npm - offcode - Versions diffs - 0.0.0-stage → 0.1.0 - Mend

offcode 0.0.0-stage → 0.1.0

This diff represents the content of publicly available package versions that have been released to one of the supported registries. The information contained in this diff is provided for informational purposes only and reflects changes between package versions as they appear in their respective public registries.

Files changed (1038) hide show

package/data/problems/reordered-power-of-2.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "863", "slug": "reordered-power-of-2", "id": 863, "title": "Reordered Power of 2", "difficulty": "Medium", "category": "math", "link": "https://leetcode.com/problems/reordered-power-of-2/", "examples": [{"input": "n = 1", "output": "true", "explanation": "1 is a power of two."}, {"input": "n = 10", "output": "false", "explanation": "No rearrangement is a power of two."}, {"input": "n = 16", "output": "true", "explanation": "16 itself is a power of two."}], "hints": ["Compare sorted digit strings: `n` works exactly when its digit signature matches that of some power of two with the same length.", "Precompute the signatures of all powers of two up to 2^30 once, then each query is a lookup.", "Counting digits avoids enumerating permutations, which would be far too slow."], "statement": "You are given a positive integer `n`. You may reorder its decimal digits arbitrarily, but the rearranged number must not have a leading zero.\n\nDetermine whether some rearrangement equals a power of two (1, 2, 4, 8, 16, 32, and so on). Return `true` when possible and `false` otherwise.\n\nOnly the multiset of digits matters: two numbers with the same digit counts are rearrangements of each other.\n\n**Constraints:**\n- `1 <= n <= 10^9`\n", "solution": "## Approach\n\nTwo numbers are digit-rearrangements of each other exactly when their sorted digit strings match. Powers of two up to the limit are few (2^0 through 2^30), so precompute their signatures once and check whether the signature of `n` appears among those of the same length.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(d log d) per query, where d is the digit count, for sorting digits.\n- **Space Complexity:** O(d) for the signature strings.\n\n## Implementation\n\n```python\nclass Solution:\n def reorderedPowerOf2(self, n: int) -> bool:\n sig = sorted(str(n))\n p = 1\n while p <= 10 ** 9:\n if sorted(str(p)) == sig:\n return True\n p <<= 1\n return False\n```\n", "starter": {"go": "package main\n\nfunc ReorderedPowerOf2(n int) bool {\n return false\n}", "python": "class Solution:\n def reorderedPowerOf2(self, n: int) -> bool:\n pass", "cpp": "class Solution {\npublic:\n bool reorderedPowerOf2(int n) {\n return false;\n }\n};"}, "fn": "reorderedPowerOf2", "params": [{"name": "n", "type": "int"}], "outputType": "boolean", "tests": [["1"], ["10"], ["16"], ["24"], ["46"], ["821"], ["128"], ["256"], ["512"], ["1024"], ["2"], ["3"], ["4"], ["8"], ["7"], ["12"], ["13"], ["21"], ["61"], ["23"], ["32"], ["64"], ["112"], ["1042"], ["4182"], ["1000000000"], ["999999999"], ["536870912"]], "expected": [true, false, true, false, true, true, true, true, true, true, true, false, true, true, false, false, false, false, true, true, true, true, false, true, false, false, false, true], "loose": false}

package/data/problems/reorganize-string.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "203", "slug": "reorganize-string", "id": 203, "title": "Reorganize String", "difficulty": "Medium", "category": "heap", "link": "https://leetcode.com/problems/reorganize-string/", "examples": [{"input": "s = \"aab\"", "output": "\"aba\"", "explanation": "The only possible rearrangement is \"aba\"."}, {"input": "s = \"aaab\"", "output": "\"\"", "explanation": "No valid rearrangement exists because three a's would always touch."}], "hints": ["Count the frequency of each character.", "Use a max-heap keyed by frequency to always append the most frequent remaining character that was not just placed.", "If a character appears more than (s.length + 1) / 2 times, a rearrangement is impossible."], "statement": "Take a string `s` and shuffle its characters into a new order in which no two neighbours match.\n\nProduce any such shuffle, or produce `\"\"` when no valid shuffle exists.\n\n**Constraints:**\n\n- `1 <= s.length <= 500`\n- `s` consists of lowercase English letters.\n", "solution": "## Approach\n\nCount the 26 character frequencies and push every present character into a max-heap keyed by frequency. Repeatedly pop the most frequent remaining character, append it, and only then put the previously appended character back into the heap. Holding the previous character back for one step guarantees no two equal adjacent characters. If a leftover character cannot be placed after the heap empties, no valid rearrangement exists and we return `\"\"`.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n log 26) = O(n), where `n` is `s.length`.\n- **Space Complexity:** O(1), because the heap and count table hold at most 26 entries.\n\n## Implementation\n\n```python\nfrom heapq import heappop, heappush, heapify\n\nclass Solution:\n def reorganizeString(self, s: str) -> str:\n count = [0] * 26\n for ch in s:\n count[ord(ch) - ord(\"a\")] += 1\n heap = [(-freq, chr(ord(\"a\") + i)) for i, freq in enumerate(count) if freq > 0]\n heapify(heap)\n\n result = []\n prev_char, prev_freq = \"#\", 0\n while heap:\n neg_freq, ch = heappop(heap)\n result.append(ch)\n if prev_freq > 0:\n heappush(heap, (-prev_freq, prev_char))\n prev_char = ch\n prev_freq = -neg_freq - 1\n if prev_freq > 0:\n return \"\"\n return \"\".join(result)\n```", "starter": {"go": "package main\n\nfunc ReorganizeString(s string) string {\n \n}", "python": "class Solution:\n def reorganizeString(self, s: str) -> str:\n ", "cpp": "#include <string>\n#include <queue>\nusing namespace std;\n\nclass Solution {\npublic:\n string reorganizeString(string s) {\n \n }\n};"}, "fn": "reorganizeString", "params": [{"name": "s", "type": "string"}], "outputType": "string", "tests": [["aab"], ["aaab"], ["aaabc"], ["aabb"], ["z"], ["vvvlo"], ["aaaaa"], ["aabbcc"], ["abcdef"], ["baaab"], ["aaabbb"], ["ababab"], ["abcabcabc"], ["aaabb"], ["aaaabbbb"], ["a"], ["krmyfshbspcgteswneowmevfecxbzxcxhqcfwkyymswens"], ["abbabbaaab"], ["eqmeyggvp"], ["aaaa"], ["ab"], ["aa"], ["abcdeabcde"], ["zzzyyyxxx"], ["aaaaabbbb"], ["aaaaabbb"], ["qwertyuiopasdfghjklzxcvbnm"], ["cccdde"], ["aabbccddee"], ["mmmmnnnnoooopppp"]], "expected": ["aba", "", "abaca", "abab", "z", "vlvov", "", "abcabc", "abcdef", "ababa", "ababab", "ababab", "abcabcabc", "ababa", "abababab", "a", "esceswcefmswxybcefhkmnswxybcefghkmnopqrstvwxyz", "ababababab", "egegmpqvy", "", "ab", "", "abcdeabcde", "xyzxyzxyz", "ababababa", "", "abcdefghijklmnopqrstuvwxyz", "cdcdce", "abcdeabcde", "mnopmnopmnopmnop"], "loose": false}

package/data/problems/repeated-dna-sequences.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "327", "slug": "repeated-dna-sequences", "id": 327, "title": "Repeated DNA Sequences", "difficulty": "Medium", "category": "string", "link": "https://leetcode.com/problems/repeated-dna-sequences/", "examples": [{"explanation": "The block \"AAAAACCCCC\" starts at index 0 and again at index 10; \"CCCCCAAAAA\" starts at index 5 and again at index 16.", "input": "s = \"AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT\"", "output": "[\"AAAAACCCCC\",\"CCCCCAAAAA\"]"}, {"explanation": "The only length-10 block is ten A's, repeating at every position.", "input": "s = \"AAAAAAAAAAAAA\"", "output": "[\"AAAAAAAAAA\"]"}, {"explanation": "The string is shorter than 10 characters, so nothing qualifies.", "input": "s = \"ACGT\"", "output": "[]"}], "hints": ["Slide a window of width 10 across the string and count how many times each block appears with a hash map.", "Append a block to the answer the moment its count reaches 2, so each repeat is reported exactly once.", "Only the relative order is irrelevant; comparing answers as sets (or sorted lists) is the robust check."], "statement": "A DNA strand can be seen as a long string built only from the four letters `A`, `C`, `G` and `T`. Biologists care about short fragments that appear in more than one place, because repeats can point to something meaningful.\n\nYou are given such a string `s`. Gather every distinct substring of length exactly 10 that occurs two or more times in `s`. Each repeated fragment is listed once; the order of the answer does not matter.\n\n**Constraints:**\n- `0 <= s.length <= 10^5`\n- `s` consists of the characters `'A'`, `'C'`, `'G'` and `'T'`.\n", "solution": "## Approach\n\nSlide a window of width 10 over the string and count each block with a hash set. Keep a `seen` set for blocks observed once and a `repeated` set for blocks observed at least twice. Adding to `repeated` on the second sighting guarantees every qualifying fragment is reported exactly once.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n), where n is the length of `s`. Each window is hashed once.\n- **Space Complexity:** O(n) for the stored substrings in the worst case.\n\n## Implementation\n\n```python\nfrom typing import List\n\nclass Solution:\n def findRepeatedDnaSequences(self, s: str) -> List[str]:\n seen = set()\n repeated = set()\n for i in range(len(s) - 9):\n sub = s[i:i + 10]\n if sub in seen:\n repeated.add(sub)\n else:\n seen.add(sub)\n return sorted(repeated)\n```\n", "starter": {"go": "package main\n\nfunc FindRepeatedDnaSequences(s string) []string {\n return []string{}\n}", "python": "from typing import List\n\nclass Solution:\n def findRepeatedDnaSequences(self, s: str) -> List[str]:\n return []\n", "cpp": "#include <string>\n#include <vector>\nusing namespace std;\n\nclass Solution {\npublic:\n vector<string> findRepeatedDnaSequences(string s) {\n return {};\n }\n};"}, "fn": "findRepeatedDnaSequences", "params": [{"name": "s", "type": "string"}], "outputType": "string_list", "tests": [["AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"], ["AAAAAAAAAAAAA"], ["ACGT"], [""], ["A"], ["AAAAAAAAAA"], ["AAAAAAAAAAA"], ["ACGTACGTAC"], ["ACGTACGTACGT"], ["AAAAACCCCCAAAAACCCCC"], ["GGGGGGGGGGGG"], ["TTTTTTTTTTTTTTTTTTTT"], ["ACGTACGTACGTACGTACGT"], ["AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA"], ["ACACACACACACACACACAC"], ["AGCTAGCTAGCTAGCTAGCTAGCT"], ["CCCCCCCCCCAAAAAAAAAA"], ["ATGCATGCATGCATGCATGCATGCATGC"], ["GATTACAGATTACAGATTACA"], ["CGTACGTACGTACGTACGTACGTA"], ["TGCATGCATGTGCATGCATGTGCATGCA"], ["AAAACCCCGGGGTTTTAAAACCCCGGGG"], ["ACGTACGTACGTACGTACGTACGTACGTAC"], ["GGGGGAAAAACCCCCAAAAACCCCCAAAAA"], ["TTTTACGTACGTACGTACGTACGTACGTTTT"], ["CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGC"], ["ATATATATATATATATATATATATATATATA"], ["GCGCGCGCGCATATATATATGCGCGCGCGCA"]], "expected": [["AAAAACCCCC", "CCCCCAAAAA"], ["AAAAAAAAAA"], [], [], [], [], ["AAAAAAAAAA"], [], [], ["AAAAACCCCC"], ["GGGGGGGGGG"], ["TTTTTTTTTT"], ["ACGTACGTAC", "CGTACGTACG", "GTACGTACGT", "TACGTACGTA"], ["AAAAAAAAAA"], ["ACACACACAC", "CACACACACA"], ["AGCTAGCTAG", "GCTAGCTAGC", "CTAGCTAGCT", "TAGCTAGCTA"], [], ["ATGCATGCAT", "TGCATGCATG", "GCATGCATGC", "CATGCATGCA"], ["GATTACAGAT", "ATTACAGATT", "TTACAGATTA", "TACAGATTAC", "ACAGATTACA"], ["CGTACGTACG", "GTACGTACGT", "TACGTACGTA", "ACGTACGTAC"], ["TGCATGCATG", "GCATGCATGT", "CATGCATGTG", "ATGCATGTGC", "TGCATGTGCA", "GCATGTGCAT", "CATGTGCATG", "ATGTGCATGC", "TGTGCATGCA"], ["AAAACCCCGG", "AAACCCCGGG", "AACCCCGGGG"], ["ACGTACGTAC", "CGTACGTACG", "GTACGTACGT", "TACGTACGTA"], ["AAAAACCCCC", "AAAACCCCCA", "AAACCCCCAA", "AACCCCCAAA", "ACCCCCAAAA", "CCCCCAAAAA"], ["TACGTACGTA", "ACGTACGTAC", "CGTACGTACG", "GTACGTACGT"], ["CGCGCGCGCG", "GCGCGCGCGC"], ["ATATATATAT", "TATATATATA"], ["GCGCGCGCGC", "CGCGCGCGCA"]], "loose": true}

package/data/problems/repeated-string-match.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "701", "slug": "repeated-string-match", "id": 701, "title": "Repeated String Match", "difficulty": "Medium", "category": "string", "link": "https://leetcode.com/problems/repeated-string-match/", "examples": [{"input": "a = \"abcd\", b = \"cdabcdab\"", "output": "3", "explanation": "Repeating abcd three times gives abcdabcdabcd, which contains cdabcdab."}, {"input": "a = \"a\", b = \"aa\"", "output": "2", "explanation": "Two copies are needed to cover aa."}, {"input": "a = \"abc\", b = \"wxyz\"", "output": "-1", "explanation": "No amount of repetition introduces w."}], "hints": ["Repeat a until the built string is at least as long as b.", "Check containment; if it fails, one extra copy is the only longer case worth testing.", "Return -1 when even that extended string lacks b."], "statement": "You are given two strings `a` and `b`. Imagine concatenating copies of `a` (`a`, `a+a`, `a+a+a`, and so on).\n\nReturn the smallest number of copies whose concatenation contains `b` as a contiguous block, or `-1` when no repetition contains `b`.\n\n**Constraints:**\n- `1 <= a.length, b.length <= 10^4`\n- Both strings use lowercase English letters.\n", "solution": "## Approach\n\nGrow a buffer by appending `a` until it is at least as long as `b`. If `b` already occurs, return the repeat count. Otherwise append one more copy \u2014 any longer repetition would only repeat the same alignments \u2014 and test again; failure means `-1`.\n\n## Complexity Analysis\n\n- **Time Complexity:** O((|b|/|a| + 2) * (|a| + |b|)) for building and searching.\n- **Space Complexity:** O(|b| + |a|) for the buffer.\n\n## Implementation\n\n```python\nclass Solution:\n def repeatedStringMatch(self, a: str, b: str) -> int:\n buf = \"\"\n count = 0\n while len(buf) < len(b):\n buf += a\n count += 1\n if b in buf:\n return count\n buf += a\n count += 1\n if b in buf:\n return count\n return -1\n```\n", "starter": {"go": "package main\n\nfunc RepeatedStringMatch(a string, b string) int {\n return 0\n}", "python": "class Solution:\n def repeatedStringMatch(self, a: str, b: str) -> int:\n pass", "cpp": "#include <string>\nusing namespace std;\nclass Solution {\npublic:\n int repeatedStringMatch(string a, string b) {\n return 0;\n }\n};"}, "fn": "repeatedStringMatch", "params": [{"name": "a", "type": "string"}, {"name": "b", "type": "string"}], "outputType": "int", "tests": [["abcd", "cdabcdab"], ["a", "aa"], ["abc", "wxyz"], ["a", "a"], ["a", "b"], ["abcd", "abcd"], ["abcd", "d"], ["abc", "cabcabca"], ["abc", "abcabc"], ["abc", "bcabca"], ["aa", "aaa"], ["ab", "bababa"], ["abcde", "cdeab"], ["xyz", "xyzxyzxyz"], ["ab", "a"], ["ab", "b"], ["abcd", "abcdabcd"], ["a", "aaaaaaaaaaaaaaaaaaaa"], ["ababa", "abaab"], ["hello", "llohe"], ["abc", "defabc"], ["abc", "abcdef"], ["abcd", "cdab"], ["abcab", "cabca"], ["ab", "ababababa"], ["xyz", "zxy"], ["aaab", "aabaaab"], ["abc", "abcabcabcabc"]], "expected": [3, 2, -1, 1, -1, 1, 1, 4, 2, 3, 2, 4, 2, 3, 1, 1, 2, 20, 2, 2, -1, -1, 2, -1, 5, 2, 2, 4], "loose": false}

