biotite 1.5.0__cp314-cp314-win_amd64.whl

biotite/sequence/align/localgapped.pyx

@@ -0,0 +1,892 @@
+# This source code is part of the Biotite package and is distributed
+# under the 3-Clause BSD License. Please see 'LICENSE.rst' for further
+# information.
+
+__name__ = "biotite.sequence.align"
+__author__ = "Patrick Kunzmann"
+__all__ = ["align_local_gapped"]
+
+cimport cython
+cimport numpy as np
+from .tracetable cimport follow_trace, get_trace_linear, get_trace_affine
+
+import itertools
+import numpy as np
+from .alignment import Alignment
+
+
+ctypedef np.int32_t int32
+ctypedef np.int64_t int64
+ctypedef np.uint8_t uint8
+ctypedef np.uint16_t uint16
+ctypedef np.uint32_t uint32
+ctypedef np.uint64_t uint64
+
+ctypedef fused CodeType1:
+    uint8
+    uint16
+    uint32
+    uint64
+ctypedef fused CodeType2:
+    uint8
+    uint16
+    uint32
+    uint64
+
+
+cdef int INIT_SIZE = 100
+
+
+def align_local_gapped(seq1, seq2, matrix, seed, int32 threshold,
+                       gap_penalty=-10, max_number=1,
+                       direction="both", score_only=False,
+                       max_table_size=None):
+    """
+    align_local_gapped(seq1, seq2, matrix, seed, threshold,
+                       gap_penalty=-10, max_number=1,
+                       direction="both", score_only=False,
+                       max_table_size=None)
+
+    Perform a local gapped alignment extending from a given `seed`
+    position.
+
+    The alignment extends into one or both directions (controlled by
+    `direction`) until the total alignment score falls more than
+    `threshold` below the maximum score found (*X-Drop*).
+    :footcite:`Zhang2000`
+    The returned alignment contains the range that yielded the maximum
+    score.
+
+    Parameters
+    ----------
+    seq1, seq2 : Sequence
+        The sequences to be aligned.
+    matrix : SubstitutionMatrix
+        The substitution matrix used for scoring.
+    seed : tuple(int, int)
+        The indices in `seq1` and `seq2` where the local alignment
+        starts.
+        The indices must be non-negative.
+    threshold : int
+        If the current score falls this value below the maximum score
+        found, the alignment terminates.
+    gap_penalty : int or tuple(int, int), optional
+        If an integer is provided, the value will be interpreted as
+        linear gap penalty.
+        If a tuple is provided, an affine gap penalty is used
+        :footcite:`Gotoh1982`.
+        The first integer in the tuple is the gap opening penalty,
+        the second integer is the gap extension penalty.
+        threshold : int
+        If the current score falls this value below the maximum score
+        found, the alignment terminates.
+    max_number : int, optional
+        The maximum number of alignments returned.
+        When the number of branches exceeds this value in the traceback
+        step, no further branches are created.
+        By default, only a single alignment is returned.
+    direction : {'both', 'upstream', 'downstream'}, optional
+        Controls in which direction the alignment extends starting
+        from the seed.
+        If ``'upstream'``, the alignment starts before the `seed` and
+        ends at the `seed`.
+        If ``'downstream'``, the alignment starts at the `seed` and
+        ends behind the `seed`.
+        If ``'both'`` (default) the alignment starts before the `seed`
+        and ends behind the `seed`.
+        The `seed` position itself is always included in the alignment.
+    score_only : bool, optional
+        If set to ``True``, only the similarity score is returned
+        instead of the :class:`Alignment`, decreasing the runtime
+        substantially.
+    max_table_size : int, optional
+        A :class:`MemoryError` is raised, if the number of cells
+        in the internal dynamic programming table, i.e. approximately
+        the product of the lengths of the aligned regions, would exceed
+        the given value.
+
+    Returns
+    -------
+    alignments : list of Alignment
+        A list of found alignments.
+        Each alignment in the list has the same similarity
+        score.
+        Only returned, if `score_only` is ``False``.
+    score : int
+        The alignment similarity score.
+        Only returned, if `score_only` is ``True``.
