PyPyNum 1.16.0__py3-none-any.whl → 1.16.2__py3-none-any.whl

{PyPyNum-1.16.0.dist-info → PyPyNum-1.16.2.dist-info}/METADATA

@@ -1,6 +1,6 @@
 Metadata-Version: 2.1
 Name: PyPyNum
-Version: 1.16.0
+Version: 1.16.2
 Summary: PyPyNum is a Python library for math & science computations, covering algebra, calculus, stats, with data structures like matrices, vectors, tensors. It offers numerical tools, programs, and supports computational ops, functions, processing, simulation, & visualization in data science & ML, crucial for research, engineering, & data processing.
 Home-page: https://github.com/PythonSJL/PyPyNum
 Author: Shen Jiayi
@@ -234,7 +234,7 @@ processing.</font><font color = red>[Python>=3.4]</font>
 [![Downloads](https://static.pepy.tech/badge/pypynum/month)](https://pepy.tech/project/pypynum)
 [![Downloads](https://static.pepy.tech/badge/pypynum/week)](https://pepy.tech/project/pypynum)
 
-## Version -> 1.16.0 | PyPI -> https://pypi.org/project/PyPyNum/ | Gitee -> https://www.gitee.com/PythonSJL/PyPyNum | GitHub -> https://github.com/PythonSJL/PyPyNum
+## Version -> 1.16.2 | PyPI -> https://pypi.org/project/PyPyNum/ | Gitee -> https://www.gitee.com/PythonSJL/PyPyNum | GitHub -> https://github.com/PythonSJL/PyPyNum
 
 ![LOGO](PyPyNum.png)
 
@@ -247,6 +247,15 @@ The logo cannot be displayed on PyPI, it can be viewed in Gitee or GitHub.
 + Update versions periodically to add more practical features
 + If you need to contact, please add QQ number 2261748025 (Py𝙿𝚢𝚝𝚑𝚘𝚗-水晶兰), or through my email 2261748025@qq.com
 
+```
++++++++++++++++++++++++++++++++++++++++++
++ Tip:                                  +
++ Have suggestions or feature requests? +
++ Feel free to share them with us.      +
++ Your feedback is highly appreciated!  +
++++++++++++++++++++++++++++++++++++++++++
+```
+
 ### Name and Function Introduction of Submodules
 