package/data/problems/repeated-substring-pattern.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "526", "slug": "repeated-substring-pattern", "id": 526, "title": "Repeated Substring Pattern", "difficulty": "Easy", "category": "string", "link": "https://leetcode.com/problems/repeated-substring-pattern/", "examples": [{"input": "s = \"abab\"", "output": "true", "explanation": "The block \"ab\" appears twice in a row."}, {"input": "s = \"aba\"", "output": "false", "explanation": "No block repeated whole times rebuilds the string."}, {"input": "s = \"abcabcabcabc\"", "output": "true", "explanation": "The block \"abc\" appears four times in a row."}], "hints": ["A repeating block must have a length that divides the whole string length.", "Try every divisor length of `n` up to `n / 2` and check whether copies of the prefix rebuild the string."], "statement": "You are given a non-empty string `s`. Return `true` if `s` can be built by writing some shorter block two or more times in a row, and `false` otherwise.\n\n**Constraints:**\n- `1 <= s.length <= 10^4`\n- `s` consists of lowercase English letters.\n", "solution": "## Approach\n\nA repeating block must tile the string exactly, so its length has to divide the total length. Try every candidate length from 1 up to half of the string that divides the length, and test whether repeating the prefix of that length reproduces the whole string. Succeed on the first match; if no divisor works, no repeating block exists.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n^2) in the worst case, from comparing up to O(n) candidates of total length O(n).\n- **Space Complexity:** O(n) for the prefix slices.\n\n## Implementation\n\n```python\nclass Solution:\n def repeatedSubstringPattern(self, s: str) -> bool:\n n = len(s)\n for k in range(1, n // 2 + 1):\n if n % k == 0 and s[:k] * (n // k) == s:\n return True\n return False\n```\n", "starter": {"go": "package main\n\nfunc RepeatedSubstringPattern(s string) bool {\n \n}", "python": "class Solution:\n def repeatedSubstringPattern(self, s: str) -> bool:\n pass", "cpp": "#include <string>\nusing namespace std;\n\nclass Solution {\npublic:\n bool repeatedSubstringPattern(string s) {\n return false;\n }\n};"}, "fn": "repeatedSubstringPattern", "params": [{"name": "s", "type": "string"}], "outputType": "boolean", "tests": [["abab"], ["aba"], ["abcabcabcabc"], ["a"], ["aa"], ["aaa"], ["abcd"], ["ababab"], ["abcab"], ["zzzzzz"], ["abcdabcd"], ["abcabcab"], ["abababa"], ["aabcaabcaabc"], ["aabaaba"], ["@javascript:\"ab\".repeat(5000)"], ["abcabc"], ["abababab"], ["aaaa"], ["abac"], ["xyzxyzxyz"], ["abcabcd"], ["aaaaabaaaaab"], ["aabbccaabbcc"], ["abcdabc"], ["qwerqwer"], ["ababa"], ["zzzzzzzz"], ["abcdeabcdeabcde"], ["abccabccabcc"]], "expected": [true, false, true, false, true, true, false, true, false, true, true, false, false, true, false, true, true, true, true, false, true, false, true, true, false, true, false, true, true, true], "loose": false}

package/data/problems/replace-words.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "669", "slug": "replace-words", "id": 669, "title": "Replace Words", "difficulty": "Medium", "category": "trie", "link": "https://leetcode.com/problems/replace-words/", "examples": [{"input": "dictionary = [\"cat\",\"bat\",\"rat\"], sentence = \"the cattle was rattled by the battery\"", "output": "\"the cat was rat by the bat\"", "explanation": "\"cattle\" shortens to \"cat\", \"rattled\" to \"rat\", and \"battery\" to \"bat\"."}, {"input": "dictionary = [\"a\",\"b\",\"c\"], sentence = \"aadsfasf absbs bbab cadsfafs\"", "output": "\"a a b c\"", "explanation": "Every word starts with one of the single-letter roots."}, {"input": "dictionary = [\"abc\"], sentence = \"def ghi\"", "output": "\"def ghi\"", "explanation": "No word starts with \"abc\", so nothing changes."}], "hints": ["Index every root in a prefix tree (trie) that marks word ends.", "For each sentence word, walk the trie and stop at the first end marker: that is the shortest matching root.", "If the walk dies before any marker, keep the original word."], "statement": "You get a list `dictionary` of root words and a sentence of space-separated words. For each word in the sentence, look for the shortest root that is a prefix of it; when one exists, swap the whole word for that root. Words with no matching root stay unchanged.\n\nImplement `replaceWords(dictionary, sentence)` returning the rebuilt sentence with single spaces.\n\n**Constraints:**\n- `1 <= dictionary.length <= 1000`\n- `1 <= dictionary[i].length <= 100`\n- `1 <= sentence.length <= 10^6`; words hold lowercase letters, joined by single spaces.\n", "solution": "## Approach\n\nInsert all roots into a trie where each node flags the end of a root. For every sentence word, descend the trie letter by letter; the first end flag met gives the shortest covering root, which replaces the word. If the path breaks or no flag appears, the word is kept as is.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(D + S), where D is the total root length and S the sentence length.\n- **Space Complexity:** O(D) for the trie nodes.\n\n## Implementation\n\n```python\nfrom typing import List\n\nclass Solution:\n def replaceWords(self, dictionary: List[str], sentence: str) -> str:\n roots = set(dictionary)\n out = []\n for w in sentence.split(\" \"):\n hit = None\n for i in range(1, len(w) + 1):\n if w[:i] in roots:\n hit = w[:i]\n break\n out.append(hit if hit is not None else w)\n return \" \".join(out)\n```\n", "starter": {"go": "package main\n\nfunc ReplaceWords(dictionary []string, sentence string) string {\n return \"\"\n}", "python": "from typing import List\nclass Solution:\n def replaceWords(self, dictionary: List[str], sentence: str) -> str:\n pass", "cpp": "#include <vector>\n#include <string>\nusing namespace std;\n\nclass Solution {\npublic:\n string replaceWords(vector<string>& dictionary, string sentence) {\n return \"\";\n }\n};"}, "fn": "replaceWords", "params": [{"name": "dictionary", "type": "string_array"}, {"name": "sentence", "type": "string"}], "outputType": "string", "tests": [["[\"cat\", \"bat\", \"rat\"]", "the cattle was rattled by the battery"], ["[\"a\", \"b\", \"c\"]", "aadsfasf absbs bbab cadsfafs"], ["[\"abc\"]", "def ghi"], ["[\"car\", \"card\", \"carp\"]", "cardiff carpenter car"], ["[\"a\", \"aa\", \"aaa\"]", "aaaa aaa aa a"], ["[\"catt\", \"cat\", \"bat\"]", "cattle cat bat battalion"], ["[\"e\"]", "e e e"], ["[\"abc\", \"abd\"]", "abe abf abc abd"], ["[\"hello\", \"world\"]", "hello world"], ["[\"a\"]", "a b c d e f g"], ["[\"pre\", \"pro\"]", "prefix problem proof pram"], ["[\"ran\", \"rann\"]", "ranner ran running"], ["[\"x\", \"xy\", \"xyz\"]", "xyza xyzab xabc"], ["[\"the\", \"quick\"]", "the quick brown fox"], ["[\"f\"]", "foobar foo f"], ["[\"ab\", \"bc\", \"cd\"]", "abcd bcde cdef"], ["[\"a\", \"ab\", \"abc\"]", "abcd abcde abcdef"], ["[\"test\"]", "testing tester tested test"], ["[\"z\"]", "apple banana cherry"], ["[\"an\", \"ant\", \"anti\"]", "anthem antique another ant"], ["[\"d\"]", "d dd ddd dddd"], ["[\"sea\", \"seashell\"]", "seashore seashells sea"], ["[\"m\", \"mi\", \"mic\"]", "micro middle mill"], ["[\"w\"]", "w wx wxy wxyz"], ["[\"cat\", \"cater\", \"caterpillar\"]", "caterpillars catered cats"], ["[\"b\"]", "a bb bbb bbbb"], ["[\"longroot\"]", "longroot longrooted short"], ["[\"a\", \"b\", \"c\", \"d\", \"e\"]", "abcde bcdef cdefg"]], "expected": ["the cat was rat by the bat", "a a b c", "def ghi", "car car car", "a a a a", "cat cat bat bat", "e e e", "abe abf abc abd", "hello world", "a b c d e f g", "pre pro pro pram", "ran ran running", "x x x", "the quick brown fox", "f f f", "ab bc cd", "a a a", "test test test test", "apple banana cherry", "an an an an", "d d d d", "sea sea sea", "m m m", "w w w w", "cat cat cat", "a b b b", "longroot longroot short", "a b c"], "loose": false}

package/data/problems/reshape-the-matrix.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "621", "slug": "reshape-the-matrix", "id": 621, "title": "Reshape the Matrix", "difficulty": "Easy", "category": "matrix", "link": "https://leetcode.com/problems/reshape-the-matrix/", "examples": [{"input": "mat = [[1,2],[3,4]], r = 1, c = 4", "output": "[[1,2,3,4]]", "explanation": "Four values flow into one row in order."}, {"input": "mat = [[1,2],[3,4]], r = 2, c = 4", "output": "[[1,2],[3,4]]", "explanation": "Cell counts differ, so the input returns unchanged."}, {"input": "mat = [[1,2,3],[4,5,6]], r = 3, c = 2", "output": "[[1,2],[3,4],[5,6]]", "explanation": "Six values fill three rows of two."}], "hints": ["First compare r * c against m * n; on mismatch return the input unchanged.", "Map flat position k to old cell (k / n, k % n) and new cell (k / c, k % c).", "One linear pass over all cells fills the new matrix in row-major order."], "statement": "Given an `m x n` matrix `mat` and target dimensions `r` rows and `c` columns, return the reshaped matrix whose entries follow the original row-major order. If the total cell count differs (`r * c != m * n`), reshaping is impossible and the original matrix must be returned unchanged.\n\nTo rebuild, read the input left to right, top to bottom into a flat stream, then deal that stream into `r` rows of `c` entries each.\n\n**Constraints:**\n- `1 <= m, n <= 100`\n- `1 <= r, c <= 300`\n- `-1000 <= mat[i][j] <= 1000`\n", "solution": "## Approach\n\nCheck whether the reshape is feasible by comparing cell counts; a mismatch returns the original matrix. Otherwise walk a single flat index over all cells, translating it into source coordinates `(k / n, k % n)` and destination coordinates `(k / c, k % c)`, copying each value into its new home.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(m * n), one visit per cell.\n- **Space Complexity:** O(r * c) for the reshaped output.\n\n## Implementation\n\n```python\nfrom typing import List\n\nclass Solution:\n def matrixReshape(self, mat: List[List[int]], r: int, c: int) -> List[List[int]]:\n m, n = len(mat), len(mat[0])\n if r * c != m * n:\n return mat\n ans = [[0] * c for _ in range(r)]\n for k in range(m * n):\n ans[k // c][k % c] = mat[k // n][k % n]\n return ans\n```\n", "starter": {"go": "package main\n\nfunc MatrixReshape(mat [][]int, r int, c int) [][]int {\n return nil\n}", "python": "from typing import List\nclass Solution:\n def matrixReshape(self, mat: List[List[int]], r: int, c: int) -> List[List[int]]:\n return []\n", "cpp": "#include <vector>\nusing namespace std;\nclass Solution {\npublic:\n vector<vector<int>> matrixReshape(vector<vector<int>>& mat, int r, int c) {\n return {};\n }\n};"}, "fn": "matrixReshape", "params": [{"name": "mat", "type": "int_array_2d"}, {"name": "r", "type": "int"}, {"name": "c", "type": "int"}], "outputType": "int_array_2d", "tests": [["[[1,2],[3,4]]", "1", "4"], ["[[1,2],[3,4]]", "2", "4"], ["[[1,2,3],[4,5,6]]", "3", "2"], ["[[1,2,3],[4,5,6]]", "1", "6"], ["[[1,2,3],[4,5,6]]", "6", "1"], ["[[1,2,3],[4,5,6]]", "2", "3"], ["[[1]]", "1", "1"], ["[[1,2]]", "2", "1"], ["[[1],[2]]", "1", "2"], ["[[1,2],[3,4]]", "4", "1"], ["[[1,2],[3,4]]", "2", "2"], ["[[0,0,0],[0,0,0]]", "3", "2"], ["[[1,2,3,4]]", "2", "2"], ["[[1],[2],[3],[4]]", "2", "2"], ["[[5]]", "1", "5"], ["[[-1,-2],[3,4]]", "1", "4"], ["[[1,2,3],[4,5,6],[7,8,9]]", "1", "9"], ["[[1,2,3],[4,5,6],[7,8,9]]", "9", "1"], ["[[1,2,3],[4,5,6],[7,8,9]]", "3", "3"], ["[[1,2],[3,4],[5,6]]", "2", "3"], ["[[1,2],[3,4],[5,6]]", "6", "1"], ["[[1,2,3,4],[5,6,7,8]]", "4", "2"], ["[[1,2,3,4],[5,6,7,8]]", "8", "1"], ["[[1,2],[3,4]]", "1", "2"], ["[[1,2],[3,4]]", "3", "3"], ["[[7,8],[9,10],[11,12]]", "2", "3"], ["[[0]]", "1", "1"], ["[[1,2,3]]", "3", "1"]], "expected": [[[1, 2, 3, 4]], [[1, 2], [3, 4]], [[1, 2], [3, 4], [5, 6]], [[1, 2, 3, 4, 5, 6]], [[1], [2], [3], [4], [5], [6]], [[1, 2, 3], [4, 5, 6]], [[1]], [[1], [2]], [[1, 2]], [[1], [2], [3], [4]], [[1, 2], [3, 4]], [[0, 0], [0, 0], [0, 0]], [[1, 2], [3, 4]], [[1, 2], [3, 4]], [[5]], [[-1, -2, 3, 4]], [[1, 2, 3, 4, 5, 6, 7, 8, 9]], [[1], [2], [3], [4], [5], [6], [7], [8], [9]], [[1, 2, 3], [4, 5, 6], [7, 8, 9]], [[1, 2, 3], [4, 5, 6]], [[1], [2], [3], [4], [5], [6]], [[1, 2], [3, 4], [5, 6], [7, 8]], [[1], [2], [3], [4], [5], [6], [7], [8]], [[1, 2], [3, 4]], [[1, 2], [3, 4]], [[7, 8, 9], [10, 11, 12]], [[0]], [[1], [2], [3]]], "loose": false}