+
+    See Also
+    --------
+    align_ungapped
+        For ungapped local alignments with the same *X-Drop* technique.
+
+    Notes
+    -----
+    Unilke :func:`align_optimal()`, this function does not allocate
+    memory proportional to the length of both sequences, but only
+    approximately proportional to lengths of the aligned regions.
+    In principle, this makes this function viable for local alignments
+    of sequences of any length.
+    However, if the product of the lengths of the homologous regions
+    is too large to fit into memory, a :class:`MemoryError` or even a
+    crash may occur.
+    This may also happen in spurious long alignments due to poor choice
+    of substitution matrix or gap penalty.
+    You may set `max_table_size` to avoid excessive memory use and
+    crashes.
+
+    References
+    ----------
+
+    .. footbibliography::
+
+    Examples
+    --------
+
+    >>> seq1 = NucleotideSequence("CGTAGCTATCGCCTGTACGGTT")
+    >>> seq2 = NucleotideSequence("TATATGCCTTACGGAATTGCTTTTT")
+    >>> matrix = SubstitutionMatrix.std_nucleotide_matrix()
+    >>> alignment = align_local_gapped(
+    ...     seq1, seq2, matrix, seed=(16, 10), threshold=20
+    ... )[0]
+    >>> print(alignment)
+    TATCGCCTGTACGG
+    TAT-GCCT-TACGG
+    >>> alignment = align_local_gapped(
+    ...     seq1, seq2, matrix, seed=(16, 10), threshold=20, direction="upstream"
+    ... )[0]
+    >>> print(alignment)
+    TATCGCCTGTA
+    TAT-GCCT-TA
+    >>> alignment = align_local_gapped(
+    ...     seq1, seq2, matrix, seed=(16, 10), threshold=20, direction="downstream"
+    ... )[0]
+    >>> print(alignment)
+    ACGG
+    ACGG
+    >>> score = align_local_gapped(
+    ...     seq1, seq2, matrix, seed=(16, 10), threshold=20, score_only=True
+    ... )
+    >>> print(score)
+    40
+    """
+    # Check matrix alphabets
+    if     not matrix.get_alphabet1().extends(seq1.get_alphabet()) \
+        or not matrix.get_alphabet2().extends(seq2.get_alphabet()):
+            raise ValueError("The sequences' alphabets do not fit the matrix")
+    score_matrix = matrix.score_matrix()
+
+    # Check if gap penalty is linear or affine
+    if type(gap_penalty) == int:
+        if gap_penalty >= 0:
+            raise ValueError("Gap penalty must be negative")
+    elif type(gap_penalty) == tuple:
+        if gap_penalty[0] >= 0 or gap_penalty[1] >= 0:
+                raise ValueError("Gap penalty must be negative")
+    else:
+        raise TypeError("Gap penalty must be either integer or tuple")
+
+    # Check if max_number is reasonable
+    if max_number < 1:
+        raise ValueError(
+            "Maximum number of returned alignments must be at least 1"
+        )
+
+    # Check maximum table size
+    if max_table_size is None:
+        max_table_size = np.iinfo(np.int64).max
+    elif max_table_size <= 0:
+        raise ValueError("Maximum table size must be a positve value")
+
+
+    code1 = seq1.code
+    code2 = seq2.code
+
+    cdef int seq1_start, seq2_start
+    seq1_start, seq2_start = seed
+    if seq1_start < 0 or seq2_start < 0:
+        raise IndexError("Seed must contain positive indices")
+    if seq1_start >= len(code1) or seq2_start >= len(code2):
+        raise IndexError(
+            f"Seed {(seq1_start, seq2_start)} is out of bounds "
+            f"for the sequences of length {len(code1)} and {len(code2)}"
+        )
+
+
+    cdef bint upstream
+    cdef bint downstream
+    if direction == "both":
+        upstream = True
+        downstream = True
+    elif direction == "upstream":
+        upstream = True
+        downstream = False
+    elif direction == "downstream":
+        upstream = False
+        downstream = True
+    else:
+        raise ValueError(f"Direction '{direction}' is invalid")
+    # Range check to avoid negative indices
+    if seq1_start == 0 or seq2_start == 0:
+        upstream = False
+
+    if threshold < 0:
+        raise ValueError("The threshold value must be a non-negative integer")
+
+
+    cdef int32 score
+    cdef int32 total_score = 0
+    # Separate alignment into two parts:
+    # the regions upstream and downstream from the seed position
