offtracker 2.10.6__zip → 2.10.8__zip

{offtracker-2.10.6 → offtracker-2.10.8}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.1
 Name: offtracker
-Version: 2.10.6
+Version: 2.10.8
 Summary: Tracking-seq data analysis
 Home-page: https://github.com/Lan-lab/offtracker
 Author: Runda Xu
@@ -31,6 +31,7 @@ mamba create -n offtracker -c bioconda blast snakemake pybedtools deeptools chro
 
 ## Installation 
 
+
 ```bash
 # Activate the environment
 conda activate offtracker
@@ -47,17 +48,28 @@ pip install .
 
 ## Before analyzing samples
 
+**Important: Do not use hard-masked genome.fa**, in which repeats are masked by capital Ns and reads should have been mapped to these region (e.g. MHC region) will be lost. Besides, the genome.fa **should not** contain alternate loci like chr2_KI270776v1_alt and chr6_GL000256v2_alt, which may cause multi-mappings and the reads may be discarded.
+
+For example, https://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz is soft-masked genome with alternate loci. https://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.masked.gz is hard-masked genome. **Do not** use these two as reference genome.
+
+http://cistrome.org/~galib/MAESTRO/references/scATAC/Refdata_scATAC_MAESTRO_GRCh38_1.1.0.tar.gz is the genome used for the example data.
+
 ```bash
+# The following command can be used to check whether alternate loci of chr6 are present in the reference genome.
+grep "^>chr6" genome.fa
+```
+
+```bash
+# Build chromap index (only need once for each genome)
+chromap -i -r /Your_Path_To_Reference/hg38_genome.fa \
+-o /Your_Path_To_Reference/hg38_genome.chromap.index
+
 # Build blast index (only need once for each genome)
 makeblastdb -input_type fasta -title hg38 -dbtype nucl -parse_seqids \
 -in /Your_Path_To_Reference/hg38_genome.fa \
 -out /Your_Path_To_Reference/hg38_genome.blastdb \
 -logfile /Your_Path_To_Reference/hg38_genome.blastdb.log
 
-# Build chromap index (only need once for each genome)
-chromap -i -r /Your_Path_To_Reference/hg38_genome.fa \
--o /Your_Path_To_Reference/hg38_genome.chromap.index
-
 # Generate candidate regions by sgRNA sequence (need once for each genome and sgRNA)
 # --name: a user-defined name of the sgRNA, which will be used in the following analysis.
 offtracker_candidates.py -t 8 -g hg38 \
@@ -187,7 +199,7 @@ It is strongly recommended to observe the "fw.scaled.bw" and "rv.scaled.bw" usin
 
 # Example Data
 
-Here are example data that contains reads of chr6 from HEK293T cells edited with Cas9 + sgRNA VEGFA2 and wild type cells:
+Here are example data that contains reads of chr6 from HEK293T cells edited with Cas9 + sgRNA VEGFA_site_2 (VEGFA2) and reads of chr6 from wild type HEK293T cells:
 
 https://figshare.com/articles/dataset/WT_HEK239T_chr6/25956034
 
@@ -219,6 +231,17 @@ After that, you can visualize the off-target sites with their genomic sequence (
 
 ![offtarget](https://github.com/Lan-lab/offtracker/blob/main/example_output/sequences_example.png?raw=true)
 
+
+After finishing the pipeline, if “chr6:31400832-31400854” and “chr6:31495044-31495066” are missing in the plot, it is most likely due to either:
+
+•	Using a hard-masked reference genome (where repeats are replaced with 'N's)
+
+•	The presence of alternate loci (e.g., chr6_GL000256v2_alt) in the genome.
+
+These two off-target sites locate in the region of MHC class I chain-related protein A and B (MICA and MICB), which is polymorphic (resulting in alternate loci in contigs like “chr6_GL000256v2_alt”) and contains interspersed repeats (resulting in sequences masked by capital 'N's in a hard-masked genome). Please try again with unmasked or soft-masked genome without alternate loci.
+
+
+
 # Citation
 
 If you use Tracking-seq or OFF-TRACKER in your research, please cite the following paper:

offtracker-2.10.6/offtracker.egg-info/PKG-INFO → offtracker-2.10.8/README.md

@@ -1,233 +1,244 @@
-Metadata-Version: 2.1
-Name: offtracker
-Version: 2.10.6
-Summary: Tracking-seq data analysis
-Home-page: https://github.com/Lan-lab/offtracker
-Author: Runda Xu
-Author-email: xrd18@tsinghua.org.cn
-Requires-Python: >=3.6.0
-Description-Content-Type: text/markdown
-License-File: LICENSE.txt
-
-
-# Offtracker
-
-Offtracker is an end to end pipeline of Tracking-seq data analysis for detecting off-target sites of any genome editing tools that generate double-strand breaks (DSBs) or single-strand breaks (SSBs).
-
-## System requirements
-
-* Linux/Unix 
-* Python >= 3.6
-
-## Dependency
-
-```bash
-# We recommend creating a new environment using mamba/conda to avoid compatibility problems
-# If you don't use mamba, just replace the code with conda 
-# Windows systems may not be compatible with pybedtools.
-mamba create -n offtracker -c bioconda blast snakemake pybedtools deeptools chromap
-```
-
-
-## Installation 
-
-```bash
-# Activate the environment
-conda activate offtracker
-
-# Direct installation with pip
-pip install offtracker
-
-# (Alternative) Download the offtracker from github
-git clone https://github.com/Lan-lab/offtracker.git 
-cd offtracker
-pip install .
-```
-
-
-## Before analyzing samples
-
-```bash
-# Build blast index (only need once for each genome)
-makeblastdb -input_type fasta -title hg38 -dbtype nucl -parse_seqids \
--in /Your_Path_To_Reference/hg38_genome.fa \
--out /Your_Path_To_Reference/hg38_genome.blastdb \
--logfile /Your_Path_To_Reference/hg38_genome.blastdb.log
-
-# Build chromap index (only need once for each genome)
-chromap -i -r /Your_Path_To_Reference/hg38_genome.fa \
--o /Your_Path_To_Reference/hg38_genome.chromap.index
-
-# Generate candidate regions by sgRNA sequence (need once for each genome and sgRNA)
-# --name: a user-defined name of the sgRNA, which will be used in the following analysis.
-offtracker_candidates.py -t 8 -g hg38 \
--r /Your_Path_To_Reference/hg38_genome.fa \
--b /Your_Path_To_Reference/hg38_genome.blastdb \
---name 'VEGFA2' --sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG' \
--o /Your_Path_To_Candidates_Folder
-
-```
-
-
-## Quality control and adapter trimming
-
-```bash
-# Generate snakemake config file for quality control and adapter trimming.
-offtracker_qc.py -t 4 \
--f /Your_Path_To_Input_Folder \
---subfolder 0
-
-cd /Your_Path_To_Input_Folder/Trimmed_data
-snakemake -np # dry run to check whether everything is alright
-nohup snakemake --cores 16 1>${outdir}/sm_qc.log 2>&1 &
-
-"""
-Set “--subfolder 0” if the file structure is like: 
-| - Input_Folder
-  | - sample1_R1.fastq.gz
-  | - sample1_R2.fastq.gz
-  | - sample2_R1.fastq.gz
-  | - sample2_R2.fastq.gz
-Set “--subfolder 1” if the file structure is like:
-| - Input_Folder
-  | - Sample1_Folder
-    | - sample1_R1.fastq.gz
-    | - sample1_R2.fastq.gz
-  | - Sample2_Folder
-    | - sample2_R1.fastq.gz
-    | - sample2_R2.fastq.gz
-
-The script “offtracker_qc.py” will create a “Trimmed_data” folder under /Your_Path_To_Input_Folder. 
-If “-o /Your_Path_To_Output” is set, the output will be redirected to /Your_Path_To_Output.
-"""
-```
-
-## Strand-specific mapping of Tracking-seq data 
-
-```bash
-
-# Generate snakemake config file for mapping
-# Results will be generated in /Your_Path_To_Output, if -o is not set, the output will be in the same folder as the fastq files
-offtracker_config.py -t 8 -g hg38 --blacklist hg38 \
--r /Your_Path_To_Reference/hg38_genome.fa \
--i /Your_Path_To_Reference/hg38_genome.chromap.index \
--f /Your_Path_To_Trimmed_Data \
--o /Your_Path_To_Output \ 
---subfolder 0 
-
-# Warning: Do not contain "fastq" or "fq" in the folder name, otherwise the program may treat the folder as a fastq file
-# This problem may be fixed in the future
-
-# Run the snakemake program
-cd /Your_Path_To_Fastq
-snakemake -np # dry run
-nohup snakemake --cores 16 1>sm_mapping.log 2>sm_mapping.err &
-
-## about cores
-# --cores of snakemake must be larger than -t of offtracker_config.py
-# parallel number = cores/t
-
-## about output
-# This part will generate "*.fw.scaled.bw" and ".rv.scaled.bw" for IGV visualization
-# "*.fw.bed" and "*.rv.bed" are used in the next part.
-```
-
-
-## Analyzing the genome-wide off-target sites
-
-```bash
-# In this part, multiple samples in the same condition can be analyzed in a single run by pattern recognition of sample names
-
-offtracker_analysis.py -g hg38 --name "VEGFA2" \
---exp 'Cas9_VEGFA2' \
---control 'WT' \
---outname 'Cas9_VEGFA_293' \
--f /Your_Path_To_Output \
---seqfolder /Your_Path_To_Candidates
-
-# --name: the same gRNA name you set when running offtracker_candidates.py
-# --exp/--control: add one or multiple patterns of file name in regular expressions
-# If multiple samples meet the pattern, their signals will be averaged. Thus, only samples with the same condition should be included in a single analysis.
-
-# This step will generate Offtracker_result_{outname}.csv
-# Default FDR is 0.05, which can be changed by --fdr. This will empirically make the threshold of Track score around 2.
-# Sites with Track score >=2, which is a empirical threshold, are output regardless of FDR.
-# Intermediate files are saved in ./temp folder, which can be deleted.
-# Keeping the intermediate files can make the analysis faster if involving previously analyzed samples (e.g. using the same control samples for different analyses)
-```
-
-## Off-target sequences visualization
-
-```bash
-# After get the Offtracker_result_{outname}.csv, you can visualize the off-target sites with their genomic sequence with the following command:
-
-offtracker_plot.py --result Your_Offtracker_Result_CSV \
---sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG'
-
-# The default output is a pdf file with Offtracker_result_{outname}.pdf
-# Assigning a specific output file with another suffix can change the format. e.g., "--output Offtracker_plot.png" will generate a png file.
-# The orange dash line indicates the empirical threshold of Track score = 2
-# Empirically, the off-target sites with Track score < 2 are less likely to be real off-target sites.
-```
-
-
-## Note1, when not using hg38 or mm10
-
-The default setting only includes chr1-chr22, chrX, chrY, and chrM. (only suitable for human and mouse) \
-If you are using reference genomes without "chr" at the beginning, or want to analyze all chromosomes or other species, you can set "--ignore_chr" when running offtracker_config.py to skip chromosome filter.
-
-Currently, this software is only ready-to-use for mm10 and hg38. For any other genome, e.g., hg19, please add a genome size file named "hg19.chrom.sizes" to .\offtracker\utility. Besides, add "--blacklist none" or "--blacklist Your_Blacklist" (e.g., ENCODE blacklist) when running offtracker_config.py, because we only include blacklists for mm10 and hg38.