package/data/problems/restore-ip-addresses.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "279", "slug": "restore-ip-addresses", "id": 279, "title": "Restore IP Addresses", "difficulty": "Medium", "category": "string", "link": "https://leetcode.com/problems/restore-ip-addresses/", "examples": [{"input": "s = \"25525511135\"", "output": "[\"255.255.11.135\",\"255.255.111.35\"]", "explanation": "Both splits use all digits with each octet in range and no bad leading zeros."}, {"input": "s = \"0000\"", "output": "[\"0.0.0.0\"]", "explanation": "Each single zero is a valid octet."}, {"input": "s = \"101023\"", "output": "[\"1.0.10.23\",\"1.0.102.3\",\"10.1.0.23\",\"10.10.2.3\",\"101.0.2.3\"]", "explanation": "Five ways to cut the six digits into valid octets."}], "hints": ["Backtrack over at most 4 parts, trying lengths 1-3 at each step and pruning when the remainder cannot fill the remaining parts.", "Reject a part with a leading zero unless it is exactly \"0\", and reject values above 255.", "Only record an address when 4 parts are placed and every character is consumed."], "statement": "Given a string containing only digits, insert three dots to split it into four decimal parts that together form a valid IPv4 address. Each part must be between `0` and `255` inclusive, must use only its own digits, and must not carry a leading zero unless the part is exactly `\"0\"`.\n\nReturn every distinct address that uses all the input characters exactly once. The order of the results does not matter.\n\n**Constraints:**\n- `1 <= s.length <= 20`\n- `s` consists of digits only.\n\n> **Adaptation note:** the original LeetCode return type is `List<String>`; this problem uses the portable `string_list` output type with identical contents.\n", "solution": "## Approach\n\nDepth-first search over octet boundaries, trying one to three digits per part. Cut off branches whose remaining length cannot fill the remaining octets, reject leading-zero and over-255 pieces immediately, and emit an address only when four parts consume the whole string.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(1) in practice \u2014 at most 3^4 placements per input.\n- **Space Complexity:** O(1) besides the output, recursion depth at most 4.\n\n## Implementation\n\n```python\nfrom typing import List\nclass Solution:\n def restoreIpAddresses(self, s: str) -> List[str]:\n res = []\n cur = [\"\"] * 4\n def backtrack(idx: int, part: int):\n if part == 4:\n if idx == len(s):\n res.append(\".\".join(cur))\n return\n remaining = len(s) - idx\n left = 4 - part\n if remaining < left or remaining > left * 3:\n return\n for ln in range(1, 4):\n if idx + ln > len(s):\n break\n piece = s[idx:idx + ln]\n if len(piece) > 1 and piece[0] == \"0\":\n break\n if int(piece) > 255:\n break\n cur[part] = piece\n backtrack(idx + ln, part + 1)\n backtrack(0, 0)\n return res\n```\n", "starter": {"go": "package main\n\nfunc RestoreIpAddresses(s string) []string {\n return []string{}\n}", "python": "from typing import List\nclass Solution:\n def restoreIpAddresses(self, s: str) -> List[str]:\n return []\n", "cpp": "#include <string>\n#include <vector>\nusing namespace std;\nclass Solution {\npublic:\n vector<string> restoreIpAddresses(string s) {\n return {};\n }\n};"}, "fn": "restoreIpAddresses", "params": [{"name": "s", "type": "string"}], "outputType": "string_list", "tests": [["25525511135"], ["0000"], ["101023"], ["1111"], ["010010"], ["11111111"], ["00000"], ["1234567890123"], ["1"], ["12"], ["123"], ["1234"], ["12345"], ["123456"], ["1234567"], ["255255255255"], ["00000"], ["10000"], ["10101010"], ["172162541"], ["99999999"], ["111111111111"], ["000000000000"], ["192168011"], ["255050255"], ["0100100"], ["10102345"], ["123123123"], ["001001"], ["1001001"]], "expected": [["255.255.11.135", "255.255.111.35"], ["0.0.0.0"], ["1.0.10.23", "1.0.102.3", "10.1.0.23", "10.10.2.3", "101.0.2.3"], ["1.1.1.1"], ["0.10.0.10", "0.100.1.0"], ["1.1.111.111", "1.11.11.111", "1.11.111.11", "1.111.1.111", "1.111.11.11", "1.111.111.1", "11.1.11.111", "11.1.111.11", "11.11.1.111", "11.11.11.11", "11.11.111.1", "11.111.1.11", "11.111.11.1", "111.1.1.111", "111.1.11.11", "111.1.111.1", "111.11.1.11", "111.11.11.1", "111.111.1.1"], [], [], [], [], [], ["1.2.3.4"], ["1.2.3.45", "1.2.34.5", "1.23.4.5", "12.3.4.5"], ["1.2.34.56", "1.23.4.56", "1.23.45.6", "1.234.5.6", "12.3.4.56", "12.3.45.6", "12.34.5.6", "123.4.5.6"], ["1.23.45.67", "1.234.5.67", "1.234.56.7", "12.3.45.67", "12.34.5.67", "12.34.56.7", "123.4.5.67", "123.4.56.7", "123.45.6.7"], ["255.255.255.255"], [], ["10.0.0.0"], ["10.10.10.10", "10.10.101.0", "10.101.0.10", "101.0.10.10", "101.0.101.0"], ["17.216.25.41", "17.216.254.1", "172.16.25.41", "172.16.254.1", "172.162.5.41", "172.162.54.1"], ["99.99.99.99"], ["111.111.111.111"], [], ["19.216.80.11", "192.16.80.11", "192.168.0.11"], ["25.50.50.255", "255.0.50.255"], ["0.10.0.100", "0.100.10.0"], ["10.10.23.45", "10.10.234.5", "10.102.3.45", "10.102.34.5", "101.0.23.45", "101.0.234.5"], ["1.23.123.123", "1.231.23.123", "1.231.231.23", "12.3.123.123", "12.31.23.123", "12.31.231.23", "123.1.23.123", "123.1.231.23", "123.12.3.123", "123.12.31.23", "123.123.1.23", "123.123.12.3"], ["0.0.100.1"], ["10.0.100.1", "100.10.0.1"]], "loose": true}

package/data/problems/reveal-cards-in-increasing-order.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "937", "slug": "reveal-cards-in-increasing-order", "id": 937, "title": "Reveal Cards In Increasing Order", "difficulty": "Medium", "category": "array", "link": "https://leetcode.com/problems/reveal-cards-in-increasing-order/", "examples": [{"input": "deck = [17,13,11,2,3,5,7]", "output": "[2,13,3,11,5,17,7]", "explanation": "Reveal order is 2,3,5,7,11,13,17."}, {"input": "deck = [1,1000]", "output": "[1,1000]", "explanation": "Already reveals in order."}], "hints": ["Sort the values first: the smallest card is revealed first, so its slot is known.", "Replay the routine on slot indices with a queue: take the front slot for the next smallest card, then rotate the new front slot to the back."], "statement": "Order the deck so a reveal-and-rotate routine exposes cards from smallest to largest.\n\nThe routine repeats two steps until the deck is empty: show the top card (it leaves the deck), then, if cards remain, move the new top card to the bottom. You may arrange the starting deck however you wish.\n\nGiven the distinct values in `deck`, return a starting order whose reveal sequence is sorted increasingly. The first entry of your answer is the top of the deck.\n\n**Constraints:**\n- `1 <= deck.length <= 1000`\n- `1 <= deck[i] <= 10^6`\n- All values in `deck` are distinct.\n", "solution": "## Approach\n\nSort the cards increasingly, then decide where each one starts. Simulate the reveal routine on a queue of free positions: the front position receives the next smallest card (it is revealed next), and the following front position rotates to the back (mirroring the move-to-bottom step). Filling positions this way yields a deck that reveals in sorted order.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n log n), dominated by sorting.\n- **Space Complexity:** O(n) for the queue and the answer.\n\n## Implementation\n\n```python\nfrom typing import List\nfrom collections import deque\nclass Solution:\n def deckRevealedIncreasing(self, deck: List[int]) -> List[int]:\n n = len(deck)\n ans = [0] * n\n q = deque(range(n))\n for card in sorted(deck):\n ans[q.popleft()] = card\n if q:\n q.append(q.popleft())\n return ans\n```\n", "starter": {"go": "package main\n\nfunc DeckRevealedIncreasing(deck []int) []int {\n return nil\n}", "python": "from typing import List\nclass Solution:\n def deckRevealedIncreasing(self, deck: List[int]) -> List[int]:\n pass", "cpp": "#include <vector>\n#include <string>\nusing namespace std;\n\nclass Solution {\npublic:\n vector<int> deckRevealedIncreasing(vector<int>& deck) {\n return {};\n }\n};"}, "fn": "deckRevealedIncreasing", "params": [{"name": "deck", "type": "int_array"}], "outputType": "int_array", "tests": [["[17, 13, 11, 2, 3, 5, 7]"], ["[1, 1000]"], ["[1]"], ["[1, 2]"], ["[1, 2, 3]"], ["[1, 2, 3, 4]"], ["[1, 2, 3, 4, 5]"], ["[5, 4, 3, 2, 1]"], ["[10, 20, 30]"], ["[100, 200, 300, 400]"], ["[1, 2, 3, 4, 5, 6]"], ["[6, 5, 4, 3, 2, 1]"], ["[13, 11, 7, 5, 3, 2]"], ["[1, 3, 5, 7, 9]"], ["[2, 4, 6, 8, 10]"], ["[9, 1, 8, 2, 7, 3, 6, 4, 5]"], ["[1000, 1, 500, 2]"], ["[1, 2, 3, 4, 5, 6, 7, 8]"], ["[8, 7, 6, 5, 4, 3, 2, 1]"], ["[42]"], ["[3, 1, 2]"], ["[4, 1, 3, 2]"], ["[11, 22, 33, 44, 55]"], ["[99, 100, 101]"], ["[5, 1, 4, 2, 3]"], ["[10, 1, 9, 2, 8, 3, 7, 4, 6, 5]"], ["[15, 13, 11, 9, 7, 5, 3, 1]"], ["[2, 3, 5, 7, 11, 13]"]], "expected": [[2, 13, 3, 11, 5, 17, 7], [1, 1000], [1], [1, 2], [1, 3, 2], [1, 3, 2, 4], [1, 5, 2, 4, 3], [1, 5, 2, 4, 3], [10, 30, 20], [100, 300, 200, 400], [1, 4, 2, 6, 3, 5], [1, 4, 2, 6, 3, 5], [2, 7, 3, 13, 5, 11], [1, 9, 3, 7, 5], [2, 10, 4, 8, 6], [1, 9, 2, 6, 3, 8, 4, 7, 5], [1, 500, 2, 1000], [1, 5, 2, 7, 3, 6, 4, 8], [1, 5, 2, 7, 3, 6, 4, 8], [42], [1, 3, 2], [1, 3, 2, 4], [11, 55, 22, 44, 33], [99, 101, 100], [1, 5, 2, 4, 3], [1, 6, 2, 10, 3, 7, 4, 9, 5, 8], [1, 9, 3, 13, 5, 11, 7, 15], [2, 7, 3, 13, 5, 11]], "loose": false}

package/data/problems/reverse-bits.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "15", "slug": "reverse-bits", "id": 15, "title": "Reverse Bits", "difficulty": "Easy", "category": "binary", "link": "https://leetcode.com/problems/reverse-bits/", "examples": [{"input": "n = 43261596 (00000010100101000001111010011100)", "output": "964176192 (00111001011110000010100101000000)", "explanation": "Reversing the 32-bit binary of 43261596 (binary: 0b10100101000001111010011100) gives the value 964176192 (00111001011110000010100101000000)."}, {"input": "n = 2 (00000000000000000000000000000010)", "output": "1073741824 (01000000000000000000000000000000)", "explanation": "Reversing the 32-bit binary of 2 (binary: 0b10) gives the value 1073741824 (01000000000000000000000000000000)."}], "hints": ["Iterate 32 times: shift result left and add the least significant bit of n, then unsigned right shift n."], "statement": "Reverse bits of a given 32-bit unsigned even integer.\n\n**Constraints:**\n- The input is a non-negative even integer.\n", "solution": "## Approach\n\nIterate 32 times, shifting the result left and adding the least significant bit of n, then shifting n right.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(1)\n- **Space Complexity:** O(1)\n\n## Implementation\n\n```python\nclass Solution:\n def reverseBits(self, n: int) -> int:\n res = 0\n for _ in range(32):\n res = (res << 1) | (n & 1)\n n >>= 1\n return res\n```\n", "starter": {"go": "package main\n\nfunc ReverseBits(n int) int {\n \n}", "python": "class Solution:\n def reverseBits(self, n: int) -> int:\n pass\n", "cpp": "class Solution {\npublic:\n uint32_t reverseBits(uint32_t n) {\n return 0;\n }\n};"}, "fn": "reverseBits", "params": [{"name": "n", "type": "int"}], "outputType": "int", "tests": [["43261596"], ["0"], ["2"], ["4"], ["16"], ["1024"], ["2147483646"], ["1073741824"], ["6"], ["8"], ["10"], ["12"], ["14"], ["30"], ["32"], ["42"], ["100"], ["254"], ["256"], ["1022"], ["65534"], ["65536"], ["12345678"], ["100000000"], ["536870910"], ["1073741822"], ["1431655764"], ["2000000000"], ["2147483644"], ["2147483642"]], "expected": [964176192, 0, 1073741824, 536870912, 134217728, 2097152, 2147483646, 2, 1610612736, 268435456, 1342177280, 805306368, 1879048192, 2013265920, 67108864, 1409286144, 637534208, 2130706432, 8388608, 2143289344, 2147418112, 32768, 1921400064, 8892320, 2147483640, 2147483644, 715827882, 2731246, 1073741822, 1610612734], "loose": false}

package/data/problems/reverse-integer.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "151", "slug": "reverse-integer", "id": 151, "title": "Reverse Integer", "difficulty": "Medium", "category": "binary", "link": "https://leetcode.com/problems/reverse-integer/", "examples": [{"input": "x = 123", "output": "321", "explanation": "Reversing the digits of 123 gives 321."}, {"input": "x = -123", "output": "-321", "explanation": "Reversing the digits of -123 gives -321."}, {"input": "x = 120", "output": "21", "explanation": "Reversing the digits of 120 gives 21."}, {"input": "x = 1534236469", "output": "0", "explanation": "The reversed value is outside the signed 32-bit range."}], "hints": ["Repeatedly remove the last digit with remainder and append it to the result.", "Check the signed 32-bit bounds before returning; the minimum input also needs safe handling.", "Trailing zeroes in the input disappear naturally while digits are appended numerically."], "statement": "Given a signed 32-bit integer `x`, reverse its decimal digits and return the result.\n\nPreserve the sign, discard leading zeroes in the reversed magnitude, and return `0` if the reversed value falls outside the signed 32-bit range `[-2^31, 2^31 - 1]`. Assume that 64-bit integer storage is available, but arbitrary-precision arithmetic is not needed.\n\n**Constraints:**\n- `-2^31 <= x <= 2^31 - 1`\n", "solution": "## Approach\n\nRecord the sign and repeatedly remove the last digit from the input magnitude. Append each removed digit to the reversed value with multiplication by `10`. Restore the sign and return `0` if the result is outside the signed 32-bit range.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(log |x|), because one decimal digit is processed per iteration.\n- **Space Complexity:** O(1).\n\n## Implementation\n\n```python\nclass Solution:\n def reverse(self, x: int) -> int:\n sign = -1 if x < 0 else 1\n value = abs(x)\n result = 0\n while value > 0:\n result = result * 10 + value % 10\n value //= 10\n result *= sign\n return result if -(2**31) <= result <= 2**31 - 1 else 0\n```\n", "starter": {"go": "package main\n\nfunc Reverse(x int) int {\n return 0\n}", "python": "class Solution:\n def reverse(self, x: int) -> int:\n return 0\n", "cpp": "class Solution {\npublic:\n int reverse(int x) {\n return 0;\n }\n};"}, "fn": "reverse", "params": [{"name": "x", "type": "int"}], "outputType": "int", "tests": [["0"], ["1"], ["-1"], ["2"], ["-2"], ["9"], ["-9"], ["10"], ["-10"], ["12"], ["-12"], ["21"], ["-21"], ["100"], ["-100"], ["101"], ["-101"], ["110"], ["-110"], ["120"], ["-120"], ["123"], ["-123"], ["321"], ["-321"], ["1000"], ["-1000"], ["1001"], ["-1001"], ["1020"], ["-1020"], ["900000"], ["-900000"], ["1000000000"], ["-1000000000"], ["123456789"], ["-123456789"], ["987654321"], ["-987654321"], ["1111111111"], ["-1111111111"], ["1221"], ["-1221"], ["1000000001"], ["-1000000001"], ["1534236469"], ["1563847412"], ["-1563847412"], ["1463847412"], ["-1463847412"], ["2147483647"], ["-2147483648"], ["2147483412"], ["-2147483412"], ["2143847412"], ["-2143847412"], ["1000000003"], ["-1000000003"], ["2000000002"], ["-2000000002"], ["2000000003"], ["-2000000003"], ["1056389759"], ["-1056389759"], ["1073741824"], ["-1073741824"], ["1073741823"], ["-1073741823"], ["2100000009"], ["-2100000009"], ["1234500000"], ["-1234500000"], ["1002003004"], ["-1002003004"], ["2001000009"], ["-2001000009"], ["135792468"], ["-135792468"], ["246801357"], ["-246801357"], ["2147483646"], ["-2147483647"]], "expected": [0, 1, -1, 2, -2, 9, -9, 1, -1, 21, -21, 12, -12, 1, -1, 101, -101, 11, -11, 21, -21, 321, -321, 123, -123, 1, -1, 1001, -1001, 201, -201, 9, -9, 1, -1, 987654321, -987654321, 123456789, -123456789, 1111111111, -1111111111, 1221, -1221, 1000000001, -1000000001, 0, 0, 0, 2147483641, -2147483641, 0, 0, 2143847412, -2143847412, 2147483412, -2147483412, 0, 0, 2000000002, -2000000002, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 54321, -54321, 0, 0, 0, 0, 864297531, -864297531, 753108642, -753108642, 0, 0], "loose": false}