+    if upstream:
+        # For the upstream region the respective part of the sequence
+        # must be reversed
+        score, upstream_traces = _align_region(
+            code1[seq1_start-1::-1], code2[seq2_start-1::-1],
+            score_matrix, threshold, gap_penalty,
+            max_number, score_only, max_table_size
+        )
+        total_score += score
+        if upstream_traces is not None:
+            # Undo the sequence reversing
+            upstream_traces = [trace[::-1] for trace in upstream_traces]
+            offset = np.array(seed) - 1
+            for trace in upstream_traces:
+                # Gap values (-1) are not transformed,
+                # as gaps are not indices
+                non_gap_mask = (trace != -1)
+                # Second part of sequence reversing
+                trace[non_gap_mask] *= -1
+                # Add seed offset to trace indices
+                trace[non_gap_mask[:, 0], 0] += offset[0]
+                trace[non_gap_mask[:, 1], 1] += offset[1]
+
+    if downstream:
+        score, downstream_traces = _align_region(
+            code1[seq1_start+1:], code2[seq2_start+1:],
+            score_matrix, threshold, gap_penalty,
+            max_number, score_only, max_table_size
+        )
+        total_score += score
+        if downstream_traces is not None:
+            offset = np.array(seed) + 1
+            for trace in downstream_traces:
+                trace[trace[:, 0] != -1, 0] += offset[0]
+                trace[trace[:, 1] != -1, 1] += offset[1]
+
+    total_score += score_matrix[code1[seq1_start], code2[seq2_start]]
+
+
+    if score_only:
+        return total_score
+    else:
+        if upstream and downstream:
+            # Create cartesian product of upstream and downstream traces
+            # Only consider max_number alignments
+            traces = [
+                np.concatenate([upstream_trace, [seed], downstream_trace])
+                for _, (upstream_trace, downstream_trace) in zip(
+                    range(max_number),
+                    itertools.product(upstream_traces, downstream_traces)
+                )
+            ]
+        elif upstream:
+            traces = [
+                np.concatenate([trace, [seed]]) for trace in upstream_traces
+            ]
+        elif downstream:
+            traces = [
+                np.concatenate([[seed], trace]) for trace in downstream_traces
+            ]
+        else:
+            # 'direction == "upstream"', but the start index is 0 so no
+            # upstream alignment is performed
+            # -> the trace includes only the seed
+            traces = [np.array(seed)[np.newaxis, :]]
+
+        return [Alignment([seq1, seq2], trace, total_score)
+                for trace in traces]
+
+
+def _align_region(code1, code2, matrix, threshold, gap_penalty,
+                  max_number, score_only, max_table_size):
+    """
+    Perfrom a local *X-Drop* alignment extending from the start of the
+    given sequences
+
+    Parameters
+    ----------
+    code1, code2 : ndarray, dtype={np.uint8, np.uint16, np.uint32, np.uint64}
+        The code of the sequences to be aligned.
+    matrix : ndarray, shape(k, k), dtype=np.int32
+        The score matrix.
+    threshold : int
+        If the current score falls this value below the maximum score
+        found, the alignment terminates.
+    gap_penalty : int or tuple(int, int)
+        If an integer is provided, the value will be interpreted as
+        linear gap penalty.
+        If a tuple is provided, an affine gap penalty is used [2]_.
+        The first integer in the tuple is the gap opening penalty,
+        the second integer is the gap extension penalty.
+        threshold : int
+        If the current score falls this value below the maximum score
+        found, the alignment terminates.
+    max_number : int
+        The maximum number of alignments returned.
+        When the number of branches exceeds this value in the traceback
+        step, no further branches are created.
+    score_only : bool
+        If set to ``True``, only the similarity score is calculated and
+        the traceback is not conducted.