 |   Submodule Name    |                       Function Introduction                        |
@@ -327,81 +336,69 @@ Python interpreter and run it!
 ```
 !=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
 
-The submodule 'consts' has added
-a large number of mathematical
-and scientific constants,
-currently totaling 128.
+<<< Here are the newly added functions >>>
 
-This module defines a collection
-of constants representing
-various physical, mathematical,
-and unit conversion factors.
 
-These constants are commonly
-used in scientific and
-engineering calculations.
+kmp_table(pattern: Union[list, tuple, str]) -> list
+    Introduction
+    ==========
+    Generate the KMP (Knuth-Morris-Pratt) table for a given pattern.
 
-If you want to know information
-about each constant, you can
-execute 'help(consts)' to
-obtain it.
+    The KMP table is used to efficiently find occurrences of a pattern within a sequence by avoiding unnecessary
+    comparisons after a mismatch. This table determines how many characters can be skipped after a mismatch.
 
-!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
+    Example
+    ========
+    >>> kmp_table("AGCTGATCGTACGTAAGCTAGCTA")
+    [0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 2, 3, 4, 1, 2, 3, 4, 1]
+    >>>
+    :param pattern: The pattern for which to generate the KMP table.
+    :return: A list representing the KMP table for the given pattern.
 
 
-<<< Here are the newly added functions >>>
+findall(seq: Union[list, tuple, str], pat: Union[list, tuple, str]) -> list
+    Introduction
+    ==========
+    Find all indices of the subsequence 'pat' in 'seq'.
 
+    This function is designed to handle sequences such as lists, tuples, or strings and find all indices
+    of specified subsequences. It allows overlapping matches.
 
-PyPyNum
-├── special
-│   └── FUNCTION
-│       ├── qbinomial(n: typing.Union[int, float, complex], m: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│       │   # Calculate the q-binomial coefficient of n and m with parameter q.
-│       ├── qfactorial(n: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│       │   # Compute the q-factorial of n with parameter q.
-│       ├── qgamma(n: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│       │   # Calculate the q-gamma function of n with parameter q.
-│       └── qpochhammer(a: typing.Union[int, float, complex], q: typing.Union[int, float, complex], n: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│           # Compute the q-Pochhammer symbol for given a, q, and n.
-├── multiprec
-│   └── FUNCTION
-│       ├── mp_catalan(sigfigs: int) -> decimal.Decimal
-│           # Calculate the Catalan's constant with a specified number of significant figures using multiprecision arithmetic.
-├── seqs
-│   └── FUNCTION
-│       ├── padovan(n: int, single: bool) -> typing.Union[int, list]
-│       │   # Generate the Padovan sequence up to the nth term.
-│       ├── pelllucas(n: int, single: bool) -> typing.Union[int, list]
-│       │   # Generate the Pell-Lucas sequence up to the nth term.
-│       ├── perrin(n: int, single: bool) -> typing.Union[int, list]
-│       │   # Generate the Perrin sequence up to the nth term.
-│       └── sylvester(n: int, single: bool) -> typing.Union[int, list]
-│           # Generate the Sylvester sequence up to the nth term.
-├── tools
-│   └── FUNCTION
-│       ├── lcsubseq(x: typing.Union[list, tuple, str], y: typing.Union[list, tuple, str]) -> list
-│       │   # Find the longest common subsequence between two sequences x and y.
-│       └── lcsubstr(x: typing.Union[list, tuple, str], y: typing.Union[list, tuple, str]) -> list
-│           # Find the longest common substring between two sequences x and y.
-├── matrices
-│   ├── CLASS
-│   │   └── Matrix(pypynum.arrays.Array)/__init__(self: Any, data: Any, check: Any) -> Any
-│   │       # Initialize a Matrix object from a given data array.
-│   └── FUNCTION
-│       ├── perm_mat(num_rows: int, num_cols: int, row_swaps: typing.Union[list, tuple], col_swaps: typing.Union[list, tuple], rtype: typing.Callable) -> typing.Any
-│       │   # Create a permutation matrix based on specified row and column swaps.
-│       └── perm_mat_indices(num_rows: int, num_cols: int, row_swaps: typing.Union[list, tuple], col_swaps: typing.Union[list, tuple]) -> tuple
-│           # Compute the indices for a permutation matrix based on specified row and column swaps.
+    Example
+    ========
+    >>> findall([2, 1, 2, 1, 2, 1, 2, 1], [1, 2, 1, 2])
+    [1, 3]
+    >>>
+    :param seq: The sequence in which to find the subsequence.
+    :param pat: The subsequence to be found.
+    :return: A list of starting indices where the subsequence is found.
 
 
-!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
+---------------------------------------------------------------------------------------
+| q-functions generalize classical math functions by introducing parameter q.         |
+| They are key in combinatorics and special functions, widely applied.                |
+| As q approaches 1, they revert to classical forms.                                  |
+| Examples include q-factorials, q-binomial coefficients, Jackson q-Bessel functions. |
+| These functions are crucial in fractals, chaotic systems, quantum groups.           |
+| They provide tools for solving complex mathematical challenges effectively.         |
+---------------------------------------------------------------------------------------
+
+
+Here are the 12 new q-functions added in the current version (adding the previous 4 makes a total of 16):
+
 
-Other functions and classes have
-also undergone certain
-modifications, such as adding a
-"reduce" parameter to the "qr"
-function to determine whether to
-crop the matrix.
+qbeta(a: Union[int, float, complex], b: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qcos_large(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qcos_small(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qcosh_large(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qcosh_small(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qexp_large(z: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qexp_small(z: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qpi(q: Union[int, float, complex]) -> Union[int, float, complex]
+qsin_large(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qsin_small(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qsinh_large(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qsinh_small(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
 
 !=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
 ```
@@ -439,15 +436,16 @@ PyPyNum
 │       ├── asarray(data: Any) -> Any
 │       ├── aslist(data: Any) -> Any
 │       ├── boolarray(data: Any) -> Any
-│       ├── fill(shape: Any, sequence: Any, repeat: Any, pad: Any, rtype: Any) -> Any
-│       ├── full(shape: Any, fill_value: Any, rtype: Any) -> Any
-│       ├── full_like(a: Any, fill_value: Any, rtype: Any) -> Any
+│       ├── fill(shape: typing.Union[list, tuple], sequence: typing.Union[list, tuple], repeat: bool, pad: typing.Any, rtype: typing.Callable) -> typing.Any
+│       ├── full(shape: typing.Union[list, tuple], fill_value: typing.Any, rtype: typing.Callable) -> typing.Any
+│       ├── full_like(a: typing.Any, fill_value: typing.Any, rtype: typing.Callable) -> typing.Any