package/data/problems/reverse-linked-list-ii.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "191", "slug": "reverse-linked-list-ii", "id": 191, "title": "Reverse Linked List II", "difficulty": "Medium", "category": "linked-list", "link": "https://leetcode.com/problems/reverse-linked-list-ii/", "examples": [{"input": "head = [1,2,3,4,5], left = 2, right = 4", "output": "[1,4,3,2,5]", "explanation": "Reverse positions 2 through 4: [2,3,4] becomes [4,3,2]."}, {"input": "head = [5], left = 1, right = 1", "output": "[5]", "explanation": "A single node reversed in place stays [5]."}, {"input": "head = [3,5], left = 1, right = 2", "output": "[5,3]", "explanation": "Reverse the whole list [3,5] to [5,3]."}], "hints": ["Use a dummy node so reversal starting at position 1 is handled uniformly.", "Advance to the node before position left, then iteratively move each following node to the front of the sublist until position right is reached."], "statement": "Take the head of a singly linked chain plus two integers `left` and `right`\nwith `left <= right`. Flip the order of the nodes from position `left`\nthrough position `right` while leaving the rest untouched, then hand back\nthe head of the full chain. Node positions count from 1 at the head.\n\n**Constraints:**\n\n- The number of nodes in the list is `n`.\n- `1 <= n <= 500`\n- `-500 <= Node.val <= 500`\n- `1 <= left <= right <= n`\n", "solution": "## Approach\n\nUse a dummy node so a reversal starting at position `1` needs no special case.\nAdvance `prev` to the node just before `left`, then repeatedly take `cur.next`\nand move it to immediately after `prev`. After `right - left` moves the\nsegment `[left, right]` is reversed in place with `O(1)` extra pointers.\n\n## Complexity Analysis\n\n- **Time Complexity:** `O(n)`, one pass to reach `left` plus the segment length.\n- **Space Complexity:** `O(1)` extra pointers (excluding the list itself).\n\n## Implementation\n\n```python\n# Definition for singly-linked list.\n# class ListNode:\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\n\nclass Solution:\n def reverseBetween(self, head, left: int, right: int):\n dummy = ListNode(0, head)\n prev = dummy\n for _ in range(1, left):\n prev = prev.next\n cur = prev.next\n for _ in range(right - left):\n nxt = cur.next\n cur.next = nxt.next\n nxt.next = prev.next\n prev.next = nxt\n return dummy.next\n```\n", "starter": {"go": "package main\n\n/*\nDefinition for singly-linked list.\ntype ListNode struct {\n Val int\n Next *ListNode\n}\n*/\n\nfunc ReverseBetween(head *ListNode, left int, right int) *ListNode {\n \n}", "python": "# Definition for singly-linked list.\n# class ListNode:\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\n\nclass Solution:\n def reverseBetween(self, head, left: int, right: int):\n pass\n", "cpp": "/*\nDefinition for singly-linked list.\nstruct ListNode {\n int val;\n ListNode *next;\n ListNode(): val(0), next(nullptr) {}\n ListNode(int x): val(x), next(nullptr) {}\n ListNode(int x, ListNode* next): val(x), next(next) {}\n};\n*/\nclass Solution {\npublic:\n ListNode* reverseBetween(ListNode* head, int left, int right) {\n return nullptr;\n }\n};"}, "fn": "reverseBetween", "params": [{"name": "head", "type": "list_node"}, {"name": "left", "type": "int"}, {"name": "right", "type": "int"}], "outputType": "list_node", "tests": [["[1,2,3,4,5]", "2", "4"], ["[5]", "1", "1"], ["[3,5]", "1", "2"], ["[1,2,3,4,5]", "1", "5"], ["[1,2,3,4,5]", "1", "1"], ["[1,2,3,4,5]", "5", "5"], ["[1,2]", "1", "2"], ["[1,2,3]", "2", "3"], ["[7,9,2,10,1,8,6]", "3", "6"], ["[0,0,0,0]", "2", "3"], ["[-500,500,-500,500]", "1", "4"], ["@javascript:JSON.stringify(Array.from({length:500},(_,i)=>i+1))", "1", "500"], ["@javascript:JSON.stringify(Array.from({length:500},(_,i)=>500-i))", "100", "400"], ["[-500]", "1", "1"], ["[500]", "1", "1"], ["[-1,0,1]", "1", "2"], ["[-1,0,1]", "2", "2"], ["[-1,0,1]", "2", "3"], ["[1,2,3,4]", "1", "3"], ["[1,2,3,4]", "2", "4"], ["[4,3,2,1]", "2", "3"], ["[5,5,5,5,5]", "2", "4"], ["[10,20,30,40,50,60]", "3", "6"], ["[10,20,30,40,50,60]", "1", "5"], ["[1,-1,2,-2,3,-3]", "2", "5"], ["[100,200,300,400,500]", "3", "3"], ["[-500,-250,0,250,500]", "1", "4"], ["[3,1,4,1,5,9,2,6]", "4", "7"], ["[8,7,6,5,4,3,2,1]", "1", "8"], ["[0,1,0,1,0,1,0]", "2", "6"]], "expected": [[1, 4, 3, 2, 5], [5], [5, 3], [5, 4, 3, 2, 1], [1, 2, 3, 4, 5], [1, 2, 3, 4, 5], [2, 1], [1, 3, 2], [7, 9, 8, 1, 10, 2, 6], [0, 0, 0, 0], [500, -500, 500, -500], [500, 499, 498, 497, 496, 495, 494, 493, 492, 491, 490, 489, 488, 487, 486, 485, 484, 483, 482, 481, 480, 479, 478, 477, 476, 475, 474, 473, 472, 471, 470, 469, 468, 467, 466, 465, 464, 463, 462, 461, 460, 459, 458, 457, 456, 455, 454, 453, 452, 451, 450, 449, 448, 447, 446, 445, 444, 443, 442, 441, 440, 439, 438, 437, 436, 435, 434, 433, 432, 431, 430, 429, 428, 427, 426, 425, 424, 423, 422, 421, 420, 419, 418, 417, 416, 415, 414, 413, 412, 411, 410, 409, 408, 407, 406, 405, 404, 403, 402, 401, 400, 399, 398, 397, 396, 395, 394, 393, 392, 391, 390, 389, 388, 387, 386, 385, 384, 383, 382, 381, 380, 379, 378, 377, 376, 375, 374, 373, 372, 371, 370, 369, 368, 367, 366, 365, 364, 363, 362, 361, 360, 359, 358, 357, 356, 355, 354, 353, 352, 351, 350, 349, 348, 347, 346, 345, 344, 343, 342, 341, 340, 339, 338, 337, 336, 335, 334, 333, 332, 331, 330, 329, 328, 327, 326, 325, 324, 323, 322, 321, 320, 319, 318, 317, 316, 315, 314, 313, 312, 311, 310, 309, 308, 307, 306, 305, 304, 303, 302, 301, 300, 299, 298, 297, 296, 295, 294, 293, 292, 291, 290, 289, 288, 287, 286, 285, 284, 283, 282, 281, 280, 279, 278, 277, 276, 275, 274, 273, 272, 271, 270, 269, 268, 267, 266, 265, 264, 263, 262, 261, 260, 259, 258, 257, 256, 255, 254, 253, 252, 251, 250, 249, 248, 247, 246, 245, 244, 243, 242, 241, 240, 239, 238, 237, 236, 235, 234, 233, 232, 231, 230, 229, 228, 227, 226, 225, 224, 223, 222, 221, 220, 219, 218, 217, 216, 215, 214, 213, 212, 211, 210, 209, 208, 207, 206, 205, 204, 203, 202, 201, 200, 199, 198, 197, 196, 195, 194, 193, 192, 191, 190, 189, 188, 187, 186, 185, 184, 183, 182, 181, 180, 179, 178, 177, 176, 175, 174, 173, 172, 171, 170, 169, 168, 167, 166, 165, 164, 163, 162, 161, 160, 159, 158, 157, 156, 155, 154, 153, 152, 151, 150, 149, 148, 147, 146, 145, 144, 143, 142, 141, 140, 139, 138, 137, 136, 135, 134, 133, 132, 131, 130, 129, 128, 127, 126, 125, 124, 123, 122, 121, 120, 119, 118, 117, 116, 115, 114, 113, 112, 111, 110, 109, 108, 107, 106, 105, 104, 103, 102, 101, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1], [500, 499, 498, 497, 496, 495, 494, 493, 492, 491, 490, 489, 488, 487, 486, 485, 484, 483, 482, 481, 480, 479, 478, 477, 476, 475, 474, 473, 472, 471, 470, 469, 468, 467, 466, 465, 464, 463, 462, 461, 460, 459, 458, 457, 456, 455, 454, 453, 452, 451, 450, 449, 448, 447, 446, 445, 444, 443, 442, 441, 440, 439, 438, 437, 436, 435, 434, 433, 432, 431, 430, 429, 428, 427, 426, 425, 424, 423, 422, 421, 420, 419, 418, 417, 416, 415, 414, 413, 412, 411, 410, 409, 408, 407, 406, 405, 404, 403, 402, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1], [-500], [500], [0, -1, 1], [-1, 0, 1], [-1, 1, 0], [3, 2, 1, 4], [1, 4, 3, 2], [4, 2, 3, 1], [5, 5, 5, 5, 5], [10, 20, 60, 50, 40, 30], [50, 40, 30, 20, 10, 60], [1, 3, -2, 2, -1, -3], [100, 200, 300, 400, 500], [250, 0, -250, -500, 500], [3, 1, 4, 2, 9, 5, 1, 6], [1, 2, 3, 4, 5, 6, 7, 8], [0, 1, 0, 1, 0, 1, 0]], "loose": false}