+    max_table_size : int
+        Raise a :class:`MemoryError`, if a dynamic programming table
+        exceeds this size.
+
+    Returns
+    -------
+    score : int or None
+        The alignment similarity score.
+    trace : list of (ndarray, shape=(n,2), dtype=int) or None
+        A list of alignment traces, where each trace corresponds to an
+        alignment with the maximum similarity score found.
+        This list has only multiple elements if there are multiple
+        traces, that correspond to the same maximum similarity score.
+        ``None``, if `score_only` is ``False``.
+    """
+    if type(gap_penalty) == int:
+        affine_penalty = False
+    else:
+        affine_penalty = True
+
+
+
+    init_size = (
+        _min(len(code1)+1, INIT_SIZE),
+        _min(len(code2)+1, INIT_SIZE)
+    )
+    trace_table = np.zeros(init_size, dtype=np.uint8)
+
+
+    # Table filling
+    ###############
+    # Set the initial (upper left) score value to 'threshold + 1',
+    # to be able to use '0' as minus infinity value
+    init_score = threshold + 1
+    if affine_penalty:
+        m_table = np.zeros(init_size, dtype=np.int32)
+        g1_table = np.zeros(init_size, dtype=np.int32)
+        g2_table = np.zeros(init_size, dtype=np.int32)
+        # This implementation does not initialize the entire first
+        # row/column to avoid issues with premature pruning in the table
+        # filling process
+        m_table[0,0]  = init_score
+        trace_table, m_table, g1_table, g2_table = _fill_align_table_affine(
+            code1, code2, matrix, trace_table, m_table, g1_table, g2_table,
+            threshold, gap_penalty[0], gap_penalty[1], score_only,
+            max_table_size
+        )
+    else:
+        score_table = np.zeros(init_size, dtype=np.int32)
+        score_table[0,0] = init_score
+        trace_table, score_table = _fill_align_table(
+            code1, code2, matrix, trace_table, score_table, threshold,
+            gap_penalty, score_only, max_table_size
+        )
+
+    # If only the score is desired, the traceback is not necessary
+    if score_only:
+        if affine_penalty:
+            # The maximum score in the gap score tables do not need to
+            # be considered, as these starting positions would indicate
+            # that the alignment starts with a gap
+            # Hence the maximum score value in these tables is always
+            # less than in the match table
+            max_score = np.max(m_table)
+        else:
+            max_score = np.max(score_table)
+        # The initial score needs to be subtracted again,
+        # since it was artificially added for convenience resaons
+        return max_score - init_score, None
+
+
+    # Traceback
+    ###########
+    # Stores all possible traces (= possible alignments)
+    # A trace stores the indices of the aligned symbols
+    # in both sequences
+    trace_list = []
+    # Lists of trace starting indices
+    i_list = np.zeros(0, dtype=int)
+    j_list = np.zeros(0, dtype=int)
+    # List of start states
+    # State specifies the table the trace starts in
+    state_list = np.zeros(0, dtype=int)
+    # The start point is the maximal score in the table
+    # Multiple starting points possible,
+    # when duplicates of maximal score exist
+    if affine_penalty:
+        # Only consicder match table (see reason above)
+        max_score = np.max(m_table)
+        i_list, j_list = np.where((m_table == max_score))
+        state_list = np.append(state_list, np.full(len(i_list), 1))
+    else:
+        max_score = np.max(score_table)
+        i_list, j_list = np.where((score_table == max_score))
+        # State is always 0 for linear gap penalty
+        # since there is only one table
+        state_list = np.zeros(len(i_list), dtype=int)
+
+    # Follow the traces specified in state and indices lists
+    cdef int curr_trace_count
+    for k in range(len(i_list)):
+        i_start = i_list[k]
+        j_start = j_list[k]
+        state_start = state_list[k]
+        # Pessimistic array allocation:
+        # The maximum trace length arises from an alignment, where each
+        # symbol is aligned to a gap
+        trace = np.full(( i_start+1 + j_start+1, 2 ), -1, dtype=np.int64)
+        curr_trace_count = 1
+        follow_trace(
+            trace_table, False, i_start, j_start, 0, trace, trace_list,
