build blast index (only need once for each genome)
+makeblastdb -input_type fasta -title hg38 -dbtype nucl -parse_seqids \
+-in /Your_Path_To_Reference/hg38_genome.fa \
+-out /Your_Path_To_Reference/hg38_genome.blastdb \
+-logfile /Your_Path_To_Reference/hg38_genome.blastdb.log
+
+# Generate candidate regions by sgRNA sequence (need once for each genome and sgRNA)
+# --name: a user-defined name of the sgRNA, which will be used in the following analysis.
+offtracker_candidates.py -t 8 -g hg38 \
+-r /Your_Path_To_Reference/hg38_genome.fa \
+-b /Your_Path_To_Reference/hg38_genome.blastdb \
+--name 'VEGFA2' --sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG' \
+-o /Your_Path_To_Candidates_Folder
+
+# If analyzing Cas12a, whose pam is upstream of the sgRNA, add this:
+--pam_location 'upstream'
+
+```
+
+
+## Quality control and adapter trimming
+
+```bash
+# Generate snakemake config file for quality control and adapter trimming.
+offtracker_qc.py -t 4 \
+-f /Your_Path_To_Input_Folder \
+--subfolder 0
+
+cd /Your_Path_To_Input_Folder/Trimmed_data
+snakemake -np # dry run to check whether everything is alright
+nohup snakemake --cores 16 1>${outdir}/sm_qc.log 2>&1 &
+
+"""
+Set “--subfolder 0” if the file structure is like: 
+| - Input_Folder
+  | - sample1_R1.fastq.gz
+  | - sample1_R2.fastq.gz
+  | - sample2_R1.fastq.gz
+  | - sample2_R2.fastq.gz
+Set “--subfolder 1” if the file structure is like:
+| - Input_Folder
+  | - Sample1_Folder
+    | - sample1_R1.fastq.gz
+    | - sample1_R2.fastq.gz
+  | - Sample2_Folder
+    | - sample2_R1.fastq.gz
+    | - sample2_R2.fastq.gz
+
+The script “offtracker_qc.py” will create a “Trimmed_data” folder under /Your_Path_To_Input_Folder. 
+If “-o /Your_Path_To_Output” is set, the output will be redirected to /Your_Path_To_Output.
+"""
+```
+
+## Strand-specific mapping of Tracking-seq data 
+
+```bash
+
+# Generate snakemake config file for mapping
+# Results will be generated in /Your_Path_To_Output, if -o is not set, the output will be in the same folder as the fastq files
+offtracker_config.py -t 8 -g hg38 --blacklist hg38 \
+-r /Your_Path_To_Reference/hg38_genome.fa \
+-i /Your_Path_To_Reference/hg38_genome.chromap.index \
+-f /Your_Path_To_Trimmed_Data \
+-o /Your_Path_To_Output \ 
+--subfolder 0 
+
+# Warning: Do not contain "fastq" or "fq" in the folder name, otherwise the program may treat the folder as a fastq file
+# This problem may be fixed in the future
+
+# Run the snakemake program
+cd /Your_Path_To_Fastq
+snakemake -np # dry run
+nohup snakemake --cores 16 1>sm_mapping.log 2>sm_mapping.err &
+
+## about cores
+# --cores of snakemake must be larger than -t of offtracker_config.py
+# parallel number = cores/t
+
+## about output
+# This part will generate "*.fw.scaled.bw" and ".rv.scaled.bw" for IGV visualization
+# "*.fw.bed" and "*.rv.bed" are used in the next part.
+```
+
+
+## Analyzing the genome-wide off-target sites
+
+```bash
+# In this part, multiple samples in the same condition can be analyzed in a single run by pattern recognition of sample names
+
+offtracker_analysis.py -g hg38 --name "VEGFA2" \
+--exp 'Cas9_VEGFA2' \
+--control 'WT' \
+--outname 'Cas9_VEGFA_293' \
+-f /Your_Path_To_Output \
+--seqfolder /Your_Path_To_Candidates
+
+# --name: the same gRNA name you set when running offtracker_candidates.py
+# --exp/--control: add one or multiple patterns of file name in regular expressions
+# If multiple samples meet the pattern, their signals will be averaged. Thus, only samples with the same condition should be included in a single analysis.
+
+# This step will generate Offtracker_result_{outname}.csv
+# Default FDR is 0.05, which can be changed by --fdr. This will empirically make the threshold of Track score around 2.
+# Sites with Track score >=2, which is a empirical threshold, are output regardless of FDR.
+# Intermediate files are saved in ./temp folder, which can be deleted.
+# Keeping the intermediate files can make the analysis faster if involving previously analyzed samples (e.g. using the same control samples for different analyses)
+```
+
+## Off-target sequences visualization
+
+```bash
+# After get the Offtracker_result_{outname}.csv, you can visualize the off-target sites with their genomic sequence with the following command:
+
+offtracker_plot.py --result Your_Offtracker_Result_CSV \
+--sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG'
+
+# The default output is a pdf file with Offtracker_result_{outname}.pdf
+# Assigning a specific output file with another suffix can change the format. e.g., "--output Offtracker_plot.png" will generate a png file.