-
-## Note2
-
-The FDRs in the Tracking-seq result do not reflect the real off-target probability.
-It is strongly recommended to observe the "fw.scaled.bw" and "rv.scaled.bw" using genome browser like IGV to visually inspect each target location from the Tracking-seq result.
-
-
-
-# Example Data
-
-Here are example data that contains reads of chr6 from HEK293T cells edited with Cas9 + sgRNA VEGFA2 and wild type cells:
-
-https://figshare.com/articles/dataset/WT_HEK239T_chr6/25956034
-
-It takes about 5-10 minutes to run the mapping (offtracker_config.py & snakemake) of example data with -t 8 and --cores 16 (2 parallel tasks)
-
-## Signal visualization
-
-After mapping, there will be 4 .bw files in the output folder:
-```bash
-Cas9_VEGFA2_chr6.fw.scaled.bw
-
-Cas9_VEGFA2_chr6.rv.scaled.bw
-
-WT_chr6.fw.scaled.bw
-
-WT_chr6.rv.scaled.bw
-```
-These files can be visualized in genome browser like IGV:
-
-![signal](https://github.com/Lan-lab/offtracker/blob/main/example_output/signals_example.png?raw=true)
-
-The signal (coverage) for each sample is normalized to 1e7/total_reads. As only reads mapping to chr6 were extracted in the example data, the signal range is much higher than that of the whole genome samples. 
-
-## Whole genome off-target analysis
-
-For analyzing the signals (offtracker_analysis.py), it takes about 3-5 minutes and outputs a file named "Offtracker_result_{outname}.csv"
-
-After that, you can visualize the off-target sites with their genomic sequence (offtracker_plot.py) and get an image like this:
-
-![offtarget](https://github.com/Lan-lab/offtracker/blob/main/example_output/sequences_example.png?raw=true)
-
-# Citation
-
-If you use Tracking-seq or OFF-TRACKER in your research, please cite the following paper:
-
-Zhu, M., Xu, R., Yuan, J., Wang, J. et al. Tracking-seq reveals the heterogeneity of off-target effects in CRISPR–Cas9-mediated genome editing. Nat Biotechnol (2024). https://doi.org/10.1038/s41587-024-02307-y
-
-The signal visualization of .bw file here was generated by the Integrative Genomics Viewer (IGV) software. The signal visualization in the Tracking-seq article above was generated by either IGV or pyGenomeTracks:
-
-Robinson, J., Thorvaldsdóttir, H., Winckler, W. et al. Integrative genomics viewer. Nat Biotechnol 29, 24–26 (2011). https://doi.org/10.1038/nbt.1754
-
-Lopez-Delisle L, Rabbani L, Wolff J, Bhardwaj V, Backofen R, Grüning B, Ramírez F, Manke T. pyGenomeTracks: reproducible plots for multivariate genomic data sets. Bioinformatics. 2020 Aug 3:btaa692. doi: 10.1093/bioinformatics/btaa692.
-
+# Offtracker
+
+Offtracker is an end to end pipeline of Tracking-seq data analysis for detecting off-target sites of any genome editing tools that generate double-strand breaks (DSBs) or single-strand breaks (SSBs).
+
+## System requirements
+
+* Linux/Unix 
+* Python >= 3.6
+
+## Dependency
+
+```bash
+# We recommend creating a new environment using mamba/conda to avoid compatibility problems
+# If you don't use mamba, just replace the code with conda 
+# Windows systems may not be compatible with pybedtools.
+mamba create -n offtracker -c bioconda blast snakemake pybedtools deeptools chromap
+```
+
+
+## Installation 
+
+
+```bash
+# Activate the environment
+conda activate offtracker
+
+# Direct installation with pip
+pip install offtracker
+
+# (Alternative) Download the offtracker from github
+git clone https://github.com/Lan-lab/offtracker.git 
+cd offtracker
+pip install .
+```
+
+
+## Before analyzing samples
+
+**Important: Do not use hard-masked genome.fa**, in which repeats are masked by capital Ns and reads should have been mapped to these region (e.g. MHC region) will be lost. Besides, the genome.fa **should not** contain alternate loci like chr2_KI270776v1_alt and chr6_GL000256v2_alt, which may cause multi-mappings and the reads may be discarded.
+
+For example, https://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz is soft-masked genome with alternate loci. https://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.masked.gz is hard-masked genome. **Do not** use these two as reference genome.
+
+http://cistrome.org/~galib/MAESTRO/references/scATAC/Refdata_scATAC_MAESTRO_GRCh38_1.1.0.tar.gz is the genome used for the example data.
+
+```bash
+# The following command can be used to check whether alternate loci of chr6 are present in the reference genome.
+grep "^>chr6" genome.fa
+```
+
+```bash
+# Build chromap index (only need once for each genome)
+chromap -i -r /Your_Path_To_Reference/hg38_genome.fa \
+-o /Your_Path_To_Reference/hg38_genome.chromap.index
+
+# Build blast index (only need once for each genome)
+makeblastdb -input_type fasta -title hg38 -dbtype nucl -parse_seqids \
+-in /Your_Path_To_Reference/hg38_genome.fa \
+-out /Your_Path_To_Reference/hg38_genome.blastdb \
+-logfile /Your_Path_To_Reference/hg38_genome.blastdb.log
+
+# Generate candidate regions by sgRNA sequence (need once for each genome and sgRNA)
+# --name: a user-defined name of the sgRNA, which will be used in the following analysis.
+offtracker_candidates.py -t 8 -g hg38 \
+-r /Your_Path_To_Reference/hg38_genome.fa \
+-b /Your_Path_To_Reference/hg38_genome.blastdb \
+--name 'VEGFA2' --sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG' \
+-o /Your_Path_To_Candidates_Folder
+
+```
+
+
+## Quality control and adapter trimming
+
+```bash
+# Generate snakemake config file for quality control and adapter trimming.
+offtracker_qc.py -t 4 \
+-f /Your_Path_To_Input_Folder \
+--subfolder 0
+
+cd /Your_Path_To_Input_Folder/Trimmed_data
+snakemake -np # dry run to check whether everything is alright
+nohup snakemake --cores 16 1>${outdir}/sm_qc.log 2>&1 &
+
+"""
+Set “--subfolder 0” if the file structure is like: 
+| - Input_Folder
+  | - sample1_R1.fastq.gz
+  | - sample1_R2.fastq.gz
+  | - sample2_R1.fastq.gz
+  | - sample2_R2.fastq.gz
+Set “--subfolder 1” if the file structure is like:
+| - Input_Folder
+  | - Sample1_Folder
+    | - sample1_R1.fastq.gz
+    | - sample1_R2.fastq.gz
+  | - Sample2_Folder
+    | - sample2_R1.fastq.gz
+    | - sample2_R2.fastq.gz
+
+The script “offtracker_qc.py” will create a “Trimmed_data” folder under /Your_Path_To_Input_Folder. 
+If “-o /Your_Path_To_Output” is set, the output will be redirected to /Your_Path_To_Output.
+"""
+```
+
+## Strand-specific mapping of Tracking-seq data 
+
+```bash
+
+# Generate snakemake config file for mapping
+# Results will be generated in /Your_Path_To_Output, if -o is not set, the output will be in the same folder as the fastq files
+offtracker_config.py -t 8 -g hg38 --blacklist hg38 \