+            state=state_start, curr_trace_count=&curr_trace_count,
+            max_trace_count=max_number,
+            # Diagonals are only needed for banded alignments
+            lower_diag=0, upper_diag=0
+        )
+
+    # Replace gap entries in trace with -1
+    for i, trace in enumerate(trace_list):
+        trace = np.flip(trace, axis=0)
+        gap_filter = np.zeros(trace.shape, dtype=bool)
+        gap_filter[np.unique(trace[:,0], return_index=True)[1], 0] = True
+        gap_filter[np.unique(trace[:,1], return_index=True)[1], 1] = True
+        trace[~gap_filter] = -1
+        trace_list[i] = trace
+
+    # Limit the number of generated alignments to `max_number`:
+    # In most cases this is achieved by discarding branches in
+    # 'follow_trace()', however, if multiple local alignment starts
+    # are used, the number of created traces are the number of
+    # starts times `max_number`
+    trace_list = trace_list[:max_number]
+
+    return max_score - init_score, trace_list
+
+
+@cython.boundscheck(False)
+@cython.wraparound(False)
+def _fill_align_table(CodeType1[:] code1 not None,
+                      CodeType2[:] code2 not None,
+                      const int32[:,:] matrix not None,
+                      uint8[:,:] trace_table not None,
+                      int32[:,:] score_table not None,
+                      int32 threshold,
+                      int32 gap_penalty,
+                      bint score_only,
+                      int64 max_table_size):
+    """
+    Fill an alignment table with linear gap penalty using dynamic
+    programming.
+
+    Parameters
+    ----------
+    code1, code2
+        The sequence code of each sequence to be aligned.
+    matrix
+        The score matrix obtained from the :class:`SubstitutionMatrix`
+        object.
+    trace_table
+        The initial matrix containing values indicating the direction
+        for the traceback step.
+    score_table
+        The initial score table.
+    threshold
+        An alignment cell is invalidated if the total similarity score
+        is this threshold below the maximum similarity score found so
+        far.
+    gap_penalty
+        The linear gap penalty.
+    score_only
+        If true, the trace table is not filled.
+    max_table_size : int64
+        Raise a :class:`MemoryError`, if a dynamic programming table
+        exceeds this size.
+
+    Returns
+    -------
+    trace_table
+        The filled trace table.
+    score_table
+        The filled score table.
+    """
+    cdef int i, j, k=0
+    # The ranges for i in the current (k=0)
+    # and previous (k=1, k=2) antidiagonals, that point to valid cells
+    cdef int i_min_k_0=0, i_max_k_0=0
+    cdef int i_min_k_1=0, i_max_k_1=0
+    cdef int i_min_k_2=0, i_max_k_2=0
+    # The pruned range for i and j in the current antidiagonal,
+    # calculated from the previous antidiagonals
+    cdef int i_min, i_max
+    cdef int j_max
+    # The maximum values for i and j ever encountered while iterating
+    # over the antidiagonals -> used for final trimming of tables
+    cdef int i_max_total=0, j_max_total=0
+
+    cdef int32 from_diag, from_left, from_top
+    cdef uint8 trace = 0
+    cdef int32 score = 0
+    cdef int32 max_score = score_table[0, 0]
+    cdef int32 req_score = max_score - threshold
+
+    # Instead of iteration over row and column,
+    # iterate over antidiagonals and diagonals to achieve symmetric
+    # treatment of both sequences
+    for k in range(1, code1.shape[0] + code2.shape[0] + 1):
+        # Prepare values for iteration
+        i_min_k_2 = i_min_k_1
+        i_max_k_2 = i_max_k_1
+        i_min_k_1 = i_min_k_0
+        i_max_k_1 = i_max_k_0
+        # Reset values for iteration to most 'restrictive' values
+        # These restrictive values are overwritten in the next iteration
+        # if valid cells are present
+        i_min_k_0 = k
+        i_max_k_0 = 0
+
+        # Prune index range for antidiagonal
+        # to range where valid cells exist
+        i_min = _min(i_min_k_1,     i_min_k_2 + 1)
+        i_max = _max(i_max_k_1 + 1, i_max_k_2 + 1)
+        # The index must also not be out of sequence range
+        i_min = _max(i_min, k - code2.shape[0])
+        i_max = _min(i_max, code1.shape[0])
+        # The algorithm has finished,