 │       ├── get_shape(data: Any) -> Any
 │       ├── is_valid_array(_array: Any, _shape: Any) -> Any
-│       ├── ones(shape: Any, rtype: Any) -> Any
-│       ├── ones_like(a: Any, rtype: Any) -> Any
-│       ├── zeros(shape: Any, rtype: Any) -> Any
-│       └── zeros_like(a: Any, rtype: Any) -> Any
+│       ├── ones(shape: typing.Union[list, tuple], rtype: typing.Callable) -> typing.Any
+│       ├── ones_like(a: typing.Any, rtype: typing.Callable) -> typing.Any
+│       ├── tensorproduct(tensors: pypynum.arrays.Array) -> pypynum.arrays.Array
+│       ├── zeros(shape: typing.Union[list, tuple], rtype: typing.Callable) -> typing.Any
+│       └── zeros_like(a: typing.Any, rtype: typing.Callable) -> typing.Any
 ├── chars
 │   ├── CLASS
 │   └── FUNCTION
@@ -501,7 +499,7 @@ PyPyNum
 │       ├── gamma_pdf(x: Any, shape: Any, scale: Any) -> Any
 │       ├── geometric_pmf(k: Any, p: Any) -> Any
 │       ├── hypergeom_pmf(k: Any, mg: Any, n: Any, nt: Any) -> Any
-│       ├── inv_gauss_pdf(x: Any, mu: Any, lambda_: Any, alpha: Any) -> Any
+│       ├── invgauss_pdf(x: Any, mu: Any, lambda_: Any, alpha: Any) -> Any
 │       ├── levy_pdf(x: Any, c: Any) -> Any
 │       ├── log_logistic_cdf(x: Any, alpha: Any, beta: Any) -> Any
 │       ├── log_logistic_pdf(x: Any, alpha: Any, beta: Any) -> Any
@@ -647,7 +645,7 @@ PyPyNum
 │       ├── cosh(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── cot(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── coth(x: typing.Union[int, float]) -> typing.Union[int, float]
-│       ├── cov(x: typing.Union[list, tuple], y: typing.Union[list, tuple], dof: int) -> typing.Union[int, float, complex]
+│       ├── cov(x: typing.Union[list, tuple], y: typing.Union[list, tuple], ddof: int) -> typing.Union[int, float, complex]
 │       ├── crt(n: typing.Union[list, tuple], a: typing.Union[list, tuple]) -> int
 │       ├── csc(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── csch(x: typing.Union[int, float]) -> typing.Union[int, float]
@@ -695,13 +693,13 @@ PyPyNum
 │       ├── sinh(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── skew(data: typing.Union[list, tuple]) -> float
 │       ├── square_mean(numbers: typing.Union[list, tuple]) -> typing.Union[int, float, complex]
-│       ├── std(numbers: typing.Union[list, tuple], dof: int) -> typing.Union[int, float, complex]
+│       ├── std(numbers: typing.Union[list, tuple], ddof: int) -> typing.Union[int, float, complex]
 │       ├── sumprod(arrays: typing.Union[list, tuple]) -> typing.Union[int, float, complex]
 │       ├── tan(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── tanh(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── totient(n: int) -> int
 │       ├── upper_gamma(s: typing.Union[int, float, complex], x: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│       ├── var(numbers: typing.Union[list, tuple], dof: int) -> typing.Union[int, float, complex]
+│       ├── var(numbers: typing.Union[list, tuple], ddof: int) -> typing.Union[int, float, complex]
 │       ├── xlogy(x: typing.Union[int, float, complex], y: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       └── zeta(alpha: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 ├── matrices
@@ -848,10 +846,22 @@ PyPyNum
 │       ├── hyp1f1(a0: typing.Union[int, float, complex], b0: typing.Union[int, float, complex], z: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       ├── hyp2f1(a0: typing.Union[int, float, complex], a1: typing.Union[int, float, complex], b0: typing.Union[int, float, complex], z: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       ├── hyppfq(a: typing.Union[list, tuple], b: typing.Union[list, tuple], z: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qbeta(a: typing.Union[int, float, complex], b: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       ├── qbinomial(n: typing.Union[int, float, complex], m: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qcos_large(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qcos_small(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qcosh_large(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qcosh_small(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qexp_large(z: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qexp_small(z: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       ├── qfactorial(n: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       ├── qgamma(n: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│       └── qpochhammer(a: typing.Union[int, float, complex], q: typing.Union[int, float, complex], n: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qpi(q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qpochhammer(a: typing.Union[int, float, complex], q: typing.Union[int, float, complex], n: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qsin_large(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qsin_small(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qsinh_large(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       └── qsinh_small(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 ├── stattest
 │   ├── CLASS
 │   └── FUNCTION
@@ -870,8 +880,7 @@ PyPyNum
 │   │   └── Tensor(pypynum.arrays.Array)/__init__(self: Any, data: Any, check: Any) -> Any
 │   └── FUNCTION
 │       ├── ten(data: list) -> pypynum.tensors.Tensor
-│       ├── tensor_and_number(tensor: Any, operator: Any, number: Any) -> Any
-│       └── tensorproduct(tensors: pypynum.tensors.Tensor) -> pypynum.tensors.Tensor
+│       └── tensor_and_number(tensor: Any, operator: Any, number: Any) -> Any
 ├── test
 │   ├── CLASS
 │   └── FUNCTION
@@ -882,10 +891,13 @@ PyPyNum
 │   ├── CLASS
 │   └── FUNCTION
 │       ├── classify(array: typing.Union[list, tuple]) -> dict
+│       ├── cos_sim(seq1: typing.Union[list, tuple, str], seq2: typing.Union[list, tuple, str], is_vector: bool) -> float
 │       ├── dedup(iterable: typing.Union[list, tuple, str]) -> typing.Union[list, tuple, str]
 │       ├── fast_pow(a: typing.Any, n: int, init: typing.Any, mul: typing.Callable) -> typing.Any
+│       ├── findall(seq: typing.Union[list, tuple, str], pat: typing.Union[list, tuple, str]) -> list
 │       ├── frange(start: typing.Union[int, float], stop: typing.Union[int, float], step: float) -> list
 │       ├── geomspace(start: typing.Union[int, float], stop: typing.Union[int, float], number: int) -> list
+│       ├── kmp_table(pattern: typing.Union[list, tuple, str]) -> list
 │       ├── lcsubseq(x: typing.Union[list, tuple, str], y: typing.Union[list, tuple, str]) -> list
 │       ├── lcsubstr(x: typing.Union[list, tuple, str], y: typing.Union[list, tuple, str]) -> list
 │       ├── levenshtein(x: typing.Union[list, tuple, str], y: typing.Union[list, tuple, str]) -> int
@@ -894,6 +906,7 @@ PyPyNum
 │       ├── primality(n: int, iter_num: int) -> bool
 │       ├── prime_factors(integer: int, dictionary: bool, pollard_rho: bool) -> typing.Union[list, dict]
 │       ├── primes(limit: int) -> list
+│       ├── replace(seq: typing.Union[list, tuple], old: typing.Union[list, tuple], new: typing.Union[list, tuple], count: int) -> typing.Union[list, tuple]
 │       ├── semiprimes(limit: int) -> list
 │       ├── split(iterable: typing.Union[list, tuple, str], key: typing.Union[list, tuple], retain: bool) -> list
 │       └── twinprimes(limit: int) -> list