+-r /Your_Path_To_Reference/hg38_genome.fa \
+-i /Your_Path_To_Reference/hg38_genome.chromap.index \
+-f /Your_Path_To_Trimmed_Data \
+-o /Your_Path_To_Output \ 
+--subfolder 0 
+
+# Warning: Do not contain "fastq" or "fq" in the folder name, otherwise the program may treat the folder as a fastq file
+# This problem may be fixed in the future
+
+# Run the snakemake program
+cd /Your_Path_To_Fastq
+snakemake -np # dry run
+nohup snakemake --cores 16 1>sm_mapping.log 2>sm_mapping.err &
+
+## about cores
+# --cores of snakemake must be larger than -t of offtracker_config.py
+# parallel number = cores/t
+
+## about output
+# This part will generate "*.fw.scaled.bw" and ".rv.scaled.bw" for IGV visualization
+# "*.fw.bed" and "*.rv.bed" are used in the next part.
+```
+
+
+## Analyzing the genome-wide off-target sites
+
+```bash
+# In this part, multiple samples in the same condition can be analyzed in a single run by pattern recognition of sample names
+
+offtracker_analysis.py -g hg38 --name "VEGFA2" \
+--exp 'Cas9_VEGFA2' \
+--control 'WT' \
+--outname 'Cas9_VEGFA_293' \
+-f /Your_Path_To_Output \
+--seqfolder /Your_Path_To_Candidates
+
+# --name: the same gRNA name you set when running offtracker_candidates.py
+# --exp/--control: add one or multiple patterns of file name in regular expressions
+# If multiple samples meet the pattern, their signals will be averaged. Thus, only samples with the same condition should be included in a single analysis.
+
+# This step will generate Offtracker_result_{outname}.csv
+# Default FDR is 0.05, which can be changed by --fdr. This will empirically make the threshold of Track score around 2.
+# Sites with Track score >=2, which is a empirical threshold, are output regardless of FDR.
+# Intermediate files are saved in ./temp folder, which can be deleted.
+# Keeping the intermediate files can make the analysis faster if involving previously analyzed samples (e.g. using the same control samples for different analyses)
+```
+
+## Off-target sequences visualization
+
+```bash
+# After get the Offtracker_result_{outname}.csv, you can visualize the off-target sites with their genomic sequence with the following command:
+
+offtracker_plot.py --result Your_Offtracker_Result_CSV \
+--sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG'
+
+# The default output is a pdf file with Offtracker_result_{outname}.pdf
+# Assigning a specific output file with another suffix can change the format. e.g., "--output Offtracker_plot.png" will generate a png file.
+# The orange dash line indicates the empirical threshold of Track score = 2
+# Empirically, the off-target sites with Track score < 2 are less likely to be real off-target sites.
+```
+
+
+## Note1, when not using hg38 or mm10
+
+The default setting only includes chr1-chr22, chrX, chrY, and chrM. (only suitable for human and mouse) \
+If you are using reference genomes without "chr" at the beginning, or want to analyze all chromosomes or other species, you can set "--ignore_chr" when running offtracker_config.py to skip chromosome filter.
+
+Currently, this software is only ready-to-use for mm10 and hg38. For any other genome, e.g., hg19, please add a genome size file named "hg19.chrom.sizes" to .\offtracker\utility. Besides, add "--blacklist none" or "--blacklist Your_Blacklist" (e.g., ENCODE blacklist) when running offtracker_config.py, because we only include blacklists for mm10 and hg38.
+
+## Note2
+
+The FDRs in the Tracking-seq result do not reflect the real off-target probability.
+It is strongly recommended to observe the "fw.scaled.bw" and "rv.scaled.bw" using genome browser like IGV to visually inspect each target location from the Tracking-seq result.
+
+
+
+# Example Data
+
+Here are example data that contains reads of chr6 from HEK293T cells edited with Cas9 + sgRNA VEGFA_site_2 (VEGFA2) and reads of chr6 from wild type HEK293T cells:
+
+https://figshare.com/articles/dataset/WT_HEK239T_chr6/25956034
+
+It takes about 5-10 minutes to run the mapping (offtracker_config.py & snakemake) of example data with -t 8 and --cores 16 (2 parallel tasks)
+
+## Signal visualization
+
+After mapping, there will be 4 .bw files in the output folder:
+```bash
+Cas9_VEGFA2_chr6.fw.scaled.bw
+
+Cas9_VEGFA2_chr6.rv.scaled.bw
+
+WT_chr6.fw.scaled.bw
+
+WT_chr6.rv.scaled.bw
+```
+These files can be visualized in genome browser like IGV:
+
+![signal](https://github.com/Lan-lab/offtracker/blob/main/example_output/signals_example.png?raw=true)
+
+The signal (coverage) for each sample is normalized to 1e7/total_reads. As only reads mapping to chr6 were extracted in the example data, the signal range is much higher than that of the whole genome samples. 
+
+## Whole genome off-target analysis
+
+For analyzing the signals (offtracker_analysis.py), it takes about 3-5 minutes and outputs a file named "Offtracker_result_{outname}.csv"
+
+After that, you can visualize the off-target sites with their genomic sequence (offtracker_plot.py) and get an image like this:
+
+![offtarget](https://github.com/Lan-lab/offtracker/blob/main/example_output/sequences_example.png?raw=true)
+
+
+After finishing the pipeline, if “chr6:31400832-31400854” and “chr6:31495044-31495066” are missing in the plot, it is most likely due to either:
+
+•	Using a hard-masked reference genome (where repeats are replaced with 'N's)
+
+•	The presence of alternate loci (e.g., chr6_GL000256v2_alt) in the genome.
+
+These two off-target sites locate in the region of MHC class I chain-related protein A and B (MICA and MICB), which is polymorphic (resulting in alternate loci in contigs like “chr6_GL000256v2_alt”) and contains interspersed repeats (resulting in sequences masked by capital 'N's in a hard-masked genome). Please try again with unmasked or soft-masked genome without alternate loci.
+
+
+
+# Citation
+
+If you use Tracking-seq or OFF-TRACKER in your research, please cite the following paper:
+
+Zhu, M., Xu, R., Yuan, J., Wang, J. et al. Tracking-seq reveals the heterogeneity of off-target effects in CRISPR–Cas9-mediated genome editing. Nat Biotechnol (2024). https://doi.org/10.1038/s41587-024-02307-y
+
+The signal visualization of .bw file here was generated by the Integrative Genomics Viewer (IGV) software. The signal visualization in the Tracking-seq article above was generated by either IGV or pyGenomeTracks:
+
+Robinson, J., Thorvaldsdóttir, H., Winckler, W. et al. Integrative genomics viewer. Nat Biotechnol 29, 24–26 (2011). https://doi.org/10.1038/nbt.1754
+
+Lopez-Delisle L, Rabbani L, Wolff J, Bhardwaj V, Backofen R, Grüning B, Ramírez F, Manke T. pyGenomeTracks: reproducible plots for multivariate genomic data sets. Bioinformatics. 2020 Aug 3:btaa692. doi: 10.1093/bioinformatics/btaa692.
+