+        # if the calculated antidiagonal has no range of valid cells
+        if i_min > i_max:
+            break
+
+        j_max = k - i_min
+        # Expand ndarrays
+        # if their size would be exceeded in the following iteration
+        if i_max >= score_table.shape[0]:
+            score_table = _extend_table(
+                np.asarray(score_table), 0, max_table_size
+            )
+            if not score_only:
+                trace_table = _extend_table(
+                    np.asarray(trace_table), 0, max_table_size
+                )
+        if j_max >= score_table.shape[1]:
+            score_table = _extend_table(
+                np.asarray(score_table), 1, max_table_size
+            )
+            if not score_only:
+                trace_table = _extend_table(
+                    np.asarray(trace_table), 1, max_table_size
+                )
+        i_max_total = _max(i_max_total, i_max)
+        j_max_total = _max(j_max_total, j_max)
+
+        for i in range(i_min, i_max+1):
+            j = k - i
+
+            # Evaluate score from diagonal direction
+            if i != 0 and j != 0:
+                from_diag = score_table[i-1, j-1]
+                # Check if score stems from cells that are valid
+                if from_diag != 0:
+                    # -1 in sequence index is necessary
+                    # due to the shift of the sequences
+                    # to the bottom/right in the table
+                    from_diag += matrix[code1[i-1], code2[j-1]]
+                else:
+                    from_diag = 0
+            else:
+                from_diag = 0
+            # Evaluate score through gap insertion
+            if i != 0:
+                from_top = score_table[i-1, j] + gap_penalty
+            else:
+                from_top = 0
+            if j != 0:
+                from_left = score_table[i, j-1] + gap_penalty
+            else:
+                from_left = 0
+
+            if score_only:
+                score = _max(from_diag, _max(from_left, from_top))
+            else:
+                trace = get_trace_linear(
+                    from_diag, from_left, from_top, &score
+                )
+
+            # Check if the obtained score reaches the required threshold
+            # and if they even exceed the maximum score
+            if score >= req_score:
+                if i_min_k_0 == k:
+                    # 'i_min_k_0 == k'
+                    # -> i_min_k_0 has not been set in this iteration, yet
+                    i_min_k_0 = i
+                i_max_k_0 = i
+                score_table[i,j] = score
+                if not score_only:
+                    trace_table[i,j] = trace
+                if score > max_score:
+                    max_score = score
+                    req_score = max_score - threshold
+
+
+    return np.asarray(trace_table)[:i_max_total+1, :j_max_total+1], \
+           np.asarray(score_table)[:i_max_total+1, :j_max_total+1]
+
+
+@cython.boundscheck(False)
+@cython.wraparound(False)
+def _fill_align_table_affine(CodeType1[:] code1 not None,
+                             CodeType2[:] code2 not None,
+                             const int32[:,:] matrix not None,
+                             uint8[:,:] trace_table not None,
+                             int32[:,:] m_table not None,
+                             int32[:,:] g1_table not None,
+                             int32[:,:] g2_table not None,
+                             int32 threshold,
+                             int32 gap_open,
+                             int32 gap_ext,
+                             bint score_only,
+                             int64 max_table_size):
+    """
+    Fill an alignment table with affines gap penalty using dynamic
+    programming.
+
+    Parameters
+    ----------
+    code1, code2
+        The sequence code of each sequence to be aligned.
+    matrix
+        The score matrix obtained from the :class:`SubstitutionMatrix`
+        object.
+    trace_table
+        The initial matrix containing values indicating the direction
+        for the traceback step.
+    m_table, g1_table, g2_table
+        The alignment tables containing the scores.
+        `m_table` contains values for matches.
+        `g1_table` contains values for gaps in the first sequence.
+        `g2_table` contains values for gaps in the second sequence.