package/data/problems/reverse-linked-list.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "40", "slug": "reverse-linked-list", "id": 40, "title": "Reverse Linked List", "difficulty": "Easy", "category": "linked-list", "link": "https://leetcode.com/problems/reverse-linked-list/", "examples": [{"input": "head = [1,2,3,4,5]", "output": "[5,4,3,2,1]", "explanation": "Reversing the linked list [1,2,3,4,5] gives the reversed order [5,4,3,2,1]."}, {"input": "head = [1,2]", "output": "[2,1]", "explanation": "Reversing the linked list [1,2] gives the reversed order [2,1]."}, {"input": "head = []", "output": "[]", "explanation": "The list is empty, so the reversed list is also empty."}], "hints": ["Iterative approach: maintain prev, curr, next pointers; set curr.next = prev while walking forward.", "At the end, prev is the new head; return it.", "Recursive approach: reverse from head.next, then set head.next.next = head and head.next = null.", "Avoid creating new nodes; just rewire next pointers."], "statement": "Take the head of a singly linked chain, flip the direction of the whole chain, and hand back the head of the flipped chain.\n\n**Constraints:**\n\n- The number of nodes in the list is the range [0, 5000].\n- -5000 \u2264 Node.val \u2264 5000\n", "solution": "## Approach\n\nIterate through the list, reversing each node's pointer to point to the previous node. Track the previous, current, and next nodes to avoid losing references.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n)\n- **Space Complexity:** O(1)\n\n## Implementation\n\n```python\nfrom typing import Optional\nclass Solution:\n def reverseList(self, head: Optional[ListNode]) -> Optional[ListNode]:\n prev = None\n cur = head\n while cur:\n nxt = cur.next\n cur.next = prev\n prev = cur\n cur = nxt\n return prev\n```\n", "starter": {"go": "package main\n\n/*\nDefinition for singly-linked list.\ntype ListNode struct {\n Val int\n Next *ListNode\n}\n*/\n\nfunc ReverseList(head *ListNode) *ListNode {\n \n}", "python": "# Definition for singly-linked list.\n# class ListNode:\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\n\nclass Solution:\n def reverseList(self, head):\n # TODO: implement in-place reversal and return new head\n pass\n", "cpp": "/*\nDefinition for singly-linked list.\nstruct ListNode {\n int val;\n ListNode *next;\n ListNode(): val(0), next(nullptr) {}\n ListNode(int x): val(x), next(nullptr) {}\n ListNode(int x, ListNode* next): val(x), next(next) {}\n};\n*/\nclass Solution {\npublic:\n ListNode* reverseList(ListNode* head) {\n \n }\n};\n"}, "fn": "reverseList", "params": [{"name": "head", "type": "list_node"}], "outputType": "list_node", "tests": [["[1,2,3,4,5]"], ["[1,2]"], ["[]"], ["[0]"], ["[1,1,1,1]"], ["[2,1,3,5,6,4,7]"], ["[10,20,30,40,50,60,70,80,90,100]"], ["[5,4,3,2,1]"], ["[7,6,5,4,3,2,1]"], ["[1000,999,456,0,-1,-2,-3]"], ["@javascript:JSON.stringify(Array.from({length:5000}, (_, i) => i + 1))"], ["@javascript:JSON.stringify(Array(4000).fill(1))"], ["@javascript:JSON.stringify(Array.from({length:5000}, (_, i) => i % 10))"], ["[-5000]"], ["[5000]"], ["[-5000,5000]"], ["[0,0]"], ["[-1,0,1]"], ["[3,1,4,1,5,9]"], ["[9,8,7,6,5,4,3,2]"], ["[-5,-4,-3,-2,-1]"], ["[1,-1,1,-1,1,-1]"], ["[5000,4000,3000,2000,1000,0,-1000,-2000,-3000,-4000,-5000]"], ["[42,42,17,17,0,0]"], ["[2,3,5,7,11,13,17,19]"], ["[-8,6,-7,5,-3,0,9]"], ["[100,-100,200,-200,300,-300]"], ["[4,3,2,1,0,-1,-2,-3,-4]"], ["[11,22,33,44,55,66,77,88,99]"], ["[-5000,0,5000,0,-5000]"]], "expected": [[5, 4, 3, 2, 1], [2, 1], null, [0], [1, 1, 1, 1], [7, 4, 6, 5, 3, 1, 2], [100, 90, 80, 70, 60, 50, 40, 30, 20, 10], [1, 2, 3, 4, 5], [1, 2, 3, 4, 5, 6, 7], [-3, -2, -1, 0, 456, 999, 1000], [5000, 4999, 4998, 4997, 4996, 4995, 4994, 4993, 4992, 4991, 4990, 4989, 4988, 4987, 4986, 4985, 4984, 4983, 4982, 4981, 4980, 4979, 4978, 4977, 4976, 4975, 4974, 4973, 4972, 4971, 4970, 4969, 4968, 4967, 4966, 4965, 4964, 4963, 4962, 4961, 4960, 4959, 4958, 4957, 4956, 4955, 4954, 4953, 4952, 4951, 4950, 4949, 4948, 4947, 4946, 4945, 4944, 4943, 4942, 4941, 4940, 4939, 4938, 4937, 4936, 4935, 4934, 4933, 4932, 4931, 4930, 4929, 4928, 4927, 4926, 4925, 4924, 4923, 4922, 4921, 4920, 4919, 4918, 4917, 4916, 4915, 4914, 4913, 4912, 4911, 4910, 4909, 4908, 4907, 4906, 4905, 4904, 4903, 4902, 4901, 4900, 4899, 4898, 4897, 4896, 4895, 4894, 4893, 4892, 4891, 4890, 4889, 4888, 4887, 4886, 4885, 4884, 4883, 4882, 4881, 4880, 4879, 4878, 4877, 4876, 4875, 4874, 4873, 4872, 4871, 4870, 4869, 4868, 4867, 4866, 4865, 4864, 4863, 4862, 4861, 4860, 4859, 4858, 4857, 4856, 4855, 4854, 4853, 4852, 4851, 4850, 4849, 4848, 4847, 4846, 4845, 4844, 4843, 4842, 4841, 4840, 4839, 4838, 4837, 4836, 4835, 4834, 4833, 4832, 4831, 4830, 4829, 4828, 4827, 4826, 4825, 4824, 4823, 4822, 4821, 4820, 4819, 4818, 4817, 4816, 4815, 4814, 4813, 4812, 4811, 4810, 4809, 4808, 4807, 4806, 4805, 4804, 4803, 4802, 4801, 4800, 4799, 4798, 4797, 4796, 4795, 4794, 4793, 4792, 4791, 4790, 4789, 4788, 4787, 4786, 4785, 4784, 4783, 4782, 4781, 4780, 4779, 4778, 4777, 4776, 4775, 4774, 4773, 4772, 4771, 4770, 4769, 4768, 4767, 4766, 4765, 4764, 4763, 4762, 4761, 4760, 4759, 4758, 4757, 4756, 4755, 4754, 4753, 4752, 4751, 4750, 4749, 4748, 4747, 4746, 4745, 4744, 4743, 4742, 4741, 4740, 4739, 4738, 4737, 4736, 4735, 4734, 4733, 4732, 4731, 4730, 4729, 4728, 4727, 4726, 4725, 4724, 4723, 4722, 4721, 4720, 4719, 4718, 4717, 4716, 4715, 4714, 4713, 4712, 4711, 4710, 4709, 4708, 4707, 4706, 4705, 4704, 4703, 4702, 4701, 4700, 4699, 4698, 4697, 4696, 4695, 4694, 4693, 4692, 4691, 4690, 4689, 4688, 4687, 4686, 4685, 4684, 4683, 4682, 4681, 4680, 4679, 4678, 4677, 4676, 4675, 4674, 4673, 4672, 4671, 4670, 4669, 4668, 4667, 4666, 4665, 4664, 4663, 4662, 4661, 4660, 4659, 4658, 4657, 4656, 4655, 4654, 4653, 4652, 4651, 4650, 4649, 4648, 4647, 4646, 4645, 4644, 4643, 4642, 4641, 4640, 4639, 4638, 4637, 4636, 4635, 4634, 4633, 4632, 4631, 4630, 4629, 4628, 4627, 4626, 4625, 4624, 4623, 4622, 4621, 4620, 4619, 4618, 4617, 4616, 4615, 4614, 4613, 4612, 4611, 4610, 4609, 4608, 4607, 4606, 4605, 4604, 4603, 4602, 4601, 4600, 4599, 4598, 4597, 4596, 4595, 4594, 4593, 4592, 4591, 4590, 4589, 4588, 4587, 4586, 4585, 4584, 4583, 4582, 4581, 4580, 4579, 4578, 4577, 4576, 4575, 4574, 4573, 4572, 4571, 4570, 4569, 4568, 4567, 4566, 4565, 4564, 4563, 4562, 4561, 4560, 4559, 4558, 4557, 4556, 4555, 4554, 4553, 4552, 4551, 4550, 4549, 4548, 4547, 4546, 4545, 4544, 4543, 4542, 4541, 4540, 4539, 4538, 4537, 4536, 4535, 4534, 4533, 4532, 4531, 4530, 4529, 4528, 4527, 4526, 4525, 4524, 4523, 4522, 4521, 4520, 4519, 4518, 4517, 4516, 4515, 4514, 4513, 4512, 4511, 4510, 4509, 4508, 4507, 4506, 4505, 4504, 4503, 4502, 4501, 4500, 4499, 4498, 4497, 4496, 4495, 4494, 4493, 4492, 4491, 4490, 4489, 4488, 4487, 4486, 4485, 4484, 4483, 4482, 4481, 4480, 4479, 4478, 4477, 4476, 4475, 4474, 4473, 4472, 4471, 4470, 4469, 4468, 4467, 4466, 4465, 4464, 4463, 4462, 4461, 4460, 4459, 4458, 4457, 4456, 4455, 4454, 4453, 4452, 4451, 4450, 4449, 4448, 4447, 4446, 4445, 4444, 4443, 4442, 4441, 4440, 4439, 4438, 4437, 4436, 4435, 4434, 4433, 4432, 4431, 4430, 4429, 4428, 4427, 4426, 4425, 4424, 4423, 4422, 4421, 4420, 4419, 4418, 4417, 4416, 4415, 4414, 4413, 4412, 4411, 4410, 4409, 4408, 4407, 4406, 4405, 4404, 4403, 4402, 4401, 4400, 4399, 4398, 4397, 4396, 4395, 4394, 4393, 4392, 4391, 4390, 4389, 4388, 4387, 4386, 4385, 4384, 4383, 4382, 4381, 4380, 4379, 4378, 4377, 4376, 4375, 4374, 4373, 4372, 4371, 4370, 4369, 4368, 4367, 4366, 4365, 4364, 4363, 4362, 4361, 4360, 4359, 4358, 4357, 4356, 4355, 4354, 4353, 4352, 4351, 4350, 4349, 4348, 4347, 4346, 4345, 4344, 4343, 4342, 4341, 4340, 4339, 4338, 4337, 4336, 4335, 4334, 4333, 4332, 4331, 4330, 4329, 4328, 4327, 4326, 4325, 4324, 4323, 4322, 4321, 4320, 4319, 4318, 4317, 4316, 4315, 4314, 4313, 4312, 4311, 4310, 4309, 4308, 4307, 4306, 4305, 4304, 4303, 4302, 4301, 4300, 4299, 4298, 4297, 4296, 4295, 4294, 4293, 4292, 4291, 4290, 4289, 4288, 4287, 4286, 4285, 4284, 4283, 4282, 4281, 4280, 4279, 4278, 4277, 4276, 4275, 4274, 4273, 4272, 4271, 4270, 4269, 4268, 4267, 4266, 4265, 4264, 4263, 4262, 4261, 4260, 4259, 4258, 4257, 4256, 4255, 4254, 4253, 4252, 4251, 4250, 4249, 4248, 4247, 4246, 4245, 4244, 4243, 4242, 4241, 4240, 4239, 4238, 4237, 4236, 4235, 4234, 4233, 4232, 4231, 4230, 4229, 4228, 4227, 4226, 4225, 4224, 4223, 4222, 4221, 4220, 4219, 4218, 4217, 4216, 4215, 4214, 4213, 4212, 4211, 4210, 4209, 4208, 4207, 4206, 4205, 4204, 4203, 4202, 4201, 4200, 4199, 4198, 4197, 4196, 4195, 4194, 4193, 4192, 4191, 4190, 4189, 4188, 4187, 4186, 4185, 4184, 4183, 4182, 4181, 4180, 4179, 4178, 4177, 4176, 4175, 4174, 4173, 4172, 4171, 4170, 4169, 4168, 4167, 4166, 4165, 4164, 4163, 4162, 4161, 4160, 4159, 4158, 4157, 4156, 4155, 4154, 4153, 4152, 4151, 4150, 4149, 4148, 4147, 4146, 4145, 4144, 4143, 4142, 4141, 4140, 4139, 4138, 4137, 4136, 4135, 4134, 4133, 4132, 4131, 4130, 4129, 4128, 4127, 4126, 4125, 4124, 4123, 4122, 4121, 4120, 4119, 4118, 4117, 4116, 4115, 4114, 4113, 4112, 4111, 4110, 4109, 4108, 4107, 4106, 4105, 4104, 4103, 4102, 4101, 4100, 4099, 4098, 4097, 4096, 4095, 4094, 4093, 4092, 4091, 4090, 4089, 4088, 4087, 4086, 4085, 4084, 4083, 4082, 4081, 4080, 4079, 4078, 4077, 4076, 4075, 4074, 4073, 4072, 4071, 4070, 4069, 4068, 4067, 4066, 4065, 4064, 4063, 4062, 4061, 4060, 4059, 4058, 4057, 4056, 4055, 4054, 4053, 4052, 4051, 4050, 4049, 4048, 4047, 4046, 4045, 4044, 4043, 4042, 4041, 4040, 4039, 4038, 4037, 4036, 4035, 4034, 4033, 4032, 4031, 4030, 4029, 4028, 4027, 4026, 4025, 4024, 4023, 4022, 4021, 4020, 4019, 4018, 4017, 4016, 4015, 4014, 4013, 4012, 4011, 4010, 4009, 4008, 4007, 4006, 4005, 4004, 4003, 4002, 4001, 4000, 3999, 3998, 3997, 3996, 3995, 3994, 3993, 3992, 3991, 3990, 3989, 3988, 3987, 3986, 3985, 3984, 3983, 3982, 3981, 3980, 3979, 3978, 3977, 3976, 3975, 3974, 3973, 3972, 3971, 3970, 3969, 3968, 3967, 3966, 3965, 3964, 3963, 3962, 3961, 3960, 3959, 3958, 3957, 3956, 3955, 3954, 3953, 3952, 3951, 3950, 3949, 3948, 3947, 3946, 3945, 3944, 3943, 3942, 3941, 3940, 3939, 3938, 3937, 3936, 3935, 3934, 3933, 3932, 3931, 3930, 3929, 3928, 3927, 3926, 3925, 3924, 3923, 3922, 3921, 3920, 3919, 3918, 3917, 3916, 3915, 3914, 3913, 3912, 3911, 3910, 3909, 3908, 3907, 3906, 3905, 3904, 3903, 3902, 3901, 3900, 3899, 3898, 3897, 3896, 3895, 3894, 3893, 3892, 3891, 3890, 3889, 3888, 3887, 3886, 3885, 3884, 3883, 3882, 3881, 3880, 3879, 3878, 3877, 3876, 3875, 3874, 3873, 3872, 3871, 3870, 3869, 3868, 3867, 3866, 3865, 3864, 3863, 3862, 3861, 3860, 3859, 3858, 3857, 3856, 3855, 3854, 3853, 3852, 3851, 3850, 3849, 3848, 3847, 3846, 3845, 3844, 3843, 3842, 3841, 3840, 3839, 3838, 3837, 3836, 3835, 3834, 3833, 3832, 3831, 3830, 3829, 3828, 3827, 3826, 3825, 3824, 3823, 3822, 3821, 3820, 3819, 3818, 3817, 3816, 3815, 3814, 3813, 3812, 3811, 3810, 3809, 3808, 3807, 3806, 3805, 3804, 3803, 3802, 3801, 3800, 3799, 3798, 3797, 3796, 3795, 3794, 