{offtracker-2.10.6 → offtracker-2.10.8}/offtracker/_version.py

@@ -1,4 +1,4 @@
-__version__ = "2.10.6"
+__version__ = "2.10.8"
 # 2023.08.11. v1.1.0	adding a option for not normalizing the bw file
 # 2023.10.26. v1.9.0	prerelease for v2.0
 # 2023.10.27. v2.0.0	大更新，还没微调
@@ -33,4 +33,5 @@ __version__ = "2.10.6"
 # 2025.04.25. v2.8.0	修复了 offtracker candidates 会把小写序列转换成 N 的 bug
 # 2025.05.22. v2.9.0	翻新部分代码结构
 # 2025.06.05. v2.10.0	增加了QC模块。保留了负数score的记录，并在plot时显示为红字。增加了 "--ignore_chr" 用于跳过common chr过滤。
-# 2025.06.17. v2.10.6   修复翻新代码结构导致的bug
+# 2025.06.17. v2.10.7   修复翻新代码结构导致的bug
+# 2025.06.27. v2.10.8   将 chmod 放在了 setup.py 里

offtracker-2.10.6/README.md → offtracker-2.10.8/offtracker.egg-info/PKG-INFO

@@ -1,221 +1,256 @@
-# Offtracker
-
-Offtracker is an end to end pipeline of Tracking-seq data analysis for detecting off-target sites of any genome editing tools that generate double-strand breaks (DSBs) or single-strand breaks (SSBs).
-
-## System requirements
-
-* Linux/Unix 
-* Python >= 3.6
-
-## Dependency
-
-```bash
-# We recommend creating a new environment using mamba/conda to avoid compatibility problems
-# If you don't use mamba, just replace the code with conda 
-# Windows systems may not be compatible with pybedtools.
-mamba create -n offtracker -c bioconda blast snakemake pybedtools deeptools chromap
-```
-
-
-## Installation 
-
-```bash
-# Activate the environment
-conda activate offtracker
-
-# Direct installation with pip
-pip install offtracker
-
-# (Alternative) Download the offtracker from github
-git clone https://github.com/Lan-lab/offtracker.git 
-cd offtracker
-pip install .
-```
-
-
-## Before analyzing samples
-
-```bash
-# Build blast index (only need once for each genome)
-makeblastdb -input_type fasta -title hg38 -dbtype nucl -parse_seqids \
--in /Your_Path_To_Reference/hg38_genome.fa \
--out /Your_Path_To_Reference/hg38_genome.blastdb \
--logfile /Your_Path_To_Reference/hg38_genome.blastdb.log
-
-# Build chromap index (only need once for each genome)
-chromap -i -r /Your_Path_To_Reference/hg38_genome.fa \
--o /Your_Path_To_Reference/hg38_genome.chromap.index
-
-# Generate candidate regions by sgRNA sequence (need once for each genome and sgRNA)
-# --name: a user-defined name of the sgRNA, which will be used in the following analysis.
-offtracker_candidates.py -t 8 -g hg38 \
--r /Your_Path_To_Reference/hg38_genome.fa \
--b /Your_Path_To_Reference/hg38_genome.blastdb \
---name 'VEGFA2' --sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG' \
--o /Your_Path_To_Candidates_Folder
-
-```
-
-
-## Quality control and adapter trimming
-
-```bash
-# Generate snakemake config file for quality control and adapter trimming.
-offtracker_qc.py -t 4 \
--f /Your_Path_To_Input_Folder \
---subfolder 0
-
-cd /Your_Path_To_Input_Folder/Trimmed_data
-snakemake -np # dry run to check whether everything is alright
-nohup snakemake --cores 16 1>${outdir}/sm_qc.log 2>&1 &
-
-"""
-Set “--subfolder 0” if the file structure is like: 
-| - Input_Folder
-  | - sample1_R1.fastq.gz
-  | - sample1_R2.fastq.gz
-  | - sample2_R1.fastq.gz
-  | - sample2_R2.fastq.gz
-Set “--subfolder 1” if the file structure is like:
-| - Input_Folder
-  | - Sample1_Folder
-    | - sample1_R1.fastq.gz
-    | - sample1_R2.fastq.gz
-  | - Sample2_Folder
-    | - sample2_R1.fastq.gz
-    | - sample2_R2.fastq.gz
-
-The script “offtracker_qc.py” will create a “Trimmed_data” folder under /Your_Path_To_Input_Folder. 
-If “-o /Your_Path_To_Output” is set, the output will be redirected to /Your_Path_To_Output.
-"""
-```
-
-## Strand-specific mapping of Tracking-seq data 
-
-```bash
-
-# Generate snakemake config file for mapping
-# Results will be generated in /Your_Path_To_Output, if -o is not set, the output will be in the same folder as the fastq files
-offtracker_config.py -t 8 -g hg38 --blacklist hg38 \
--r /Your_Path_To_Reference/hg38_genome.fa \
--i /Your_Path_To_Reference/hg38_genome.chromap.index \
--f /Your_Path_To_Trimmed_Data \
--o /Your_Path_To_Output \ 
---subfolder 0 
-
-# Warning: Do not contain "fastq" or "fq" in the folder name, otherwise the program may treat the folder as a fastq file
-# This problem may be fixed in the future
-
-# Run the snakemake program
-cd /Your_Path_To_Fastq
-snakemake -np # dry run
-nohup snakemake --cores 16 1>sm_mapping.log 2>sm_mapping.err &
-
-## about cores
-# --cores of snakemake must be larger than -t of offtracker_config.py
-# parallel number = cores/t
-
-## about output
-# This part will generate "*.fw.scaled.bw" and ".rv.scaled.bw" for IGV visualization
-# "*.fw.bed" and "*.rv.bed" are used in the next part.
-```
-
-
-## Analyzing the genome-wide off-target sites
-
-```bash
-# In this part, multiple samples in the same condition can be analyzed in a single run by pattern recognition of sample names
-
-offtracker_analysis.py -g hg38 --name "VEGFA2" \
---exp 'Cas9_VEGFA2' \
---control 'WT' \
---outname 'Cas9_VEGFA_293' \
--f /Your_Path_To_Output \
---seqfolder /Your_Path_To_Candidates
-
-# --name: the same gRNA name you set when running offtracker_candidates.py
-# --exp/--control: add one or multiple patterns of file name in regular expressions
-# If multiple samples meet the pattern, their signals will be averaged. Thus, only samples with the same condition should be included in a single analysis.
-
-# This step will generate Offtracker_result_{outname}.csv
-# Default FDR is 0.05, which can be changed by --fdr. This will empirically make the threshold of Track score around 2.
-# Sites with Track score >=2, which is a empirical threshold, are output regardless of FDR.
-# Intermediate files are saved in ./temp folder, which can be deleted.
-# Keeping the intermediate files can make the analysis faster if involving previously analyzed samples (e.g. using the same control samples for different analyses)
-```
-
-## Off-target sequences visualization
-
-```bash
-# After get the Offtracker_result_{outname}.csv, you can visualize the off-target sites with their genomic sequence with the following command:
-
-offtracker_plot.py --result Your_Offtracker_Result_CSV \
---sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG'
-
-# The default output is a pdf file with Offtracker_result_{outname}.pdf
-# Assigning a specific output file with another suffix can change the format. e.g., "--output Offtracker_plot.png" will generate a png file.
-# The orange dash line indicates the empirical threshold of Track score = 2
-# Empirically, the off-target sites with Track score < 2 are less likely to be real off-target sites.
-```
-
-
-## Note1, when not using hg38 or mm10
-
-The default setting only includes chr1-chr22, chrX, chrY, and chrM. (only suitable for human and mouse) \
-If you are using reference genomes without "chr" at the beginning, or want to analyze all chromosomes or other species, you can set "--ignore_chr" when running offtracker_config.py to skip chromosome filter.
-