+    threshold
+        An alignment cell is invalidated if the total similarity score
+        is this threshold below the maximum similarity score found so
+        far.
+    gap_open
+        The gap opening penalty.
+    gap_ext
+        The gap extension penalty.
+    score_only
+        If true, the trace table is not filled.
+    max_table_size : int64
+        Raise a :class:`MemoryError`, if a dynamic programming table
+        exceeds this size.
+
+    Returns
+    -------
+    trace_table
+        The filled trace table.
+    m_table, g1_table, g2_table
+        The filled score tables.
+    """
+    cdef int i, j, k=0
+    # The ranges for i in the current (k=0)
+    # and previous (k=1, k=2) antidiagonals, that point to valid cells
+    cdef int i_min_k_0=0, i_max_k_0=0
+    cdef int i_min_k_1=0, i_max_k_1=0
+    cdef int i_min_k_2=0, i_max_k_2=0
+    # The pruned range for i and j in the current antidiagonal,
+    # calculated from the previous antidiagonals
+    cdef int i_min, i_max
+    cdef int j_max
+    # The maximum values for i and j ever encountered while iterating
+    # over the antidiagonals -> used for final trimming of tables
+    cdef int i_max_total=0, j_max_total=0
+
+    cdef uint8 trace = 0
+    cdef bint is_valid_cell
+
+    cdef int32 mm_score, g1m_score, g2m_score
+    cdef int32 mg1_score, g1g1_score
+    cdef int32 mg2_score, g2g2_score
+    cdef int32 m_score, g1_score, g2_score
+    cdef int32 similarity_score
+    cdef int32 max_score = m_table[0, 0]
+    cdef int32 req_score = max_score - threshold
+
+    # Instead of iteration over row and column,
+    # iterate over antidiagonals and diagonals to achieve symmetric
+    # treatment of both sequences
+    for k in range(1, code1.shape[0] + code2.shape[0] + 1):
+        # Prepare values for iteration
+        i_min_k_2 = i_min_k_1
+        i_max_k_2 = i_max_k_1
+        i_min_k_1 = i_min_k_0
+        i_max_k_1 = i_max_k_0
+        # Reset values for iteration to most 'restrictive' values
+        # These restrictive values are overwritten in the next iteration
+        # if valid cells are present
+        i_min_k_0 = k
+        i_max_k_0 = 0
+
+        # Prune index range for antidiagonal
+        # to range where valid cells exist
+        i_min = _min(i_min_k_1,     i_min_k_2 + 1)
+        i_max = _max(i_max_k_1 + 1, i_max_k_2 + 1)
+        # The index must also not be out of sequence range
+        i_min = _max(i_min, k - code2.shape[0])
+        i_max = _min(i_max, code1.shape[0])
+        # The algorithm has finished,
+        # if the calculated antidiagonal has no range of valid cells
+        if i_min > i_max:
+            break
+
+        j_max = k - i_min
+        # Expand ndarrays
+        # if their size would be exceeded in the following iteration
+        if i_max >= m_table.shape[0]:
+            m_table  = _extend_table(np.asarray(m_table),  0, max_table_size)
+            g1_table = _extend_table(np.asarray(g1_table), 0, max_table_size)
+            g2_table = _extend_table(np.asarray(g2_table), 0, max_table_size)
+            if not score_only:
+                trace_table = _extend_table(
+                    np.asarray(trace_table), 0, max_table_size
+                )
+        if j_max >= m_table.shape[1]:
+            m_table  = _extend_table(np.asarray(m_table),  1, max_table_size)
+            g1_table = _extend_table(np.asarray(g1_table), 1, max_table_size)
+            g2_table = _extend_table(np.asarray(g2_table), 1, max_table_size)
+            if not score_only:
+                trace_table = _extend_table(
+                    np.asarray(trace_table), 1, max_table_size
+                )
+        i_max_total = _max(i_max_total, i_max)
+        j_max_total = _max(j_max_total, j_max)
+
+        for i in range(i_min, i_max+1):
+            j = k - i
+
+            # Evaluate score from diagonal direction
+            if i != 0 and j != 0:
+                # -1 in sequence index is necessary
+                # due to the shift of the sequences
+                # to the bottom/right in the table