{PyPyNum-1.16.0.dist-info → PyPyNum-1.16.2.dist-info}/RECORD

@@ -1,13 +1,13 @@
 pypynum/PyPyNum.png,sha256=t96tJPWfHxT8kcXm_qZI2z5W36TgOqjCU9qdgbmlFws,11623
-pypynum/README.md,sha256=1SOzsAn-Z-7WMCdc3TNB_SFHqhNscOpf7DCQ7mh6Cr4,84595
-pypynum/__init__.py,sha256=2Huv1gP1tUG1seEJmofWw_UMFlf3A_xIKT87hLfEMn8,2640
-pypynum/arrays.py,sha256=NiNs_wTeVgQpJuSe5OrIdFFG0Nln_ed4Im3hua0ZBnE,13293
-pypynum/chars.py,sha256=6XNmH0zYsv0pfadW3KoevrR8xQPIkles9oGikjS6R1I,2181
+pypynum/README.md,sha256=RQ25LQM5-mWR-7bvwgUn2TzuklWLomSeDABoL0QeN2A,87008
+pypynum/__init__.py,sha256=BqVO2tFYX-UWMao6Uy1Zl8snL6H2_GxNM6Chestl02Q,2640
+pypynum/arrays.py,sha256=81dlyUn1xNs1f4enpfQjXEJurjEMfQqaQMfMC3quR8U,15793
+pypynum/chars.py,sha256=HIqTmWl58GypJgVIlgSFVc2icI01NczfbRyu5QmuHz0,2178
 pypynum/ciphers.py,sha256=kC7wZk3FF-MCCvn2-1YxiaRa4ImDKxyyihJYc6Dyf5E,10008
 pypynum/consts.py,sha256=enetPwJevWgYXuGEasAb-tXMHpvL2xWKUe-B1gTwInk,8416
 pypynum/crandom.py,sha256=44GZ7o6y5PwgL-cZLkXUZaAUfiW6aadyRNfMdxTnH30,5111
 pypynum/dataproc.py,sha256=bJ2a1-S7TQj8V8vzXZ3ooP32fBe99NQU0orPGprEIdg,9231
-pypynum/dists.py,sha256=SGxZ08n4mRaqegHILoaJNH4jzPzk-fsE7kvN-EmegPQ,29697
+pypynum/dists.py,sha256=fz7hZZfHFWDHnxo7Li9eNkaj7cQtE6SuYGaitSRwHKc,29695
 pypynum/equations.py,sha256=_oywKzbrOPOOhD4yu83qqNiIOKQPbJJs6SghdkGbqUw,561
 pypynum/fft.py,sha256=AtG0tESykzEs4gDsXhcizW7qhQnmw0gjcWcXefBqzhs,1401
 pypynum/files.py,sha256=iLtTc5UTtUUWoh2sDJl5Yyy_rT8-Vi0pby5c2J95EqE,3397
@@ -18,9 +18,9 @@ pypynum/images.py,sha256=DPpsW_qdoKSrXz3w6DWaQDj9Y_u5l_JYWbNt47taJbs,12157
 pypynum/interp.py,sha256=wNMa6M_IRpSe026tuRxXfr244oBtgHOpCpYlGd4eyhA,4920
 pypynum/kernels.py,sha256=GMwWnjLWEprFXSEAIN8d6GZrC2KDx6qhJdbcLBoYOTg,15869
 pypynum/logics.py,sha256=EwvWFNND14__oWx7o-_oYIUubmVhp3DrvBcnRCWW8vc,10999
-pypynum/maths.py,sha256=McuOXRktbjcjZpTfWEoHnmFkeeQVacMoHyThqTIC27E,32808
+pypynum/maths.py,sha256=Q8TX1o3j5g-0VKS2kHiaxMKkvWXa20vGi1jhIuaJsXw,32820
 pypynum/matrices.py,sha256=useh4_Hlk3YBRTSTJK6SsErTRnDVblsqB0a7iw1mB_k,22439
-pypynum/multiprec.py,sha256=r8_OoWH56pRbBxCjd5-qkfxJMBU1r7LjV4Wvr7zR46Y,20111
+pypynum/multiprec.py,sha256=LCaj0pkZIXmPKodm2Jt5RdyTg20Q6Js-n7PGBzqMXhk,20111
 pypynum/networks.py,sha256=iSOvC9JW1h4AFGokGGOTkKie5hAYN_YT9H4f3apI9b8,3275
 pypynum/numbers.py,sha256=EPzw8zq5U7GQj8URu2VxeVIXS-_XQm2ADmSAIHa816k,11133
 pypynum/plotting.py,sha256=mbIYK5TpY1qvuMJrqz4d8bxJEiZww3AI684vSKV-DgU,7781
@@ -29,21 +29,21 @@ pypynum/pprinters.py,sha256=Qt9-V5SUyoOqC3lsUU5D5zSSM-MmcnFCUyUtLxhS4pE,2514
 pypynum/quats.py,sha256=tn1ZogMiV8FGYucZ3u8ynG6SFpPjhFAachVHxgBdDZk,8000
 pypynum/random.py,sha256=fGaJfwS0QUWV-qb8hldXpRUYJ-79n7Al0gEmPJMAwJc,2254
 pypynum/regs.py,sha256=mV1r1KkXAv07FmcTntaBF0rcwHBXUyXPvC9h6UOkhE0,2042
-pypynum/seqs.py,sha256=Hch8ebCrVFHUfKig54CVGzf3xXkVJlVbLsE0e7flOX4,11666
-pypynum/special.py,sha256=58pRacza__MwnovWFRemVglszF1wdUwgA4uyS25M47w,11643
+pypynum/seqs.py,sha256=Y60nSV32wcuY3zyY8h_l185BURkCJoa82BhZVgI3AMY,11681
+pypynum/special.py,sha256=cuucF1Z6CPRaBiffRKKbStfWaZkbOEqLPTIg7zRXLFQ,19748
 pypynum/stattest.py,sha256=nCAqFjaHVa9EOaWcmgWrhPuBoyLdoypkz6_YeM_AOd8,5511
 pypynum/symbols.py,sha256=u-Dig3OLs6qoLzxMpTAYJGq5uSWDMvgU13TAHKLyjMY,2768
-pypynum/tensors.py,sha256=gKpklk-7R9FHRD9iUOXOG6d-h-mL3I_E7TAL-xOWKu8,3685
+pypynum/tensors.py,sha256=F87npY9VbaCAr0OvTwsW1GAhEQPQAQTVlJzeVuf4zSg,3418
 pypynum/test.py,sha256=HY6TiQr9-wIadRoXElu8TJkVWKMxcahisyWBtew8B9c,8730
 pypynum/this.py,sha256=wT7DwodxqOQ7LoDaUtvskMkAb8CODL_56mtXPy12P54,3411
-pypynum/tools.py,sha256=QOuftgsu9603odrzMUXG9HQIJumFtGhXq0x9PFlUIS4,18850
+pypynum/tools.py,sha256=bxIoWjjnjlasEYnhrk_2nItKGRndwPrk_f2lK7SLUQ4,25422
 pypynum/trees.py,sha256=b02t69vBjc3ibKaUAkWfBvMDdsugF4DpGC2-q4RsgEU,39779
 pypynum/types.py,sha256=v1lGIL_p0xgxL6mGX7uBQBHBa7UScKCsgPkW8Q6nzlk,3348
 pypynum/ufuncs.py,sha256=Lmr_ZVsswQqbGo2MB8gjd_lijRBOZIy2q2wQBOHvYxM,3549
 pypynum/utils.py,sha256=BhH_iSU44bS6tC3MMrDfIfGhIsQg9nMVlp6fl0-KcRA,21001
-pypynum/vectors.py,sha256=GGVk0YSLVm-hzJjm068W7tNRYu8NqPgOKtWHIOTn9yY,3212
-pypynum/zh_cn.py,sha256=YBmTCO0h-xMDEo9pfpaR1qvh0qaL811psoZDdBniuzE,13818
-PyPyNum-1.16.0.dist-info/METADATA,sha256=insI60KoVZ3gxJwZN7pb4WQC3iQ9Kgia_VYIItcyUxQ,98974
-PyPyNum-1.16.0.dist-info/WHEEL,sha256=GJ7t_kWBFywbagK5eo9IoUwLW6oyOeTKmQ-9iHFVNxQ,92
-PyPyNum-1.16.0.dist-info/top_level.txt,sha256=4wW_Xb4bRglmiMsdPAe9f75MkXhNpuN88H17g_Cr5u8,8
-PyPyNum-1.16.0.dist-info/RECORD,,
+pypynum/vectors.py,sha256=ANvmI1ftLZPIxO871YLuXUzV6CtvHXrGBf5YIqN_qUE,3390
+pypynum/zh_cn.py,sha256=raTXV7sa9zob3ZtnT263kNFL7NDm-0ZhTrqZIcc88Tk,13812
+PyPyNum-1.16.2.dist-info/METADATA,sha256=K1E_AqE4v-FaRxqCJB8fd4Z_O9jFBlMoPony-pEt_Fc,101387
+PyPyNum-1.16.2.dist-info/WHEEL,sha256=GJ7t_kWBFywbagK5eo9IoUwLW6oyOeTKmQ-9iHFVNxQ,92
+PyPyNum-1.16.2.dist-info/top_level.txt,sha256=4wW_Xb4bRglmiMsdPAe9f75MkXhNpuN88H17g_Cr5u8,8
+PyPyNum-1.16.2.dist-info/RECORD,,