-Currently, this software is only ready-to-use for mm10 and hg38. For any other genome, e.g., hg19, please add a genome size file named "hg19.chrom.sizes" to .\offtracker\utility. Besides, add "--blacklist none" or "--blacklist Your_Blacklist" (e.g., ENCODE blacklist) when running offtracker_config.py, because we only include blacklists for mm10 and hg38.
-
-## Note2
-
-The FDRs in the Tracking-seq result do not reflect the real off-target probability.
-It is strongly recommended to observe the "fw.scaled.bw" and "rv.scaled.bw" using genome browser like IGV to visually inspect each target location from the Tracking-seq result.
-
-
-
-# Example Data
-
-Here are example data that contains reads of chr6 from HEK293T cells edited with Cas9 + sgRNA VEGFA2 and wild type cells:
-
-https://figshare.com/articles/dataset/WT_HEK239T_chr6/25956034
-
-It takes about 5-10 minutes to run the mapping (offtracker_config.py & snakemake) of example data with -t 8 and --cores 16 (2 parallel tasks)
-
-## Signal visualization
-
-After mapping, there will be 4 .bw files in the output folder:
-```bash
-Cas9_VEGFA2_chr6.fw.scaled.bw
-
-Cas9_VEGFA2_chr6.rv.scaled.bw
-
-WT_chr6.fw.scaled.bw
-
-WT_chr6.rv.scaled.bw
-```
-These files can be visualized in genome browser like IGV:
-
-![signal](https://github.com/Lan-lab/offtracker/blob/main/example_output/signals_example.png?raw=true)
-
-The signal (coverage) for each sample is normalized to 1e7/total_reads. As only reads mapping to chr6 were extracted in the example data, the signal range is much higher than that of the whole genome samples. 
-
-## Whole genome off-target analysis
-
-For analyzing the signals (offtracker_analysis.py), it takes about 3-5 minutes and outputs a file named "Offtracker_result_{outname}.csv"
-
-After that, you can visualize the off-target sites with their genomic sequence (offtracker_plot.py) and get an image like this:
-
-![offtarget](https://github.com/Lan-lab/offtracker/blob/main/example_output/sequences_example.png?raw=true)
-
-# Citation
-
-If you use Tracking-seq or OFF-TRACKER in your research, please cite the following paper:
-
-Zhu, M., Xu, R., Yuan, J., Wang, J. et al. Tracking-seq reveals the heterogeneity of off-target effects in CRISPR–Cas9-mediated genome editing. Nat Biotechnol (2024). https://doi.org/10.1038/s41587-024-02307-y
-
-The signal visualization of .bw file here was generated by the Integrative Genomics Viewer (IGV) software. The signal visualization in the Tracking-seq article above was generated by either IGV or pyGenomeTracks:
-
-Robinson, J., Thorvaldsdóttir, H., Winckler, W. et al. Integrative genomics viewer. Nat Biotechnol 29, 24–26 (2011). https://doi.org/10.1038/nbt.1754
-
-Lopez-Delisle L, Rabbani L, Wolff J, Bhardwaj V, Backofen R, Grüning B, Ramírez F, Manke T. pyGenomeTracks: reproducible plots for multivariate genomic data sets. Bioinformatics. 2020 Aug 3:btaa692. doi: 10.1093/bioinformatics/btaa692.
-
+Metadata-Version: 2.1
+Name: offtracker
+Version: 2.10.8
+Summary: Tracking-seq data analysis
+Home-page: https://github.com/Lan-lab/offtracker
+Author: Runda Xu
+Author-email: xrd18@tsinghua.org.cn
+Requires-Python: >=3.6.0
+Description-Content-Type: text/markdown
+License-File: LICENSE.txt
+
+
+# Offtracker
+
+Offtracker is an end to end pipeline of Tracking-seq data analysis for detecting off-target sites of any genome editing tools that generate double-strand breaks (DSBs) or single-strand breaks (SSBs).
+
+## System requirements
+
+* Linux/Unix 
+* Python >= 3.6
+
+## Dependency
+
+```bash
+# We recommend creating a new environment using mamba/conda to avoid compatibility problems
+# If you don't use mamba, just replace the code with conda 
+# Windows systems may not be compatible with pybedtools.
+mamba create -n offtracker -c bioconda blast snakemake pybedtools deeptools chromap
+```
+
+
+## Installation 
+
+
+```bash
+# Activate the environment
+conda activate offtracker
+
+# Direct installation with pip
+pip install offtracker
+
+# (Alternative) Download the offtracker from github
+git clone https://github.com/Lan-lab/offtracker.git 
+cd offtracker
+pip install .
+```
+
+
+## Before analyzing samples
+
+**Important: Do not use hard-masked genome.fa**, in which repeats are masked by capital Ns and reads should have been mapped to these region (e.g. MHC region) will be lost. Besides, the genome.fa **should not** contain alternate loci like chr2_KI270776v1_alt and chr6_GL000256v2_alt, which may cause multi-mappings and the reads may be discarded.
+
+For example, https://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz is soft-masked genome with alternate loci. https://hgdownload.soe.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.masked.gz is hard-masked genome. **Do not** use these two as reference genome.
+
+http://cistrome.org/~galib/MAESTRO/references/scATAC/Refdata_scATAC_MAESTRO_GRCh38_1.1.0.tar.gz is the genome used for the example data.
+
+```bash
+# The following command can be used to check whether alternate loci of chr6 are present in the reference genome.
+grep "^>chr6" genome.fa
+```
+
+```bash
+# Build chromap index (only need once for each genome)
+chromap -i -r /Your_Path_To_Reference/hg38_genome.fa \
+-o /Your_Path_To_Reference/hg38_genome.chromap.index
+
+# Build blast index (only need once for each genome)
+makeblastdb -input_type fasta -title hg38 -dbtype nucl -parse_seqids \
+-in /Your_Path_To_Reference/hg38_genome.fa \
+-out /Your_Path_To_Reference/hg38_genome.blastdb \
+-logfile /Your_Path_To_Reference/hg38_genome.blastdb.log
+
+# Generate candidate regions by sgRNA sequence (need once for each genome and sgRNA)
+# --name: a user-defined name of the sgRNA, which will be used in the following analysis.
+offtracker_candidates.py -t 8 -g hg38 \
+-r /Your_Path_To_Reference/hg38_genome.fa \
+-b /Your_Path_To_Reference/hg38_genome.blastdb \
+--name 'VEGFA2' --sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG' \
+-o /Your_Path_To_Candidates_Folder
+
+```
+
+
+## Quality control and adapter trimming
+
+```bash
+# Generate snakemake config file for quality control and adapter trimming.
+offtracker_qc.py -t 4 \
+-f /Your_Path_To_Input_Folder \
+--subfolder 0
+
+cd /Your_Path_To_Input_Folder/Trimmed_data
+snakemake -np # dry run to check whether everything is alright
+nohup snakemake --cores 16 1>${outdir}/sm_qc.log 2>&1 &
+
+"""
+Set “--subfolder 0” if the file structure is like: 
+| - Input_Folder
+  | - sample1_R1.fastq.gz
+  | - sample1_R2.fastq.gz
+  | - sample2_R1.fastq.gz
+  | - sample2_R2.fastq.gz
+Set “--subfolder 1” if the file structure is like:
+| - Input_Folder
+  | - Sample1_Folder
+    | - sample1_R1.fastq.gz
+    | - sample1_R2.fastq.gz
+  | - Sample2_Folder
+    | - sample2_R1.fastq.gz
+    | - sample2_R2.fastq.gz
+
+The script “offtracker_qc.py” will create a “Trimmed_data” folder under /Your_Path_To_Input_Folder. 
+If “-o /Your_Path_To_Output” is set, the output will be redirected to /Your_Path_To_Output.
+"""
+```
+
+## Strand-specific mapping of Tracking-seq data 
+