+# The orange dash line indicates the empirical threshold of Track score = 2
+# Empirically, the off-target sites with Track score < 2 are less likely to be real off-target sites.
+```
+
+
+## Note1, when not using hg38 or mm10
+
+The default setting only includes chr1-chr22, chrX, chrY, and chrM. (only suitable for human and mouse) \
+If you are using reference genomes without "chr" at the beginning, or want to analyze all chromosomes or other species, you can set "--ignore_chr" when running offtracker_config.py to skip chromosome filter.
+
+Currently, this software is only ready-to-use for mm10 and hg38. For any other genome, e.g., hg19, please add a genome size file named "hg19.chrom.sizes" to .\offtracker\utility. Besides, add "--blacklist none" or "--blacklist Your_Blacklist" (e.g., ENCODE blacklist) when running offtracker_config.py, because we only include blacklists for mm10 and hg38.
+
+## Note2
+
+The FDRs in the Tracking-seq result do not reflect the real off-target probability.
+It is strongly recommended to observe the "fw.scaled.bw" and "rv.scaled.bw" using genome browser like IGV to visually inspect each target location from the Tracking-seq result.
+
+
+
+# Example Data
+
+Here are example data that contains reads of chr6 from HEK293T cells edited with Cas9 + sgRNA VEGFA_site_2 (VEGFA2) and reads of chr6 from wild type HEK293T cells:
+
+https://figshare.com/articles/dataset/WT_HEK239T_chr6/25956034
+
+It takes about 5-10 minutes to run the mapping (offtracker_config.py & snakemake) of example data with -t 8 and --cores 16 (2 parallel tasks)
+
+To download the data with wget:
+```
+wget --user-agent="Mozilla" https://figshare.com/ndownloader/files/46770337 -O WT_HEK239T_chr6_1.fq.gz
+wget --user-agent="Mozilla" https://figshare.com/ndownloader/files/46770334 -O WT_HEK239T_chr6_2.fq.gz
+wget --user-agent="Mozilla" https://figshare.com/ndownloader/files/46775599 -O Cas9_VEGFA2_chr6_1.fq.gz
+wget --user-agent="Mozilla" https://figshare.com/ndownloader/files/46775602 -O Cas9_VEGFA2_chr6_2.fq.gz
+```
+
+## Signal visualization
+
+After mapping, there will be 4 .bw files in the output folder:
+```bash
+Cas9_VEGFA2_chr6.fw.scaled.bw
+
+Cas9_VEGFA2_chr6.rv.scaled.bw
+
+WT_chr6.fw.scaled.bw
+
+WT_chr6.rv.scaled.bw
+```
+These files can be visualized in genome browser like IGV:
+
+![signal](https://github.com/Lan-lab/offtracker/blob/main/example_output/signals_example.png?raw=true)
+
+The signal (coverage) for each sample is normalized to 1e7/total_reads. As only reads mapping to chr6 were extracted in the example data, the signal range is much higher than that of the whole genome samples. 
+
+## Whole genome off-target analysis
+
+For analyzing the signals (offtracker_analysis.py), it takes about 3-5 minutes and outputs a file named "Offtracker_result_{outname}.csv"
+
+After that, you can visualize the off-target sites with their genomic sequence (offtracker_plot.py) and get an image like this:
+
+![offtarget](https://github.com/Lan-lab/offtracker/blob/main/example_output/sequences_example.png?raw=true)
+
+
+After finishing the pipeline, if “chr6:31400832-31400854” and “chr6:31495044-31495066” are missing in the plot, it is most likely due to either:
+
+•	Using a hard-masked reference genome (where repeats are replaced with 'N's)
+
+•	The presence of alternate loci (e.g., chr6_GL000256v2_alt) in the genome.
+
+These two off-target sites locate in the region of MHC class I chain-related protein A and B (MICA and MICB), which is polymorphic (resulting in alternate loci in contigs like “chr6_GL000256v2_alt”) and contains interspersed repeats (resulting in sequences masked by capital 'N's in a hard-masked genome). Please try again with unmasked or soft-masked genome without alternate loci.
+
+
+
+# Citation
+
+If you use Tracking-seq or OFF-TRACKER in your research, please cite the following paper:
+
+Zhu, M., Xu, R., Yuan, J., Wang, J. et al. Tracking-seq reveals the heterogeneity of off-target effects in CRISPR–Cas9-mediated genome editing. Nat Biotechnol (2024). https://doi.org/10.1038/s41587-024-02307-y
+
+The signal visualization of .bw file here was generated by the Integrative Genomics Viewer (IGV) software. The signal visualization in the Tracking-seq article above was generated by either IGV or pyGenomeTracks:
+
+Robinson, J., Thorvaldsdóttir, H., Winckler, W. et al. Integrative genomics viewer. Nat Biotechnol 29, 24–26 (2011). https://doi.org/10.1038/nbt.1754
+
+Lopez-Delisle L, Rabbani L, Wolff J, Bhardwaj V, Backofen R, Grüning B, Ramírez F, Manke T. pyGenomeTracks: reproducible plots for multivariate genomic data sets. Bioinformatics. 2020 Aug 3:btaa692. doi: 10.1093/bioinformatics/btaa692.
+