pypynum/README.md

@@ -20,7 +20,7 @@ processing.</font><font color = red>[Python>=3.4]</font>
 [![Downloads](https://static.pepy.tech/badge/pypynum/month)](https://pepy.tech/project/pypynum)
 [![Downloads](https://static.pepy.tech/badge/pypynum/week)](https://pepy.tech/project/pypynum)
 
-## Version -> 1.16.0 | PyPI -> https://pypi.org/project/PyPyNum/ | Gitee -> https://www.gitee.com/PythonSJL/PyPyNum | GitHub -> https://github.com/PythonSJL/PyPyNum
+## Version -> 1.16.2 | PyPI -> https://pypi.org/project/PyPyNum/ | Gitee -> https://www.gitee.com/PythonSJL/PyPyNum | GitHub -> https://github.com/PythonSJL/PyPyNum
 
 ![LOGO](PyPyNum.png)
 
@@ -33,6 +33,15 @@ The logo cannot be displayed on PyPI, it can be viewed in Gitee or GitHub.
 + Update versions periodically to add more practical features
 + If you need to contact, please add QQ number 2261748025 (Py𝙿𝚢𝚝𝚑𝚘𝚗-水晶兰), or through my email 2261748025@qq.com
 
+```
++++++++++++++++++++++++++++++++++++++++++
++ Tip:                                  +
++ Have suggestions or feature requests? +
++ Feel free to share them with us.      +
++ Your feedback is highly appreciated!  +
++++++++++++++++++++++++++++++++++++++++++
+```
+
 ### Name and Function Introduction of Submodules
 