+```bash
+
+# Generate snakemake config file for mapping
+# Results will be generated in /Your_Path_To_Output, if -o is not set, the output will be in the same folder as the fastq files
+offtracker_config.py -t 8 -g hg38 --blacklist hg38 \
+-r /Your_Path_To_Reference/hg38_genome.fa \
+-i /Your_Path_To_Reference/hg38_genome.chromap.index \
+-f /Your_Path_To_Trimmed_Data \
+-o /Your_Path_To_Output \ 
+--subfolder 0 
+
+# Warning: Do not contain "fastq" or "fq" in the folder name, otherwise the program may treat the folder as a fastq file
+# This problem may be fixed in the future
+
+# Run the snakemake program
+cd /Your_Path_To_Fastq
+snakemake -np # dry run
+nohup snakemake --cores 16 1>sm_mapping.log 2>sm_mapping.err &
+
+## about cores
+# --cores of snakemake must be larger than -t of offtracker_config.py
+# parallel number = cores/t
+
+## about output
+# This part will generate "*.fw.scaled.bw" and ".rv.scaled.bw" for IGV visualization
+# "*.fw.bed" and "*.rv.bed" are used in the next part.
+```
+
+
+## Analyzing the genome-wide off-target sites
+
+```bash
+# In this part, multiple samples in the same condition can be analyzed in a single run by pattern recognition of sample names
+
+offtracker_analysis.py -g hg38 --name "VEGFA2" \
+--exp 'Cas9_VEGFA2' \
+--control 'WT' \
+--outname 'Cas9_VEGFA_293' \
+-f /Your_Path_To_Output \
+--seqfolder /Your_Path_To_Candidates
+
+# --name: the same gRNA name you set when running offtracker_candidates.py
+# --exp/--control: add one or multiple patterns of file name in regular expressions
+# If multiple samples meet the pattern, their signals will be averaged. Thus, only samples with the same condition should be included in a single analysis.
+
+# This step will generate Offtracker_result_{outname}.csv
+# Default FDR is 0.05, which can be changed by --fdr. This will empirically make the threshold of Track score around 2.
+# Sites with Track score >=2, which is a empirical threshold, are output regardless of FDR.
+# Intermediate files are saved in ./temp folder, which can be deleted.
+# Keeping the intermediate files can make the analysis faster if involving previously analyzed samples (e.g. using the same control samples for different analyses)
+```
+
+## Off-target sequences visualization
+
+```bash
+# After get the Offtracker_result_{outname}.csv, you can visualize the off-target sites with their genomic sequence with the following command:
+
+offtracker_plot.py --result Your_Offtracker_Result_CSV \
+--sgrna 'GACCCCCTCCACCCCGCCTC' --pam 'NGG'
+
+# The default output is a pdf file with Offtracker_result_{outname}.pdf
+# Assigning a specific output file with another suffix can change the format. e.g., "--output Offtracker_plot.png" will generate a png file.
+# The orange dash line indicates the empirical threshold of Track score = 2
+# Empirically, the off-target sites with Track score < 2 are less likely to be real off-target sites.
+```
+
+
+## Note1, when not using hg38 or mm10
+
+The default setting only includes chr1-chr22, chrX, chrY, and chrM. (only suitable for human and mouse) \
+If you are using reference genomes without "chr" at the beginning, or want to analyze all chromosomes or other species, you can set "--ignore_chr" when running offtracker_config.py to skip chromosome filter.
+
+Currently, this software is only ready-to-use for mm10 and hg38. For any other genome, e.g., hg19, please add a genome size file named "hg19.chrom.sizes" to .\offtracker\utility. Besides, add "--blacklist none" or "--blacklist Your_Blacklist" (e.g., ENCODE blacklist) when running offtracker_config.py, because we only include blacklists for mm10 and hg38.
+
+## Note2
+
+The FDRs in the Tracking-seq result do not reflect the real off-target probability.
+It is strongly recommended to observe the "fw.scaled.bw" and "rv.scaled.bw" using genome browser like IGV to visually inspect each target location from the Tracking-seq result.
+
+
+
+# Example Data
+
+Here are example data that contains reads of chr6 from HEK293T cells edited with Cas9 + sgRNA VEGFA_site_2 (VEGFA2) and reads of chr6 from wild type HEK293T cells:
+
+https://figshare.com/articles/dataset/WT_HEK239T_chr6/25956034
+
+It takes about 5-10 minutes to run the mapping (offtracker_config.py & snakemake) of example data with -t 8 and --cores 16 (2 parallel tasks)
+
+## Signal visualization
+
+After mapping, there will be 4 .bw files in the output folder:
+```bash
+Cas9_VEGFA2_chr6.fw.scaled.bw
+
+Cas9_VEGFA2_chr6.rv.scaled.bw
+
+WT_chr6.fw.scaled.bw
+
+WT_chr6.rv.scaled.bw
+```
+These files can be visualized in genome browser like IGV:
+
+![signal](https://github.com/Lan-lab/offtracker/blob/main/example_output/signals_example.png?raw=true)
+
+The signal (coverage) for each sample is normalized to 1e7/total_reads. As only reads mapping to chr6 were extracted in the example data, the signal range is much higher than that of the whole genome samples. 
+
+## Whole genome off-target analysis
+
+For analyzing the signals (offtracker_analysis.py), it takes about 3-5 minutes and outputs a file named "Offtracker_result_{outname}.csv"
+
+After that, you can visualize the off-target sites with their genomic sequence (offtracker_plot.py) and get an image like this:
+
+![offtarget](https://github.com/Lan-lab/offtracker/blob/main/example_output/sequences_example.png?raw=true)
+
+
+After finishing the pipeline, if “chr6:31400832-31400854” and “chr6:31495044-31495066” are missing in the plot, it is most likely due to either:
+
+•	Using a hard-masked reference genome (where repeats are replaced with 'N's)
+
+•	The presence of alternate loci (e.g., chr6_GL000256v2_alt) in the genome.
+
+These two off-target sites locate in the region of MHC class I chain-related protein A and B (MICA and MICB), which is polymorphic (resulting in alternate loci in contigs like “chr6_GL000256v2_alt”) and contains interspersed repeats (resulting in sequences masked by capital 'N's in a hard-masked genome). Please try again with unmasked or soft-masked genome without alternate loci.
+
+
+
+# Citation
+
+If you use Tracking-seq or OFF-TRACKER in your research, please cite the following paper:
+
+Zhu, M., Xu, R., Yuan, J., Wang, J. et al. Tracking-seq reveals the heterogeneity of off-target effects in CRISPR–Cas9-mediated genome editing. Nat Biotechnol (2024). https://doi.org/10.1038/s41587-024-02307-y
+
+The signal visualization of .bw file here was generated by the Integrative Genomics Viewer (IGV) software. The signal visualization in the Tracking-seq article above was generated by either IGV or pyGenomeTracks:
+
+Robinson, J., Thorvaldsdóttir, H., Winckler, W. et al. Integrative genomics viewer. Nat Biotechnol 29, 24–26 (2011). https://doi.org/10.1038/nbt.1754
+
+Lopez-Delisle L, Rabbani L, Wolff J, Bhardwaj V, Backofen R, Grüning B, Ramírez F, Manke T. pyGenomeTracks: reproducible plots for multivariate genomic data sets. Bioinformatics. 2020 Aug 3:btaa692. doi: 10.1093/bioinformatics/btaa692.
+