3793, 3792, 3791, 3790, 3789, 3788, 3787, 3786, 3785, 3784, 3783, 3782, 3781, 3780, 3779, 3778, 3777, 3776, 3775, 3774, 3773, 3772, 3771, 3770, 3769, 3768, 3767, 3766, 3765, 3764, 3763, 3762, 3761, 3760, 3759, 3758, 3757, 3756, 3755, 3754, 3753, 3752, 3751, 3750, 3749, 3748, 3747, 3746, 3745, 3744, 3743, 3742, 3741, 3740, 3739, 3738, 3737, 3736, 3735, 3734, 3733, 3732, 3731, 3730, 3729, 3728, 3727, 3726, 3725, 3724, 3723, 3722, 3721, 3720, 3719, 3718, 3717, 3716, 3715, 3714, 3713, 3712, 3711, 3710, 3709, 3708, 3707, 3706, 3705, 3704, 3703, 3702, 3701, 3700, 3699, 3698, 3697, 3696, 3695, 3694, 3693, 3692, 3691, 3690, 3689, 3688, 3687, 3686, 3685, 3684, 3683, 3682, 3681, 3680, 3679, 3678, 3677, 3676, 3675, 3674, 3673, 3672, 3671, 3670, 3669, 3668, 3667, 3666, 3665, 3664, 3663, 3662, 3661, 3660, 3659, 3658, 3657, 3656, 3655, 3654, 3653, 3652, 3651, 3650, 3649, 3648, 3647, 3646, 3645, 3644, 3643, 3642, 3641, 3640, 3639, 3638, 3637, 3636, 3635, 3634, 3633, 3632, 3631, 3630, 3629, 3628, 3627, 3626, 3625, 3624, 3623, 3622, 3621, 3620, 3619, 3618, 3617, 3616, 3615, 3614, 3613, 3612, 3611, 3610, 3609, 3608, 3607, 3606, 3605, 3604, 3603, 3602, 3601, 3600, 3599, 3598, 3597, 3596, 3595, 3594, 3593, 3592, 3591, 3590, 3589, 3588, 3587, 3586, 3585, 3584, 3583, 3582, 3581, 3580, 3579, 3578, 3577, 3576, 3575, 3574, 3573, 3572, 3571, 3570, 3569, 3568, 3567, 3566, 3565, 3564, 3563, 3562, 3561, 3560, 3559, 3558, 3557, 3556, 3555, 3554, 3553, 3552, 3551, 3550, 3549, 3548, 3547, 3546, 3545, 3544, 3543, 3542, 3541, 3540, 3539, 3538, 3537, 3536, 3535, 3534, 3533, 3532, 3531, 3530, 3529, 3528, 3527, 3526, 3525, 3524, 3523, 3522, 3521, 3520, 3519, 3518, 3517, 3516, 3515, 3514, 3513, 3512, 3511, 3510, 3509, 3508, 3507, 3506, 3505, 3504, 3503, 3502, 3501, 3500, 3499, 3498, 3497, 3496, 3495, 3494, 3493, 3492, 3491, 3490, 3489, 3488, 3487, 3486, 3485, 3484, 3483, 3482, 3481, 3480, 3479, 3478, 3477, 3476, 3475, 3474, 3473, 3472, 3471, 3470, 3469, 3468, 3467, 3466, 3465, 3464, 3463, 3462, 3461, 3460, 3459, 3458, 3457, 3456, 3455, 3454, 3453, 3452, 3451, 3450, 3449, 3448, 3447, 3446, 3445, 3444, 3443, 3442, 3441, 3440, 3439, 3438, 3437, 3436, 3435, 3434, 3433, 3432, 3431, 3430, 3429, 3428, 3427, 3426, 3425, 3424, 3423, 3422, 3421, 3420, 3419, 3418, 3417, 3416, 3415, 3414, 3413, 3412, 3411, 3410, 3409, 3408, 3407, 3406, 3405, 3404, 3403, 3402, 3401, 3400, 3399, 3398, 3397, 3396, 3395, 3394, 3393, 3392, 3391, 3390, 3389, 3388, 3387, 3386, 3385, 3384, 3383, 3382, 3381, 3380, 3379, 3378, 3377, 3376, 3375, 3374, 3373, 3372, 3371, 3370, 3369, 3368, 3367, 3366, 3365, 3364, 3363, 3362, 3361, 3360, 3359, 3358, 3357, 3356, 3355, 3354, 3353, 3352, 3351, 3350, 3349, 3348, 3347, 3346, 3345, 3344, 3343, 3342, 3341, 3340, 3339, 3338, 3337, 3336, 3335, 3334, 3333, 3332, 3331, 3330, 3329, 3328, 3327, 3326, 3325, 3324, 3323, 3322, 3321, 3320, 3319, 3318, 3317, 3316, 3315, 3314, 3313, 3312, 3311, 3310, 3309, 3308, 3307, 3306, 3305, 3304, 3303, 3302, 3301, 3300, 3299, 3298, 3297, 3296, 3295, 3294, 3293, 3292, 3291, 3290, 3289, 3288, 3287, 3286, 3285, 3284, 3283, 3282, 3281, 3280, 3279, 3278, 3277, 3276, 3275, 3274, 3273, 3272, 3271, 3270, 3269, 3268, 3267, 3266, 3265, 3264, 3263, 3262, 3261, 3260, 3259, 3258, 3257, 3256, 3255, 3254, 3253, 3252, 3251, 3250, 3249, 3248, 3247, 3246, 3245, 3244, 3243, 3242, 3241, 3240, 3239, 3238, 3237, 3236, 3235, 3234, 3233, 3232, 3231, 3230, 3229, 3228, 3227, 3226, 3225, 3224, 3223, 3222, 3221, 3220, 3219, 3218, 3217, 3216, 3215, 3214, 3213, 3212, 3211, 3210, 3209, 3208, 3207, 3206, 3205, 3204, 3203, 3202, 3201, 3200, 3199, 3198, 3197, 3196, 3195, 3194, 3193, 3192, 3191, 3190, 3189, 3188, 3187, 3186, 3185, 3184, 3183, 3182, 3181, 3180, 3179, 3178, 3177, 3176, 3175, 3174, 3173, 3172, 3171, 3170, 3169, 3168, 3167, 3166, 3165, 3164, 3163, 3162, 3161, 3160, 3159, 3158, 3157, 3156, 3155, 3154, 3153, 3152, 3151, 3150, 3149, 3148, 3147, 3146, 3145, 3144, 3143, 3142, 3141, 3140, 3139, 3138, 3137, 3136, 3135, 3134, 3133, 3132, 3131, 3130, 3129, 3128, 3127, 3126, 3125, 3124, 3123, 3122, 3121, 3120, 3119, 3118, 3117, 3116, 3115, 3114, 3113, 3112, 3111, 3110, 3109, 3108, 3107, 3106, 3105, 3104, 3103, 3102, 3101, 3100, 3099, 3098, 3097, 3096, 3095, 3094, 3093, 3092, 3091, 3090, 3089, 3088, 3087, 3086, 3085, 3084, 3083, 3082, 3081, 3080, 3079, 3078, 3077, 3076, 3075, 3074, 3073, 3072, 3071, 3070, 3069, 3068, 3067, 3066, 3065, 3064, 3063, 3062, 3061, 3060, 3059, 3058, 3057, 3056, 3055, 3054, 3053, 3052, 3051, 3050, 3049, 3048, 3047, 3046, 3045, 3044, 3043, 3042, 3041, 3040, 3039, 3038, 3037, 3036, 3035, 3034, 3033, 3032, 3031, 3030, 3029, 3028, 3027, 3026, 3025, 3024, 3023, 3022, 3021, 3020, 3019, 3018, 3017, 3016, 3015, 3014, 3013, 3012, 3011, 3010, 3009, 3008, 3007, 3006, 3005, 3004, 3003, 3002, 3001, 3000, 2999, 2998, 2997, 2996, 2995, 2994, 2993, 2992, 2991, 2990, 2989, 2988, 2987, 2986, 2985, 2984, 2983, 2982, 2981, 2980, 2979, 2978, 2977, 2976, 2975, 2974, 2973, 2972, 2971, 2970, 2969, 2968, 2967, 2966, 2965, 2964, 2963, 2962, 2961, 2960, 2959, 2958, 2957, 2956, 2955, 2954, 2953, 2952, 2951, 2950, 2949, 2948, 2947, 2946, 2945, 2944, 2943, 2942, 2941, 2940, 2939, 2938, 2937, 2936, 2935, 2934, 2933, 2932, 2931, 2930, 2929, 2928, 2927, 2926, 2925, 2924, 2923, 2922, 2921, 2920, 2919, 2918, 2917, 2916, 2915, 2914, 2913, 2912, 2911, 2910, 2909, 2908, 2907, 2906, 2905, 2904, 2903, 2902, 2901, 2900, 2899, 2898, 2897, 2896, 2895, 2894, 2893, 2892, 2891, 2890, 2889, 2888, 2887, 2886, 2885, 2884, 2883, 2882, 2881, 2880, 2879, 2878, 2877, 2876, 2875, 2874, 2873, 2872, 2871, 2870, 2869, 2868, 2867, 2866, 2865, 2864, 2863, 2862, 2861, 2860, 2859, 2858, 2857, 2856, 2855, 2854, 2853, 2852, 2851, 2850, 2849, 2848, 2847, 2846, 2845, 2844, 2843, 2842, 2841, 2840, 2839, 2838, 2837, 2836, 2835, 2834, 2833, 2832, 2831, 2830, 2829, 2828, 2827, 2826, 2825, 2824, 2823, 2822, 2821, 2820, 2819, 2818, 2817, 2816, 2815, 2814, 2813, 2812, 2811, 2810, 2809, 2808, 2807, 2806, 2805, 2804, 2803, 2802, 2801, 2800, 2799, 2798, 2797, 2796, 2795, 2794, 2793, 2792, 2791, 2790, 2789, 2788, 2787, 2786, 2785, 2784, 2783, 2782, 2781, 2780, 2779, 2778, 2777, 2776, 2775, 2774, 2773, 2772, 2771, 2770, 2769, 2768, 2767, 2766, 2765, 2764, 2763, 2762, 2761, 2760, 2759, 2758, 2757, 2756, 2755, 2754, 2753, 2752, 2751, 2750, 2749, 2748, 2747, 2746, 2745, 2744, 2743, 2742, 2741, 2740, 2739, 2738, 2737, 2736, 2735, 2734, 2733, 2732, 2731, 2730, 2729, 2728, 2727, 2726, 2725, 2724, 2723, 2722, 2721, 2720, 2719, 2718, 2717, 2716, 2715, 2714, 2713, 2712, 2711, 2710, 2709, 2708, 2707, 2706, 2705, 2704, 2703, 2702, 2701, 2700, 2699, 2698, 2697, 2696, 2695, 2694, 2693, 2692, 2691, 2690, 2689, 2688, 2687, 2686, 2685, 2684, 2683, 2682, 2681, 2680, 2679, 2678, 2677, 2676, 2675, 2674, 2673, 2672, 2671, 2670, 2669, 2668, 2667, 2666, 2665, 2664, 2663, 2662, 2661, 2660, 2659, 2658, 2657, 2656, 2655, 2654, 2653, 2652, 2651, 2650, 2649, 2648, 2647, 2646, 2645, 2644, 2643, 2642, 2641, 2640, 2639, 2638, 2637, 2636, 2635, 2634, 2633, 2632, 2631, 2630, 2629, 2628, 2627, 2626, 2625, 2624, 2623, 2622, 2621, 2620, 2619, 2618, 2617, 2616, 2615, 2614, 2613, 2612, 2611, 2610, 2609, 2608, 2607, 2606, 2605, 2604, 2603, 2602, 2601, 2600, 2599, 2598, 2597, 2596, 2595, 2594, 2593, 2592, 2591, 2590, 2589, 2588, 2587, 2586, 2585, 2584, 2583, 2582, 2581, 2580, 2579, 2578, 2577, 2576, 2575, 2574, 2573, 2572, 2571, 2570, 2569, 2568, 2567, 2566, 2565, 2564, 2563, 2562, 2561, 2560, 2559, 2558, 2557, 2556, 2555, 2554, 2553, 2552, 2551, 2550, 2549, 2548, 2547, 2546, 2545, 2544, 2543, 2542, 2541, 2540, 2539, 2538, 2537, 2536, 2535, 2534, 2533, 2532, 2531, 2530, 2529, 2528, 2527, 2526, 2525, 2524, 2523, 2522, 2521, 2520, 2519, 2518, 2517, 2516, 2515, 2514, 2513, 2512, 2511, 2510, 2509, 2508, 2507, 2506, 2505, 2504, 2503, 2502, 2501, 2500, 2499, 2498, 2497, 2496, 2495, 2494, 2493, 2492, 2491, 2490, 2489, 2488, 2487, 2486, 2485, 2484, 2483, 2482, 2481, 2480, 2479, 2478, 2477, 2476, 2475, 2474, 2473, 2472, 2471, 2470, 2469, 2468, 2467, 2466, 2465, 2464, 2463, 2462, 2461, 2460, 2459, 2458, 2457, 2456, 2455, 2454, 2453, 2452, 2451, 2450, 2449, 2448, 2447, 2446, 2445, 2444, 2443, 2442, 2441, 2440, 2439, 2438, 2437, 2436, 2435, 2434, 2433, 2432, 2431, 2430, 2429, 2428, 2427, 2426, 2425, 2424, 2423, 2422, 2421, 2420, 2419, 2418, 2417, 2416, 2415, 2414, 2413, 2412, 2411, 2410, 2409, 2408, 2407, 2406, 2405, 2404, 2403, 2402, 2401, 2400, 2399, 2398, 2397, 2396, 2395, 2394, 2393, 2392, 2391, 2390, 2389, 2388, 2387, 2386, 2385, 2384, 2383, 2382, 2381, 2380, 2379, 2378, 2377, 2376, 2375, 2374, 2373, 2372, 2371, 2370, 2369, 2368, 2367, 2366, 2365, 2364, 2363, 2362, 2361, 2360, 2359, 2358, 2357, 2356, 2355, 2354, 2353, 2352, 2351, 2350, 2349, 2348, 2347, 2346, 2345, 2344, 2343, 2342, 2341, 2340, 2339, 2338, 2337, 2336, 2335, 2334, 2333, 2332, 2331, 2330, 2329, 2328, 2327, 2326, 2325, 2324, 2323, 2322, 2321, 2320, 2319, 2318, 2317, 2316, 2315, 2314, 2313, 2312, 2311, 2310, 2309, 2308, 2307, 2306, 2305, 2304, 2303, 2302, 2301, 2300, 2299, 2298, 2297, 2296, 2295, 2294, 2293, 2292, 2291, 2290, 2289, 2288, 2287, 2286, 2285, 2284, 2283, 2282, 2281, 2280, 2279, 2278, 2277, 2276, 2275, 2274, 2273, 2272, 2271, 2270, 2269, 2268, 2267, 2266, 2265, 2264, 2263, 2262, 2261, 2260, 2259, 2258, 2257, 2256, 2255, 2254, 2253, 2252, 2251, 2250, 2249, 2248, 2247, 2246, 2245, 2244, 2243, 2242, 2241, 2240, 2239, 2238, 2237, 2236, 2235, 2234, 2233, 2232, 2231, 2230, 2229, 2228, 2227, 2226, 2225, 2224, 2223, 2222, 2221, 2220, 2219, 2218, 2217, 2216, 2215, 2214, 2213, 2212, 2211, 2210, 2209, 2208, 2207, 2206, 2205, 2204, 2203, 2202, 2201, 2200, 2199, 2198, 2197, 2196, 2195, 2194, 2193, 2192, 2191, 2190, 2189, 2188, 2187, 2186, 2185, 2184, 2183, 2182, 2181, 2180, 2179, 2178, 2177, 2176, 2175, 2174, 2173, 2172, 2171, 2170, 2169, 2168, 2167, 2166, 2165, 2164, 2163, 2162, 2161, 2160, 2159, 2158, 2157, 2156, 2155, 2154, 2153, 2152, 2151, 2150, 2149, 2148, 2147, 2146, 2145, 2144, 2143, 2142, 2141, 2140, 2139, 2138, 2137, 2136, 2135, 2134, 2133, 2132, 2131, 2130, 2129, 2128, 2127, 2126, 2125, 2124, 2123, 2122, 2121, 2120, 2119, 2118, 2117, 2116, 2115, 2114, 2113, 2112, 2111, 2110, 2109, 2108, 2107, 2106, 2105, 2104, 2103, 2102, 2101, 2100, 2099, 2098, 2097, 2096, 2095, 2094, 2093, 2092, 2091, 2090, 2089, 2088, 2087, 2086, 2085, 2084, 2083, 2082, 2081, 2080, 2079, 2078, 2077, 2076, 2075, 2074, 2073, 2072, 2071, 2070, 2069, 2068, 2067, 2066, 2065, 2064, 2063, 2062, 2061, 2060, 2059, 2058, 2057, 2056, 2055, 2054, 2053, 2052, 2051, 2050, 2049, 2048, 2047, 2046, 2045, 2044, 2043, 2042, 2041, 2040, 2039, 2038, 2037, 2036, 2035, 2034, 2033, 2032, 2031, 2030, 2029, 2028, 2027, 2026, 2025, 2024, 2023, 2022, 2021, 2020, 2019, 2018, 2017, 2016, 2015, 2014, 2013, 2012, 2011, 2010, 2009, 2008, 2007, 2006, 2005, 2004, 2003, 2002, 2001, 2000, 1999, 1998, 1997, 1996, 1995, 1994, 1993, 1992, 1991, 1990, 1989, 1988, 1987, 1986, 1985, 1984, 1983, 1982, 1981, 1980, 1979, 1978, 1977, 1976, 1975, 1974, 1973, 1972, 1971, 