+                similarity_score = matrix[code1[i-1], code2[j-1]]
+                mm_score  = m_table[i-1,j-1]
+                g1m_score = g1_table[i-1,j-1]
+                g2m_score = g2_table[i-1,j-1]
+                # Check if scores stem from cells that are valid
+                if mm_score != 0:
+                    mm_score += similarity_score
+                if g1m_score != 0:
+                    g1m_score += similarity_score
+                if g2m_score != 0:
+                    g2m_score += similarity_score
+            else:
+                mm_score = 0
+                g1m_score = 0
+                g2m_score = 0
+            # Evaluate score through gap insertion
+            # No transition from g1_table to g2_table and vice versa,
+            # since this would mean adjacent gaps in both sequences;
+            # a substitution makes more sense in this case
+            if j != 0:
+                mg1_score  =  m_table[i,j-1] + gap_open
+                g1g1_score = g1_table[i,j-1] + gap_ext
+            else:
+                mg1_score  = 0
+                g1g1_score = 0
+            if i != 0:
+                mg2_score  = m_table[i-1,j]  + gap_open
+                g2g2_score = g2_table[i-1,j] + gap_ext
+            else:
+                mg2_score  = 0
+                g2g2_score = 0
+
+
+
+            if score_only:
+                m_score  = _max(mm_score, _max(g1m_score, g2m_score))
+                g1_score = _max(mg1_score, g1g1_score)
+                g2_score = _max(mg2_score, g2g2_score)
+            else:
+                trace = get_trace_affine(
+                    mm_score, g1m_score, g2m_score,
+                    mg1_score, g1g1_score,
+                    mg2_score, g2g2_score,
+                    # The max score values to be written
+                    &m_score, &g1_score, &g2_score
+                )
+
+
+            # Check if the obtained scores reach the required threshold
+            # and if they even exceed the maximum score
+            is_valid_cell = False
+
+            if m_score >= req_score:
+                if i_min_k_0 == k:
+                    i_min_k_0 = i
+                i_max_k_0 = i
+                m_table[i,j] = m_score
+                is_valid_cell = True
+                if m_score > max_score:
+                    max_score = m_score
+                    req_score = max_score - threshold
+
+            if g1_score >= req_score:
+                if i_min_k_0 == k:
+                    i_min_k_0 = i
+                i_max_k_0 = i
+                g1_table[i,j] = g1_score
+                is_valid_cell = True
+                if g1_score > max_score:
+                    max_score = g1_score
+                    req_score = max_score - threshold
+
+            if g2_score >= req_score:
+                if i_min_k_0 == k:
+                    i_min_k_0 = i
+                i_max_k_0 = i
+                g2_table[i,j] = g2_score
+                is_valid_cell = True
+                if g2_score > max_score:
+                    max_score = g2_score
+                    req_score = max_score - threshold
+
+            if is_valid_cell and not score_only:
+                trace_table[i,j] = trace
+
+
+    return np.asarray(trace_table)[:i_max_total+1, :j_max_total+1], \
+           np.asarray(m_table    )[:i_max_total+1, :j_max_total+1], \
+           np.asarray(g1_table   )[:i_max_total+1, :j_max_total+1], \
+           np.asarray(g2_table   )[:i_max_total+1, :j_max_total+1]
+
+
+def _extend_table(table, int dimension, int64 max_size):
+    if dimension == 0:
+        new_shape = (table.shape[0] * 2, table.shape[1])
+    else:
+        new_shape = (table.shape[0], table.shape[1] * 2)
+    if new_shape[0] * new_shape[1] > max_size:
+        raise MemoryError("Maximum table size exceeded")
+    new_table = np.zeros(new_shape, dtype=table.dtype)
+    # Fill in exiisting data
+    new_table[:table.shape[0], :table.shape[1]] = table
+    return new_table
+
+
+cdef inline int _min(int32 a, int32 b):
+    return a if a < b else b
+
+cdef inline int _max(int32 a, int32 b):
+    return a if a > b else b