 |   Submodule Name    |                       Function Introduction                        |
@@ -113,81 +122,69 @@ Python interpreter and run it!
 ```
 !=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
 
-The submodule 'consts' has added
-a large number of mathematical
-and scientific constants,
-currently totaling 128.
+<<< Here are the newly added functions >>>
 
-This module defines a collection
-of constants representing
-various physical, mathematical,
-and unit conversion factors.
 
-These constants are commonly
-used in scientific and
-engineering calculations.
+kmp_table(pattern: Union[list, tuple, str]) -> list
+    Introduction
+    ==========
+    Generate the KMP (Knuth-Morris-Pratt) table for a given pattern.
 
-If you want to know information
-about each constant, you can
-execute 'help(consts)' to
-obtain it.
+    The KMP table is used to efficiently find occurrences of a pattern within a sequence by avoiding unnecessary
+    comparisons after a mismatch. This table determines how many characters can be skipped after a mismatch.
 
-!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
+    Example
+    ========
+    >>> kmp_table("AGCTGATCGTACGTAAGCTAGCTA")
+    [0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 1, 1, 2, 3, 4, 1, 2, 3, 4, 1]
+    >>>
+    :param pattern: The pattern for which to generate the KMP table.
+    :return: A list representing the KMP table for the given pattern.
 
 
-<<< Here are the newly added functions >>>
+findall(seq: Union[list, tuple, str], pat: Union[list, tuple, str]) -> list
+    Introduction
+    ==========
+    Find all indices of the subsequence 'pat' in 'seq'.
 
+    This function is designed to handle sequences such as lists, tuples, or strings and find all indices
+    of specified subsequences. It allows overlapping matches.
 
-PyPyNum
-├── special
-│   └── FUNCTION
-│       ├── qbinomial(n: typing.Union[int, float, complex], m: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│       │   # Calculate the q-binomial coefficient of n and m with parameter q.
-│       ├── qfactorial(n: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│       │   # Compute the q-factorial of n with parameter q.
-│       ├── qgamma(n: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│       │   # Calculate the q-gamma function of n with parameter q.
-│       └── qpochhammer(a: typing.Union[int, float, complex], q: typing.Union[int, float, complex], n: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│           # Compute the q-Pochhammer symbol for given a, q, and n.
-├── multiprec
-│   └── FUNCTION
-│       ├── mp_catalan(sigfigs: int) -> decimal.Decimal
-│           # Calculate the Catalan's constant with a specified number of significant figures using multiprecision arithmetic.
-├── seqs
-│   └── FUNCTION
-│       ├── padovan(n: int, single: bool) -> typing.Union[int, list]
-│       │   # Generate the Padovan sequence up to the nth term.
-│       ├── pelllucas(n: int, single: bool) -> typing.Union[int, list]
-│       │   # Generate the Pell-Lucas sequence up to the nth term.
-│       ├── perrin(n: int, single: bool) -> typing.Union[int, list]
-│       │   # Generate the Perrin sequence up to the nth term.
-│       └── sylvester(n: int, single: bool) -> typing.Union[int, list]
-│           # Generate the Sylvester sequence up to the nth term.
-├── tools
-│   └── FUNCTION
-│       ├── lcsubseq(x: typing.Union[list, tuple, str], y: typing.Union[list, tuple, str]) -> list
-│       │   # Find the longest common subsequence between two sequences x and y.
-│       └── lcsubstr(x: typing.Union[list, tuple, str], y: typing.Union[list, tuple, str]) -> list
-│           # Find the longest common substring between two sequences x and y.
-├── matrices
-│   ├── CLASS
-│   │   └── Matrix(pypynum.arrays.Array)/__init__(self: Any, data: Any, check: Any) -> Any
-│   │       # Initialize a Matrix object from a given data array.
-│   └── FUNCTION
-│       ├── perm_mat(num_rows: int, num_cols: int, row_swaps: typing.Union[list, tuple], col_swaps: typing.Union[list, tuple], rtype: typing.Callable) -> typing.Any
-│       │   # Create a permutation matrix based on specified row and column swaps.
-│       └── perm_mat_indices(num_rows: int, num_cols: int, row_swaps: typing.Union[list, tuple], col_swaps: typing.Union[list, tuple]) -> tuple
-│           # Compute the indices for a permutation matrix based on specified row and column swaps.
+    Example
+    ========
+    >>> findall([2, 1, 2, 1, 2, 1, 2, 1], [1, 2, 1, 2])
+    [1, 3]
+    >>>
+    :param seq: The sequence in which to find the subsequence.
+    :param pat: The subsequence to be found.
+    :return: A list of starting indices where the subsequence is found.
 
 
-!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
+---------------------------------------------------------------------------------------
+| q-functions generalize classical math functions by introducing parameter q.         |
+| They are key in combinatorics and special functions, widely applied.                |