1970, 1969, 1968, 1967, 1966, 1965, 1964, 1963, 1962, 1961, 1960, 1959, 1958, 1957, 1956, 1955, 1954, 1953, 1952, 1951, 1950, 1949, 1948, 1947, 1946, 1945, 1944, 1943, 1942, 1941, 1940, 1939, 1938, 1937, 1936, 1935, 1934, 1933, 1932, 1931, 1930, 1929, 1928, 1927, 1926, 1925, 1924, 1923, 1922, 1921, 1920, 1919, 1918, 1917, 1916, 1915, 1914, 1913, 1912, 1911, 1910, 1909, 1908, 1907, 1906, 1905, 1904, 1903, 1902, 1901, 1900, 1899, 1898, 1897, 1896, 1895, 1894, 1893, 1892, 1891, 1890, 1889, 1888, 1887, 1886, 1885, 1884, 1883, 1882, 1881, 1880, 1879, 1878, 1877, 1876, 1875, 1874, 1873, 1872, 1871, 1870, 1869, 1868, 1867, 1866, 1865, 1864, 1863, 1862, 1861, 1860, 1859, 1858, 1857, 1856, 1855, 1854, 1853, 1852, 1851, 1850, 1849, 1848, 1847, 1846, 1845, 1844, 1843, 1842, 1841, 1840, 1839, 1838, 1837, 1836, 1835, 1834, 1833, 1832, 1831, 1830, 1829, 1828, 1827, 1826, 1825, 1824, 1823, 1822, 1821, 1820, 1819, 1818, 1817, 1816, 1815, 1814, 1813, 1812, 1811, 1810, 1809, 1808, 1807, 1806, 1805, 1804, 1803, 1802, 1801, 1800, 1799, 1798, 1797, 1796, 1795, 1794, 1793, 1792, 1791, 1790, 1789, 1788, 1787, 1786, 1785, 1784, 1783, 1782, 1781, 1780, 1779, 1778, 1777, 1776, 1775, 1774, 1773, 1772, 1771, 1770, 1769, 1768, 1767, 1766, 1765, 1764, 1763, 1762, 1761, 1760, 1759, 1758, 1757, 1756, 1755, 1754, 1753, 1752, 1751, 1750, 1749, 1748, 1747, 1746, 1745, 1744, 1743, 1742, 1741, 1740, 1739, 1738, 1737, 1736, 1735, 1734, 1733, 1732, 1731, 1730, 1729, 1728, 1727, 1726, 1725, 1724, 1723, 1722, 1721, 1720, 1719, 1718, 1717, 1716, 1715, 1714, 1713, 1712, 1711, 1710, 1709, 1708, 1707, 1706, 1705, 1704, 1703, 1702, 1701, 1700, 1699, 1698, 1697, 1696, 1695, 1694, 1693, 1692, 1691, 1690, 1689, 1688, 1687, 1686, 1685, 1684, 1683, 1682, 1681, 1680, 1679, 1678, 1677, 1676, 1675, 1674, 1673, 1672, 1671, 1670, 1669, 1668, 1667, 1666, 1665, 1664, 1663, 1662, 1661, 1660, 1659, 1658, 1657, 1656, 1655, 1654, 1653, 1652, 1651, 1650, 1649, 1648, 1647, 1646, 1645, 1644, 1643, 1642, 1641, 1640, 1639, 1638, 1637, 1636, 1635, 1634, 1633, 1632, 1631, 1630, 1629, 1628, 1627, 1626, 1625, 1624, 1623, 1622, 1621, 1620, 1619, 1618, 1617, 1616, 1615, 1614, 1613, 1612, 1611, 1610, 1609, 1608, 1607, 1606, 1605, 1604, 1603, 1602, 1601, 1600, 1599, 1598, 1597, 1596, 1595, 1594, 1593, 1592, 1591, 1590, 1589, 1588, 1587, 1586, 1585, 1584, 1583, 1582, 1581, 1580, 1579, 1578, 1577, 1576, 1575, 1574, 1573, 1572, 1571, 1570, 1569, 1568, 1567, 1566, 1565, 1564, 1563, 1562, 1561, 1560, 1559, 1558, 1557, 1556, 1555, 1554, 1553, 1552, 1551, 1550, 1549, 1548, 1547, 1546, 1545, 1544, 1543, 1542, 1541, 1540, 1539, 1538, 1537, 1536, 1535, 1534, 1533, 1532, 1531, 1530, 1529, 1528, 1527, 1526, 1525, 1524, 1523, 1522, 1521, 1520, 1519, 1518, 1517, 1516, 1515, 1514, 1513, 1512, 1511, 1510, 1509, 1508, 1507, 1506, 1505, 1504, 1503, 1502, 1501, 1500, 1499, 1498, 1497, 1496, 1495, 1494, 1493, 1492, 1491, 1490, 1489, 1488, 1487, 1486, 1485, 1484, 1483, 1482, 1481, 1480, 1479, 1478, 1477, 1476, 1475, 1474, 1473, 1472, 1471, 1470, 1469, 1468, 1467, 1466, 1465, 1464, 1463, 1462, 1461, 1460, 1459, 1458, 1457, 1456, 1455, 1454, 1453, 1452, 1451, 1450, 1449, 1448, 1447, 1446, 1445, 1444, 1443, 1442, 1441, 1440, 1439, 1438, 1437, 1436, 1435, 1434, 1433, 1432, 1431, 1430, 1429, 1428, 1427, 1426, 1425, 1424, 1423, 1422, 1421, 1420, 1419, 1418, 1417, 1416, 1415, 1414, 1413, 1412, 1411, 1410, 1409, 1408, 1407, 1406, 1405, 1404, 1403, 1402, 1401, 1400, 1399, 1398, 1397, 1396, 1395, 1394, 1393, 1392, 1391, 1390, 1389, 1388, 1387, 1386, 1385, 1384, 1383, 1382, 1381, 1380, 1379, 1378, 1377, 1376, 1375, 1374, 1373, 1372, 1371, 1370, 1369, 1368, 1367, 1366, 1365, 1364, 1363, 1362, 1361, 1360, 1359, 1358, 1357, 1356, 1355, 1354, 1353, 1352, 1351, 1350, 1349, 1348, 1347, 1346, 1345, 1344, 1343, 1342, 1341, 1340, 1339, 1338, 1337, 1336, 1335, 1334, 1333, 1332, 1331, 1330, 1329, 1328, 1327, 1326, 1325, 1324, 1323, 1322, 1321, 1320, 1319, 1318, 1317, 1316, 1315, 1314, 1313, 1312, 1311, 1310, 1309, 1308, 1307, 1306, 1305, 1304, 1303, 1302, 1301, 1300, 1299, 1298, 1297, 1296, 1295, 1294, 1293, 1292, 1291, 1290, 1289, 1288, 1287, 1286, 1285, 1284, 1283, 1282, 1281, 1280, 1279, 1278, 1277, 1276, 1275, 1274, 1273, 1272, 1271, 1270, 1269, 1268, 1267, 1266, 1265, 1264, 1263, 1262, 1261, 1260, 1259, 1258, 1257, 1256, 1255, 1254, 1253, 1252, 1251, 1250, 1249, 1248, 1247, 1246, 1245, 1244, 1243, 1242, 1241, 1240, 1239, 1238, 1237, 1236, 1235, 1234, 1233, 1232, 1231, 1230, 1229, 1228, 1227, 1226, 1225, 1224, 1223, 1222, 1221, 1220, 1219, 1218, 1217, 1216, 1215, 1214, 1213, 1212, 1211, 1210, 1209, 1208, 1207, 1206, 1205, 1204, 1203, 1202, 1201, 1200, 1199, 1198, 1197, 1196, 1195, 1194, 1193, 1192, 1191, 1190, 1189, 1188, 1187, 1186, 1185, 1184, 1183, 1182, 1181, 1180, 1179, 1178, 1177, 1176, 1175, 1174, 1173, 1172, 1171, 1170, 1169, 1168, 1167, 1166, 1165, 1164, 1163, 1162, 1161, 1160, 1159, 1158, 1157, 1156, 1155, 1154, 1153, 1152, 1151, 1150, 1149, 1148, 1147, 1146, 1145, 1144, 1143, 1142, 1141, 1140, 1139, 1138, 1137, 1136, 1135, 1134, 1133, 1132, 1131, 1130, 1129, 1128, 1127, 1126, 1125, 1124, 1123, 1122, 1121, 1120, 1119, 1118, 1117, 1116, 1115, 1114, 1113, 1112, 1111, 1110, 1109, 1108, 1107, 1106, 1105, 1104, 1103, 1102, 1101, 1100, 1099, 1098, 1097, 1096, 1095, 1094, 1093, 1092, 1091, 1090, 1089, 1088, 1087, 1086, 1085, 1084, 1083, 1082, 1081, 1080, 1079, 1078, 1077, 1076, 1075, 1074, 1073, 1072, 1071, 1070, 1069, 1068, 1067, 1066, 1065, 1064, 1063, 1062, 1061, 1060, 1059, 1058, 1057, 1056, 1055, 1054, 1053, 1052, 1051, 1050, 1049, 1048, 1047, 1046, 1045, 1044, 1043, 1042, 1041, 1040, 1039, 1038, 1037, 1036, 1035, 1034, 1033, 1032, 1031, 1030, 1029, 1028, 1027, 1026, 1025, 1024, 1023, 1022, 1021, 1020, 1019, 1018, 1017, 1016, 1015, 1014, 1013, 1012, 1011, 1010, 1009, 1008, 1007, 1006, 1005, 1004, 1003, 1002, 1001, 1000, 999, 998, 997, 996, 995, 994, 993, 992, 991, 990, 989, 988, 987, 986, 985, 984, 983, 982, 981, 980, 979, 978, 977, 976, 975, 974, 973, 972, 971, 970, 969, 968, 967, 966, 965, 964, 963, 962, 961, 960, 959, 958, 957, 956, 955, 954, 953, 952, 951, 950, 949, 948, 947, 946, 945, 944, 943, 942, 941, 940, 939, 938, 937, 936, 935, 934, 933, 932, 931, 930, 929, 928, 927, 926, 925, 924, 923, 922, 921, 920, 919, 918, 917, 916, 915, 914, 913, 912, 911, 910, 909, 908, 907, 906, 905, 904, 903, 902, 901, 900, 899, 898, 897, 896, 895, 894, 893, 892, 891, 890, 889, 888, 887, 886, 885, 884, 883, 882, 881, 880, 879, 878, 877, 876, 875, 874, 873, 872, 871, 870, 869, 868, 867, 866, 865, 864, 863, 862, 861, 860, 859, 858, 857, 856, 855, 854, 853, 852, 851, 850, 849, 848, 847, 846, 845, 844, 843, 842, 841, 840, 839, 838, 837, 836, 835, 834, 833, 832, 831, 830, 829, 828, 827, 826, 825, 824, 823, 822, 821, 820, 819, 818, 817, 816, 815, 814, 813, 812, 811, 810, 809, 808, 807, 806, 805, 804, 803, 802, 801, 800, 799, 798, 797, 796, 795, 794, 793, 792, 791, 790, 789, 788, 787, 786, 785, 784, 783, 782, 781, 780, 779, 778, 777, 776, 775, 774, 773, 772, 771, 770, 769, 768, 767, 766, 765, 764, 763, 762, 761, 760, 759, 758, 757, 756, 755, 754, 753, 752, 751, 750, 749, 748, 747, 746, 745, 744, 743, 742, 741, 740, 739, 738, 737, 736, 735, 734, 733, 732, 731, 730, 729, 728, 727, 726, 725, 724, 723, 722, 721, 720, 719, 718, 717, 716, 715, 714, 713, 712, 711, 710, 709, 708, 707, 706, 705, 704, 703, 702, 701, 700, 699, 698, 697, 696, 695, 694, 693, 692, 691, 690, 689, 688, 687, 686, 685, 684, 683, 682, 681, 680, 679, 678, 677, 676, 675, 674, 673, 672, 671, 670, 669, 668, 667, 666, 665, 664, 663, 662, 661, 660, 659, 658, 657, 656, 655, 654, 653, 652, 651, 650, 649, 648, 647, 646, 645, 644, 643, 642, 641, 640, 639, 638, 637, 636, 635, 634, 633, 632, 631, 630, 629, 628, 627, 626, 625, 624, 623, 622, 621, 620, 619, 618, 617, 616, 615, 614, 613, 612, 611, 610, 609, 608, 607, 606, 605, 604, 603, 602, 601, 600, 599, 598, 597, 596, 595, 594, 593, 592, 591, 590, 589, 588, 587, 586, 585, 584, 583, 582, 581, 580, 579, 578, 577, 576, 575, 574, 573, 572, 571, 570, 569, 568, 567, 566, 565, 564, 563, 562, 561, 560, 559, 558, 557, 556, 555, 554, 553, 552, 551, 550, 549, 548, 547, 546, 545, 544, 543, 542, 541, 540, 539, 538, 537, 536, 535, 534, 533, 532, 531, 530, 529, 528, 527, 526, 525, 524, 523, 522, 521, 520, 519, 518, 517, 516, 515, 514, 513, 512, 511, 510, 509, 508, 507, 506, 505, 504, 503, 502, 501, 500, 499, 498, 497, 496, 495, 494, 493, 492, 491, 490, 489, 488, 487, 486, 485, 484, 483, 482, 481, 480, 479, 478, 477, 476, 475, 474, 473, 472, 471, 470, 469, 468, 467, 466, 465, 464, 463, 462, 461, 460, 459, 458, 457, 456, 455, 454, 453, 452, 451, 450, 449, 448, 447, 446, 445, 444, 443, 442, 441, 440, 439, 438, 437, 436, 435, 434, 433, 432, 431, 430, 429, 428, 427, 426, 425, 424, 423, 422, 421, 420, 419, 418, 417, 416, 415, 414, 413, 412, 411, 410, 409, 408, 407, 406, 405, 404, 403, 402, 401, 400, 399, 398, 397, 396, 395, 394, 393, 392, 391, 390, 389, 388, 387, 386, 385, 384, 383, 382, 381, 380, 379, 378, 377, 376, 375, 374, 373, 372, 371, 370, 369, 368, 367, 366, 365, 364, 363, 362, 361, 360, 359, 358, 357, 356, 355, 354, 353, 352, 351, 350, 349, 348, 347, 346, 345, 344, 343, 342, 341, 340, 339, 338, 337, 336, 335, 334, 333, 332, 331, 330, 329, 328, 327, 326, 325, 324, 323, 322, 321, 320, 319, 318, 317, 316, 315, 314, 313, 312, 311, 310, 309, 308, 307, 306, 305, 304, 303, 302, 301, 300, 299, 298, 297, 296, 295, 294, 293, 292, 291, 290, 289, 288, 287, 286, 285, 284, 283, 282, 281, 280, 279, 278, 277, 276, 275, 274, 273, 272, 271, 270, 269, 268, 267, 266, 265, 264, 263, 262, 261, 260, 259, 258, 257, 256, 255, 254, 253, 252, 251, 250, 249, 248, 247, 246, 245, 244, 243, 242, 241, 240, 239, 238, 237, 236, 235, 234, 233, 232, 231, 230, 229, 228, 227, 226, 225, 224, 223, 222, 221, 220, 219, 218, 217, 216, 215, 214, 213, 212, 211, 210, 209, 208, 207, 206, 205, 204, 203, 202, 201, 200, 199, 198, 197, 196, 195, 194, 193, 192, 191, 190, 189, 188, 187, 186, 185, 184, 183, 182, 181, 180, 179, 178, 177, 176, 175, 174, 173, 172, 171, 170, 169, 168, 167, 166, 165, 164, 163, 162, 161, 160, 159, 158, 157, 156, 155, 154, 153, 152, 151, 150, 149, 148, 147, 146, 145, 144, 143, 142, 141, 140, 139, 138, 137, 136, 135, 134, 133, 132, 131, 130, 129, 128, 127, 126, 125, 124, 123, 122, 121, 120, 119, 118, 117, 116, 115, 114, 113, 112, 111, 110, 109, 108, 107, 106, 105, 104, 103, 102, 101, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1], [1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1], [9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0], [-5000], [5000], [5000, -5000], [0, 0], [1, 0, -1], [9, 5, 1, 4, 1, 3], [2, 3, 4, 5, 6, 7, 8, 9], [-1, -2, -3, -4, -5], [-1, 1, -1, 1, -1, 1], [-5000, -4000, -3000, -2000, -1000, 0, 1000, 2000, 3000, 4000, 5000], [0, 0, 17, 17, 42, 42], [19, 17, 13, 11, 7, 5, 3, 2], [9, 0, -3, 5, -7, 6, -8], [-300, 300, -200, 200, -100, 100], [-4, -3, -2, -1, 0, 1, 2, 3, 4], [99, 88, 77, 66, 55, 44, 33, 22, 11], [-5000, 0, 5000, 0, -5000]], "loose": false}