{offtracker-2.13.2 → offtracker-2.14.0}/offtracker.egg-info/requires.txt

@@ -4,3 +4,4 @@ numpy
 biopython<=1.85
 pybedtools
 pyyaml
+psutil

{offtracker-2.13.2 → offtracker-2.14.0}/scripts/offtracker_analysis.py

@@ -4,6 +4,8 @@
 import os,glob,sys,time,shutil
 import polars as pl
 
+# 2025.10.05. 添加 threads 监测
+
 if sys.version_info < (3,0):
     import platform
     raise Exception(f'python3 is needed, while running {platform.python_version()} now')
@@ -69,6 +71,21 @@ def main():
     seq_score_power = args.SeqScorePower
     n_threads  = args.thread
 
+    ################
+    # threads 监测 #
+    ################
+    import psutil
+    n_threads = args.thread
+    assert n_threads > 0, f'n_threads should be greater than 0, while {n_threads} is given.'
+    cpu_count_total = psutil.cpu_count(logical=True)  # 逻辑 CPU 总数（包括超线程）
+    if n_threads > cpu_count_total:
+        n_threads = cpu_count_total-1
+        print(f'n_threads is reset to {n_threads} due to the total number of threads ({cpu_count_total}).')
+    if n_threads > 16:
+        n_threads = 16
+        print(f'n_threads is reset to {n_threads} as too many threads are unnecessary.')
+
+
     outdir = args.outdir
     if outdir == 'first':
         outdir = folders[0]
@@ -383,6 +400,7 @@ def main():
         # 2025.06.05. BE可能会形成单边信号，但是很少见，如果 control 用的是别的 sgRNA 的样本，对应脱靶位置附近一般就是负数
         # bool_neg_score = df_result['track_score']< -1
         df_output = df_result[bool_fdr|bool_score].copy()
+        df_output = df_output['track_score']>1.75
         if pattern_ctr != 'none':
             df_output = df_output[['target_location', 'best_strand','best_target','deletion','insertion','mismatch',
                                 'exp_L_length', 'exp_R_length','ctr_L_length','ctr_R_length','L_length','R_length','signal_length',

{offtracker-2.13.2 → offtracker-2.14.0}/scripts/offtracker_candidates.py

@@ -5,6 +5,7 @@
 # 2023.12.06. v2.1: 2.1增加 cleavage_site 推测, 修正 deletion 错位, 以 cleavage_site 为中心
 # 2025.04.25. 修正大小写问题
 # 2025.06.11. 调整跳过已存在的candidates的代码顺序
+# 2025.10.05. 添加 threads 监测
 
 import os,sys,re,time
 from itertools import product, permutations
@@ -87,6 +88,19 @@ def main():
     df_sgRNA_PAM = pd.DataFrame({'ID':ID,'sequence':possible_sgRNA_PAM})
     xseq.write_fasta(df_sgRNA_PAM, dir_sgRNA_fasta)
     
+    ################
+    # threads 监测 #
+    ################
+    import psutil
+    assert n_threads > 0, f'n_threads should be greater than 0, while {n_threads} is given.'
+    cpu_count_total = psutil.cpu_count(logical=True)  # 逻辑 CPU 总数（包括超线程）
+    if n_threads > cpu_count_total:
+        n_threads = cpu_count_total-1
+        print(f'n_threads is reset to {n_threads} due to the total number of threads ({cpu_count_total}).')
+    if n_threads > 16:
+        n_threads = 16
+        print(f'n_threads is reset to {n_threads} as too many threads are unnecessary.')
+
     #########
     # BLAST #
     #########