+| As q approaches 1, they revert to classical forms.                                  |
+| Examples include q-factorials, q-binomial coefficients, Jackson q-Bessel functions. |
+| These functions are crucial in fractals, chaotic systems, quantum groups.           |
+| They provide tools for solving complex mathematical challenges effectively.         |
+---------------------------------------------------------------------------------------
+
+
+Here are the 12 new q-functions added in the current version (adding the previous 4 makes a total of 16):
+
 
-Other functions and classes have
-also undergone certain
-modifications, such as adding a
-"reduce" parameter to the "qr"
-function to determine whether to
-crop the matrix.
+qbeta(a: Union[int, float, complex], b: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qcos_large(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qcos_small(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qcosh_large(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qcosh_small(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qexp_large(z: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qexp_small(z: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qpi(q: Union[int, float, complex]) -> Union[int, float, complex]
+qsin_large(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qsin_small(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qsinh_large(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
+qsinh_small(x: Union[int, float, complex], q: Union[int, float, complex]) -> Union[int, float, complex]
 
 !=!=!=!=!=!=!=!=!=!=!=!=!=!=!=!=
 ```
@@ -225,15 +222,16 @@ PyPyNum
 │       ├── asarray(data: Any) -> Any
 │       ├── aslist(data: Any) -> Any
 │       ├── boolarray(data: Any) -> Any
-│       ├── fill(shape: Any, sequence: Any, repeat: Any, pad: Any, rtype: Any) -> Any
-│       ├── full(shape: Any, fill_value: Any, rtype: Any) -> Any
-│       ├── full_like(a: Any, fill_value: Any, rtype: Any) -> Any
+│       ├── fill(shape: typing.Union[list, tuple], sequence: typing.Union[list, tuple], repeat: bool, pad: typing.Any, rtype: typing.Callable) -> typing.Any
+│       ├── full(shape: typing.Union[list, tuple], fill_value: typing.Any, rtype: typing.Callable) -> typing.Any
+│       ├── full_like(a: typing.Any, fill_value: typing.Any, rtype: typing.Callable) -> typing.Any
 │       ├── get_shape(data: Any) -> Any
 │       ├── is_valid_array(_array: Any, _shape: Any) -> Any
-│       ├── ones(shape: Any, rtype: Any) -> Any
-│       ├── ones_like(a: Any, rtype: Any) -> Any
-│       ├── zeros(shape: Any, rtype: Any) -> Any
-│       └── zeros_like(a: Any, rtype: Any) -> Any
+│       ├── ones(shape: typing.Union[list, tuple], rtype: typing.Callable) -> typing.Any
+│       ├── ones_like(a: typing.Any, rtype: typing.Callable) -> typing.Any
+│       ├── tensorproduct(tensors: pypynum.arrays.Array) -> pypynum.arrays.Array
+│       ├── zeros(shape: typing.Union[list, tuple], rtype: typing.Callable) -> typing.Any
+│       └── zeros_like(a: typing.Any, rtype: typing.Callable) -> typing.Any
 ├── chars
 │   ├── CLASS
 │   └── FUNCTION
@@ -287,7 +285,7 @@ PyPyNum
 │       ├── gamma_pdf(x: Any, shape: Any, scale: Any) -> Any
 │       ├── geometric_pmf(k: Any, p: Any) -> Any
 │       ├── hypergeom_pmf(k: Any, mg: Any, n: Any, nt: Any) -> Any
-│       ├── inv_gauss_pdf(x: Any, mu: Any, lambda_: Any, alpha: Any) -> Any
+│       ├── invgauss_pdf(x: Any, mu: Any, lambda_: Any, alpha: Any) -> Any
 │       ├── levy_pdf(x: Any, c: Any) -> Any
 │       ├── log_logistic_cdf(x: Any, alpha: Any, beta: Any) -> Any
 │       ├── log_logistic_pdf(x: Any, alpha: Any, beta: Any) -> Any
@@ -433,7 +431,7 @@ PyPyNum
 │       ├── cosh(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── cot(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── coth(x: typing.Union[int, float]) -> typing.Union[int, float]
-│       ├── cov(x: typing.Union[list, tuple], y: typing.Union[list, tuple], dof: int) -> typing.Union[int, float, complex]
+│       ├── cov(x: typing.Union[list, tuple], y: typing.Union[list, tuple], ddof: int) -> typing.Union[int, float, complex]
 │       ├── crt(n: typing.Union[list, tuple], a: typing.Union[list, tuple]) -> int
 │       ├── csc(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── csch(x: typing.Union[int, float]) -> typing.Union[int, float]
@@ -481,13 +479,13 @@ PyPyNum
 │       ├── sinh(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── skew(data: typing.Union[list, tuple]) -> float
 │       ├── square_mean(numbers: typing.Union[list, tuple]) -> typing.Union[int, float, complex]
-│       ├── std(numbers: typing.Union[list, tuple], dof: int) -> typing.Union[int, float, complex]
+│       ├── std(numbers: typing.Union[list, tuple], ddof: int) -> typing.Union[int, float, complex]
 │       ├── sumprod(arrays: typing.Union[list, tuple]) -> typing.Union[int, float, complex]
 │       ├── tan(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── tanh(x: typing.Union[int, float]) -> typing.Union[int, float]
 │       ├── totient(n: int) -> int