{offtracker-2.10.6 → offtracker-2.10.8}/scripts/offtracker_analysis.py

@@ -9,8 +9,7 @@ if sys.version_info < (3,0):
 
 import offtracker
 import offtracker.X_sequence as xseq
-script_dir = os.path.abspath(os.path.dirname(offtracker.__file__))
-script_folder= os.path.join(script_dir, 'mapping')
+
 
 import argparse
 import pandas as pd
@@ -26,8 +25,8 @@ def main():
     parser.add_argument('--name'         , type=str, required=True,    help='custom name of the sgRNA' )
     parser.add_argument('--exp'          , type=str, default='all',    nargs='+', help='A substring mark in the name of experimental samples. The default is to use all samples other than control' )
     parser.add_argument('--control'      , type=str, default='none',   nargs='+', help='A substring mark in the name of control samples. The default is no control. "others" for all samples other than --exp.' )
-    parser.add_argument('--fdr'          , type=int, default=0.01,     help='FDR threshold for the final result. Default is 0.01.')
-    parser.add_argument('--score'        , type=int, default=1.9,        help='Track score threshold for the final result. Default is 1.9.')
+    parser.add_argument('--fdr'          , type=float, default=0.05,     help='FDR threshold for the final result. Default is 0.05.')
+    parser.add_argument('--score'        , type=float, default=1.9,        help='Track score threshold for the final result. Default is 1.9.')
     parser.add_argument('--smooth'       , type=int, default=1,        help='Smooth strength for the signal.')
     parser.add_argument('--window'       , type=int, default=3,        help='Window size for smoothing the signal.')
     parser.add_argument('--binsize'      , type=int, default=100,      help='Window size for smoothing the signal.')
@@ -40,6 +39,8 @@ def main():
     parser.add_argument('-o','--outdir'  , type=str, default='first',  help='The output folder. Default is the first folder of --folder' )
     parser.add_argument('--outname'      , type=str, default='same',   help='The suffix of output files. Default is the same --exp' )
     parser.add_argument('--signal_only'  , action='store_true', help='A developer option: stop before group analysis. ' )
+    # parser.add_argument('--individual_results', action='store_true', help='When multiple samples meet the exp pattern, only one merged result is generated.\n' \
+    #                                                                       'Set --individual_results to additionally output the individual result of each exp sample. ' )
     parser.add_argument('--overwrite'    , action='store_true', help='Whether to overwrite existed dataframes.' )
     parser.add_argument('--clean'        , action='store_true', help='Whether to remove temp files')
 

{offtracker-2.10.6 → offtracker-2.10.8}/scripts/offtracker_config.py

@@ -13,7 +13,7 @@ import offtracker
 import offtracker.X_sequence as xseq
 script_dir = os.path.abspath(os.path.dirname(offtracker.__file__))
 utility_dir = os.path.join(script_dir, 'utility')
-os.chmod( os.path.join(utility_dir, 'bedGraphToBigWig'), 0o755)
+# os.chmod( os.path.join(utility_dir, 'bedGraphToBigWig'), 0o755)
 
 ###
 parser = argparse.ArgumentParser()

{offtracker-2.10.6 → offtracker-2.10.8}/scripts/offtracker_qc.py

@@ -12,7 +12,7 @@ import offtracker.X_sequence as xseq
 
 script_dir = os.path.abspath(os.path.dirname(offtracker.__file__))
 utility_dir = os.path.join(script_dir, 'utility')
-os.chmod( os.path.join(utility_dir, 'bedGraphToBigWig'), 0o755)
+# os.chmod( os.path.join(utility_dir, 'bedGraphToBigWig'), 0o755)
 
 ###
 parser = argparse.ArgumentParser()

{offtracker-2.10.6 → offtracker-2.10.8}/setup.py

@@ -1,11 +1,15 @@
 #!/usr/bin/env python
 # -*- coding: utf-8 -*-
 
-import io
-import os
-import sys
-from shutil import rmtree
-from setuptools import find_packages, setup, Command
+import io, os
+# import sys
+# from shutil import rmtree
+from setuptools import setup
+
+# import pkg_resources
+from importlib_metadata import distribution
+from setuptools.command.install import install
+from setuptools.command.develop import develop
 
 #
 NAME = 'offtracker'
@@ -26,7 +30,7 @@ with open(os.path.join(here, package_folder, '_version.py'),'r',encoding='utf-8'
 
 # requirements
 REQUIRED = [
-    'biopython', 'pybedtools', 'pyyaml', 'pandas', 'numpy',
+   'pandas', 'numpy', 'biopython', 'pybedtools', 'pyyaml', 
 ]
 ## pybedtools may be not supported in Windows
 
@@ -37,6 +41,26 @@ except FileNotFoundError:
     long_description = DESCRIPTION
 
 
+
+
+class PostInstallCommand(install):
+    def run(self):
+        install.run(self)
+        # 获取文件位置
+        dist = distribution('offtracker')
+        package_path = dist.locate_file('')
+        utility_dir = os.path.join(package_path, 'offtracker/utility')
+        os.chmod( os.path.join(utility_dir, 'bedGraphToBigWig'), 0o755)
+
+class PostDevelopCommand(develop):
+    def run(self):
+        develop.run(self)
+        # 获取文件位置
+        dist = distribution('offtracker')
+        package_path = dist.locate_file('')
+        utility_dir = os.path.join(package_path, 'offtracker/utility')
+        os.chmod( os.path.join(utility_dir, 'bedGraphToBigWig'), 0o755)
+
 setup(
     name=NAME,
     version=VERSION,
@@ -49,6 +73,10 @@ setup(
     python_requires=REQUIRES_PYTHON,
     packages=['offtracker'],
     package_data={'offtracker': ['snakefile/*','utility/*']},
+    cmdclass={
+        'install': PostInstallCommand,
+        'develop': PostDevelopCommand,
+    },
     scripts = ['scripts/offtracker_qc.py',
                'scripts/offtracker_config.py',
                'scripts/offtracker_candidates.py',

{offtracker-2.10.6 → offtracker-2.10.8}/offtracker.egg-info/requires.txt

@@ -1,5 +1,5 @@
+pandas
+numpy
 biopython
 pybedtools
 pyyaml
-pandas
-numpy