 │       ├── upper_gamma(s: typing.Union[int, float, complex], x: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│       ├── var(numbers: typing.Union[list, tuple], dof: int) -> typing.Union[int, float, complex]
+│       ├── var(numbers: typing.Union[list, tuple], ddof: int) -> typing.Union[int, float, complex]
 │       ├── xlogy(x: typing.Union[int, float, complex], y: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       └── zeta(alpha: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 ├── matrices
@@ -634,10 +632,22 @@ PyPyNum
 │       ├── hyp1f1(a0: typing.Union[int, float, complex], b0: typing.Union[int, float, complex], z: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       ├── hyp2f1(a0: typing.Union[int, float, complex], a1: typing.Union[int, float, complex], b0: typing.Union[int, float, complex], z: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       ├── hyppfq(a: typing.Union[list, tuple], b: typing.Union[list, tuple], z: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qbeta(a: typing.Union[int, float, complex], b: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       ├── qbinomial(n: typing.Union[int, float, complex], m: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qcos_large(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qcos_small(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qcosh_large(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qcosh_small(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qexp_large(z: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qexp_small(z: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       ├── qfactorial(n: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 │       ├── qgamma(n: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
-│       └── qpochhammer(a: typing.Union[int, float, complex], q: typing.Union[int, float, complex], n: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qpi(q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qpochhammer(a: typing.Union[int, float, complex], q: typing.Union[int, float, complex], n: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qsin_large(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qsin_small(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       ├── qsinh_large(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
+│       └── qsinh_small(x: typing.Union[int, float, complex], q: typing.Union[int, float, complex]) -> typing.Union[int, float, complex]
 ├── stattest
 │   ├── CLASS
 │   └── FUNCTION
@@ -656,8 +666,7 @@ PyPyNum
 │   │   └── Tensor(pypynum.arrays.Array)/__init__(self: Any, data: Any, check: Any) -> Any
 │   └── FUNCTION
 │       ├── ten(data: list) -> pypynum.tensors.Tensor
-│       ├── tensor_and_number(tensor: Any, operator: Any, number: Any) -> Any
-│       └── tensorproduct(tensors: pypynum.tensors.Tensor) -> pypynum.tensors.Tensor
+│       └── tensor_and_number(tensor: Any, operator: Any, number: Any) -> Any
 ├── test
 │   ├── CLASS
 │   └── FUNCTION
@@ -668,10 +677,13 @@ PyPyNum
 │   ├── CLASS
 │   └── FUNCTION
 │       ├── classify(array: typing.Union[list, tuple]) -> dict
+│       ├── cos_sim(seq1: typing.Union[list, tuple, str], seq2: typing.Union[list, tuple, str], is_vector: bool) -> float
 │       ├── dedup(iterable: typing.Union[list, tuple, str]) -> typing.Union[list, tuple, str]
 │       ├── fast_pow(a: typing.Any, n: int, init: typing.Any, mul: typing.Callable) -> typing.Any
+│       ├── findall(seq: typing.Union[list, tuple, str], pat: typing.Union[list, tuple, str]) -> list
 │       ├── frange(start: typing.Union[int, float], stop: typing.Union[int, float], step: float) -> list
 │       ├── geomspace(start: typing.Union[int, float], stop: typing.Union[int, float], number: int) -> list
+│       ├── kmp_table(pattern: typing.Union[list, tuple, str]) -> list
 │       ├── lcsubseq(x: typing.Union[list, tuple, str], y: typing.Union[list, tuple, str]) -> list
 │       ├── lcsubstr(x: typing.Union[list, tuple, str], y: typing.Union[list, tuple, str]) -> list
 │       ├── levenshtein(x: typing.Union[list, tuple, str], y: typing.Union[list, tuple, str]) -> int
@@ -680,6 +692,7 @@ PyPyNum
 │       ├── primality(n: int, iter_num: int) -> bool
 │       ├── prime_factors(integer: int, dictionary: bool, pollard_rho: bool) -> typing.Union[list, dict]
 │       ├── primes(limit: int) -> list
+│       ├── replace(seq: typing.Union[list, tuple], old: typing.Union[list, tuple], new: typing.Union[list, tuple], count: int) -> typing.Union[list, tuple]
 │       ├── semiprimes(limit: int) -> list
 │       ├── split(iterable: typing.Union[list, tuple, str], key: typing.Union[list, tuple], retain: bool) -> list
 │       └── twinprimes(limit: int) -> list

pypynum/__init__.py

@@ -68,7 +68,7 @@ from .ufuncs import *
 from .utils import *
 from .vectors import *
 
-__version__ = "1.16.0"
+__version__ = "1.16.2"
 print("PyPyNum", "Version -> " + __version__, "PyPI -> https://pypi.org/project/PyPyNum/",
       "Gitee -> https://www.gitee.com/PythonSJL/PyPyNum", "GitHub -> https://github.com/PythonSJL/PyPyNum", sep=" | ")
 for _ in list(globals().keys()):