package/data/problems/reverse-nodes-in-k-group.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "96", "slug": "reverse-nodes-in-k-group", "id": 96, "title": "Reverse Nodes in k-Group", "difficulty": "Hard", "category": "linked-list", "link": "https://leetcode.com/problems/reverse-nodes-in-k-group/", "examples": [{"input": "head = [1,2,3,4,5], k = 2", "output": "[2,1,4,3,5]", "explanation": "Reversing every 2 nodes in the linked list [1,2,3,4,5] gives [2,1,4,3,5]."}, {"input": "head = [1,2,3,4,5], k = 3", "output": "[3,2,1,4,5]", "explanation": "Reversing every 3 nodes in the linked list [1,2,3,4,5] gives [3,2,1,4,5]."}, {"input": "head = [1,2], k = 2", "output": "[2,1]", "explanation": "Reversing every 2 nodes in the linked list [1,2] gives [2,1]."}], "hints": ["Use a dummy node before the head so reconnecting the first reversed group is no different from later groups.", "Before reversing, walk `k` steps to confirm that a complete group remains and remember the node after it.", "Reverse links until reaching the saved next-group node, then reconnect both ends of the group."], "statement": "Take the head of a chain and walk along it flipping each consecutive block of\n`k` nodes, then hand back the head of the reworked chain.\n\nA trailing block shorter than `k` nodes is left exactly as it is. Links may\nbe rewired, but simply exchanging the values held by nodes is not allowed.\n\n**Constraints:**\n\n- The list contains between `1` and `5000` nodes.\n- `0 <= node.val <= 1000`\n- `1 <= k <=` the length of the list\n\n**Follow-up:** Is there a way to accomplish this with only `O(1)` extra memory?\n", "solution": "## Approach\n\nPlace a dummy node before the list. For each group, first locate its kth node; if fewer than `k` nodes remain, return. Otherwise reverse links up to the saved next-group node, reconnect both ends, and continue from the old group start.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n), since every node is visited a constant number of times.\n- **Space Complexity:** O(1).\n\n## Implementation\n\n```python\nclass Solution:\n def reverseKGroup(self, head, k: int):\n dummy = ListNode(0, head)\n group_previous = dummy\n\n while True:\n kth = group_previous\n for _ in range(k):\n kth = kth.next\n if kth is None:\n return dummy.next\n\n group_next = kth.next\n previous = group_next\n current = group_previous.next\n while current is not group_next:\n following = current.next\n current.next = previous\n previous = current\n current = following\n\n old_start = group_previous.next\n group_previous.next = kth\n group_previous = old_start\n```\n", "starter": {"go": "package main\n\n/*\nDefinition for singly-linked list.\ntype ListNode struct {\n Val int\n Next *ListNode\n}\n*/\n\nfunc ReverseKGroup(head *ListNode, k int) *ListNode {\n return nil\n}", "python": "# Definition for singly-linked list.\n# class ListNode:\n# def __init__(self, val=0, next=None):\n# self.val = val\n# self.next = next\n\nclass Solution:\n def reverseKGroup(self, head, k: int):\n pass\n", "cpp": "/*\nstruct ListNode {\n int val;\n ListNode *next;\n ListNode(): val(0), next(nullptr) {}\n ListNode(int x): val(x), next(nullptr) {}\n ListNode(int x, ListNode* next): val(x), next(next) {}\n};\n*/\nclass Solution {\npublic:\n ListNode* reverseKGroup(ListNode* head, int k) {\n return nullptr;\n }\n};"}, "fn": "reverseKGroup", "params": [{"name": "head", "type": "list_node"}, {"name": "k", "type": "int"}], "outputType": "list_node", "tests": [["[1]", "1"], ["[1,2]", "1"], ["[1,2]", "2"], ["[1,2,3]", "1"], ["[1,2,3]", "2"], ["[1,2,3]", "3"], ["[1,2,3,4]", "2"], ["[1,2,3,4]", "3"], ["[1,2,3,4]", "4"], ["[1,2,3,4,5]", "1"], ["[1,2,3,4,5]", "2"], ["[1,2,3,4,5]", "3"], ["[1,2,3,4,5]", "4"], ["[1,2,3,4,5]", "5"], ["[0,0,0,0,0]", "2"], ["[7,7,7,7,7]", "3"], ["[5,4,3,2,1]", "2"], ["[5,4,3,2,1]", "5"], ["[1000,0]", "2"], ["[2,1,2,1,2,1]", "2"], ["[2,1,2,1,2,1]", "3"], ["[1,2,3,4,5,6]", "2"], ["[1,2,3,4,5,6]", "3"], ["[1,2,3,4,5,6]", "4"], ["[1,2,3,4,5,6]", "5"], ["[1,2,3,4,5,6]", "6"], ["[6,5,4,3,2,1]", "3"], ["[10,20,30,40,50,60]", "4"], ["[1,2,3,4,5,6,7]", "2"], ["[1,2,3,4,5,6,7]", "3"], ["[1,2,3,4,5,6,7]", "4"], ["[1,2,3,4,5,6,7]", "7"], ["[7,6,5,4,3,2,1]", "6"], ["[9,8,7,6,5,4,3]", "5"], ["[1,2,3,4,5,6,7,8]", "2"], ["[1,2,3,4,5,6,7,8]", "3"], ["[1,2,3,4,5,6,7,8]", "4"], ["[1,2,3,4,5,6,7,8]", "5"], ["[1,2,3,4,5,6,7,8]", "8"], ["[8,1,6,2,7,3,5,4]", "3"], ["[0,1,0,1,0,1,0,1]", "4"], ["[1000,999,998,997,996,995,994,993]", "7"], ["[1,2,3,4,5,6,7,8,9]", "2"], ["[1,2,3,4,5,6,7,8,9]", "3"], ["[1,2,3,4,5,6,7,8,9]", "4"], ["[1,2,3,4,5,6,7,8,9]", "5"], ["[1,2,3,4,5,6,7,8,9]", "8"], ["[1,2,3,4,5,6,7,8,9]", "9"], ["[9,9,8,8,7,7,6,6,5]", "2"], ["[3,1,4,1,5,9,2,6,5]", "4"], ["[1,2,3,4,5,6,7,8,9,10]", "3"], ["[1,2,3,4,5,6,7,8,9,10]", "6"], ["[1,2,3,4,5,6,7,8,9,10]", "10"], ["[10,20,30,40,50,60,70,80,90,100]", "4"], ["[0,1000,0,1000,0,1000,0,1000,0,1000]", "5"], ["@javascript:JSON.stringify(Array.from({length:4999},(_,i)=>i%1001))", "4998"], ["@javascript:JSON.stringify(Array.from({length:5000},(_,i)=>1000-(i%1001)))", "5000"]], "expected": [[1], [1, 2], [2, 1], [1, 2, 3], [2, 1, 3], [3, 2, 1], [2, 1, 4, 3], [3, 2, 1, 4], [4, 3, 2, 1], [1, 2, 3, 4, 5], [2, 1, 4, 3, 5], [3, 2, 1, 4, 5], [4, 3, 2, 1, 5], [5, 4, 3, 2, 1], [0, 0, 0, 0, 0], [7, 7, 7, 7, 7], [4, 5, 2, 3, 1], [1, 2, 3, 4, 5], [0, 1000], [1, 2, 1, 2, 1, 2], [2, 1, 2, 1, 2, 1], [2, 1, 4, 3, 6, 5], [3, 2, 1, 6, 5, 4], [4, 3, 2, 1, 5, 6], [5, 4, 3, 2, 1, 6], [6, 5, 4, 3, 2, 1], [4, 5, 6, 1, 2, 3], [40, 30, 20, 10, 50, 60], [2, 1, 4, 3, 6, 5, 7], [3, 2, 1, 6, 5, 4, 7], [4, 3, 2, 1, 5, 6, 7], [7, 6, 5, 4, 3, 2, 1], [2, 3, 4, 5, 6, 7, 1], [5, 6, 7, 8, 9, 4, 3], [2, 1, 4, 3, 6, 5, 8, 7], [3, 2, 1, 6, 5, 4, 7, 8], [4, 3, 2, 1, 8, 7, 6, 5], [5, 4, 3, 2, 1, 6, 7, 8], [8, 7, 6, 5, 4, 3, 2, 1], [6, 1, 8, 3, 7, 2, 5, 4], [1, 0, 1, 0, 1, 0, 1, 0], [994, 995, 996, 997, 998, 999, 1000, 993], [2, 1, 4, 3, 6, 5, 8, 7, 9], [3, 2, 1, 6, 5, 4, 9, 8, 7], [4, 3, 2, 1, 8, 7, 6, 5, 9], [5, 4, 3, 2, 1, 6, 7, 8, 9], [8, 7, 6, 5, 4, 3, 2, 1, 9], [9, 8, 7, 6, 5, 4, 3, 2, 1], [9, 9, 8, 8, 7, 7, 6, 6, 5], [1, 4, 1, 3, 6, 2, 9, 5, 5], [3, 2, 1, 6, 5, 4, 9, 8, 7, 10], [6, 5, 4, 3, 2, 1, 7, 8, 9, 10], [10, 9, 8, 7, 6, 5, 4, 3, 2, 1], [40, 30, 20, 10, 80, 70, 60, 50, 90, 100], [0, 1000, 0, 1000, 0, 1000, 0, 1000, 0, 1000], [993, 992, 991, 990, 989, 988, 987, 986, 985, 984, 983, 982, 981, 980, 979, 978, 977, 976, 975, 974, 973, 972, 971, 970, 969, 968, 967, 966, 965, 964, 963, 962, 961, 960, 959, 958, 957, 956, 955, 954, 953, 952, 951, 950, 949, 948, 947, 946, 945, 944, 943, 942, 941, 940, 939, 938, 937, 936, 935, 934, 933, 932, 931, 930, 929, 928, 927, 926, 925, 924, 923, 922, 921, 920, 919, 918, 917, 916, 915, 914, 913, 912, 911, 910, 909, 908, 907, 906, 905, 904, 903, 902, 901, 900, 899, 898, 897, 896, 895, 894, 893, 892, 891, 890, 889, 888, 887, 886, 885, 884, 883, 882, 881, 880, 879, 878, 877, 876, 875, 874, 873, 872, 871, 870, 869, 868, 867, 866, 865, 864, 863, 862, 861, 860, 859, 858, 857, 856, 855, 854, 853, 852, 851, 850, 849, 848, 847, 846, 845, 844, 843, 842, 841, 840, 839, 838, 837, 836, 835, 834, 833, 832, 831, 830, 829, 828, 827, 826, 825, 824, 823, 822, 821, 820, 819, 818, 817, 816, 815, 814, 813, 812, 811, 810, 809, 808, 807, 806, 805, 804, 803, 802, 801, 800, 799, 798, 797, 796, 795, 794, 793, 792, 791, 790, 789, 788, 787, 786, 785, 784, 783, 782, 781, 780, 779, 778, 777, 776, 775, 774, 773, 772, 771, 770, 769, 768, 767, 766, 765, 764, 763, 762, 761, 760, 759, 758, 757, 756, 755, 754, 753, 752, 751, 750, 749, 748, 747, 746, 745, 744, 743, 742, 741, 740, 739, 738, 737, 736, 735, 734, 733, 732, 731, 730, 729, 728, 727, 726, 725, 724, 723, 722, 721, 720, 719, 718, 717, 716, 715, 714, 713, 712, 711, 710, 709, 708, 707, 706, 705, 704, 703, 702, 701, 700, 699, 698, 697, 696, 695, 694, 693, 692, 691, 690, 689, 688, 687, 686, 685, 684, 683, 682, 681, 680, 679, 678, 677, 676, 675, 674, 673, 672, 671, 670, 669, 668, 667, 666, 665, 664, 663, 662, 661, 660, 659, 658, 657, 656, 655, 654, 653, 652, 651, 650, 649, 648, 647, 646, 645, 644, 643, 642, 641, 640, 639, 638, 637, 636, 635, 634, 633, 632, 631, 630, 629, 628, 627, 626, 625, 624, 623, 622, 621, 620, 619, 618, 617, 616, 615, 614, 613, 612, 611, 610, 609, 608, 607, 606, 605, 604, 603, 602, 601, 600, 599, 598, 597, 596, 595, 594, 593, 592, 591, 590, 589, 588, 587, 586, 585, 584, 583, 582, 581, 580, 579, 578, 577, 576, 575, 574, 573, 572, 571, 570, 569, 568, 567, 566, 565, 564, 563, 562, 561, 560, 559, 558, 557, 556, 555, 554, 553, 552, 551, 550, 549, 548, 547, 546, 545, 544, 543, 542, 541, 540, 539, 538, 537, 536, 535, 534, 533, 532, 531, 530, 529, 528, 527, 526, 525, 524, 523, 522, 521, 520, 519, 518, 517, 516, 515, 514, 513, 512, 511, 510, 509, 508, 507, 506, 505, 504, 503, 502, 501, 500, 499, 498, 497, 496, 495, 494, 493, 492, 491, 490, 489, 488, 487, 486, 485, 484, 483, 482, 481, 480, 479, 478, 477, 476, 475, 474, 473, 472, 471, 470, 469, 468, 467, 466, 465, 464, 463, 462, 461, 460, 459, 458, 457, 456, 455, 454, 453, 452, 451, 450, 449, 448, 447, 446, 445, 444, 443, 442, 441, 440, 439, 438, 437, 436, 435, 434, 433, 432, 431, 430, 429, 428, 427, 426, 425, 424, 423, 422, 421, 420, 419, 418, 417, 416, 415, 414, 413, 412, 411, 410, 409, 408, 407, 406, 405, 404, 403, 402, 401, 400, 399, 398, 397, 396, 395, 394, 393, 392, 391, 390, 389, 388, 387, 386, 385, 384, 383, 382, 381, 380, 379, 378, 377, 376, 375, 374, 373, 372, 371, 370, 369, 368, 367, 366, 365, 364, 363, 362, 361, 360, 359, 358, 357, 356, 355, 354, 353, 352, 351, 350, 349, 348, 347, 346, 345, 344, 343, 342, 341, 340, 339, 338, 337, 336, 335, 334, 333, 332, 331, 330, 329, 328, 327, 326, 325, 324, 323, 322, 321, 320, 319, 318, 317, 316, 315, 314, 313, 312, 311, 310, 309, 308, 307, 306, 305, 304, 303, 302, 301, 300, 299, 298, 297, 296, 295, 294, 293, 292, 291, 290, 289, 288, 287, 286, 285, 284, 283, 282, 281, 280, 279, 278, 277, 276, 275, 274, 273, 272, 271, 270, 269, 268, 267, 266, 265, 264, 263, 262, 261, 260, 259, 258, 257, 256, 255, 254, 253, 252, 251, 250, 249, 248, 247, 246, 245, 244, 243, 242, 241, 240, 239, 238, 237, 236, 235, 234, 233, 232, 231, 230, 229, 228, 227, 226, 225, 224, 223, 222, 221, 220, 219, 218, 217, 216, 215, 214, 213, 212, 211, 210, 209, 208, 207, 206, 205, 204, 203, 202, 201, 200, 199, 198, 197, 196, 195, 194, 193, 192, 191, 190, 189, 188, 187, 186, 185, 184, 183, 182, 181, 180, 179, 178, 177, 176, 175, 174, 173, 172, 171, 170, 169, 168, 167, 166, 165, 164, 163, 162, 161, 160, 159, 158, 157, 156, 155, 154, 153, 152, 151, 150, 149, 148, 147, 146, 145, 144, 143, 142, 141, 140, 139, 138, 137, 136, 135, 134, 133, 132, 131, 130, 129, 128, 127, 126, 125, 124, 123, 122, 121, 120, 119, 118, 117, 116, 115, 114, 113, 112, 111, 110, 109, 108, 107, 106, 105, 104, 103, 102, 101, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 1000, 999, 998, 997, 996, 995, 994, 993, 992, 991, 990, 989, 988, 987, 986, 985, 984, 983, 982, 981, 980, 979, 978, 977, 976, 975, 974, 973, 972, 971, 970, 969, 968, 967, 966, 965, 964, 963, 962, 961, 960, 959, 958, 957, 956, 955, 954, 953, 952, 951, 950, 949, 948, 947, 946, 945, 944, 943, 942, 941, 940, 939, 938, 937, 936, 935, 934, 933, 932, 931, 930, 929, 928, 927, 926, 925, 924, 923, 922, 921, 920, 919, 918, 917, 916, 915, 914, 913, 912, 911, 910, 909, 908, 907, 906, 905, 904, 903, 902, 901, 900, 899, 898, 897, 896, 895, 894, 893, 892, 891, 890, 889, 888, 887, 886, 885, 884, 883, 882, 881, 880, 879, 878, 877, 876, 875, 874, 873, 872, 871, 870, 869, 868, 867, 866, 865, 864, 863, 862, 861, 860, 859, 858, 857, 856, 855, 854, 853, 852, 851, 850, 849, 848, 847, 846, 845, 844, 843, 842, 841, 840, 839, 838, 837, 836, 835, 834, 833, 832, 831, 830, 829, 828, 827, 826, 825, 824, 823, 822, 821, 820, 819, 818, 817, 816, 815, 814, 813, 812, 811, 810, 809, 808, 807, 806, 805, 804, 803, 802, 801, 800, 799, 798, 797, 796, 795, 794, 793, 792, 791, 790, 789, 788, 787, 786, 785, 784, 783, 782, 781, 780, 779, 778, 777, 776, 775, 774, 773, 772, 771, 770, 769, 768, 767, 766, 765, 764, 763, 762, 761, 760, 759, 758, 757, 756, 755, 754, 753, 752, 751, 750, 749, 748, 747, 746, 745, 744, 743, 742, 741, 740, 739, 738, 737, 736, 735, 734, 733, 732, 731, 730, 729, 728, 727, 726, 725, 724, 723, 722, 721, 720, 719, 718, 717, 716, 715, 714, 713, 712, 711, 710, 709, 708, 707, 706, 705, 704, 703, 702, 701, 700, 699, 698, 697, 696, 695, 694, 693, 692, 691, 690, 689, 688, 687, 686, 685, 684, 683, 682, 681, 680, 679, 678, 677, 676, 675, 674, 673, 672, 671, 670, 669, 668, 667, 666, 665, 664, 663, 662, 661, 660, 659, 658, 657, 656, 655, 654, 653, 652, 651, 650, 649, 648, 647, 646, 645, 644, 643, 642, 641, 640, 639, 638, 637, 636, 635, 634, 633, 632, 631, 630, 629, 628, 627, 626, 625, 624, 623, 622, 621, 620, 619, 618, 617, 616, 615, 614, 613, 612, 611, 610, 609, 608, 607, 606, 605, 604, 603, 602, 601, 600, 599, 598, 597, 596, 595, 594, 593, 592, 591, 590, 589, 588, 587, 586, 585, 584, 583, 582, 581, 580, 579, 578, 577, 576, 575, 574, 573, 572, 571, 570, 569, 568, 567, 566, 565, 564, 563, 562, 561, 560, 559, 558, 557, 556, 555, 554, 553, 552, 551, 550, 549, 548, 547, 546, 545, 544, 543, 542, 541, 540, 539, 538, 537, 536, 535, 534, 533, 532, 531, 530, 529, 528, 527, 526, 525, 524, 523, 522, 521, 520, 519, 518, 517, 516, 515, 514, 513, 512, 511, 510, 509, 508, 507, 506, 505, 504, 503, 502, 501, 500, 499, 498, 497, 496, 495, 494, 493, 492, 491, 490, 489, 488, 487, 486, 485, 484, 483, 482, 481, 480, 479, 478, 477, 476, 475, 474, 473, 472, 471, 470, 469, 468, 467, 466, 465, 464, 463, 462, 461, 460, 459, 458, 457, 456, 455, 454, 453, 452, 451, 450, 449, 448, 447, 446, 445, 444, 443, 442, 441, 440, 439, 438, 437, 436, 435, 434, 433, 432, 431, 430, 429, 428, 427, 426, 425, 424, 423, 422, 421, 420, 419, 418, 417, 416, 415, 414, 413, 412, 411, 410, 409, 408, 407, 406, 405, 404, 403, 402, 401, 400, 399, 398, 397, 396, 395, 394, 393, 392, 391, 390, 389, 388, 387, 386, 385, 384, 383, 382, 381, 380, 379, 378, 377, 376, 375, 374, 373, 372, 371, 370, 369, 368, 367, 366, 365, 364, 363, 362, 361, 360, 359, 358, 357, 356, 355, 354, 353, 352, 351, 350, 349, 348, 347, 346, 345, 344, 343, 342, 341, 340, 339, 338, 337, 336, 335, 334, 333, 332, 331, 330, 329, 328, 327, 326, 325, 324, 323, 322, 321, 320, 319, 318, 317, 316, 315, 314, 313, 312, 311, 310, 309, 308, 307, 306, 305, 304, 303, 302, 301, 300, 299, 298, 297, 296, 295, 294, 293, 292, 291, 290, 289, 288, 287, 286, 285, 284, 283, 282, 281, 280, 279, 278, 277, 276, 275, 274, 273, 272, 271, 270, 269, 268, 267, 266, 265, 264, 263, 262, 261, 260, 259, 258, 257, 256, 255, 254, 253, 252, 251, 250, 249, 248, 247, 246, 245, 244, 243, 242, 241, 240, 239, 238, 237, 236, 235, 234, 233, 232, 231, 230, 229, 228, 227, 226, 225, 224, 223, 222, 221, 220, 219, 218, 217, 216, 215, 214, 213, 212, 211, 210, 209, 208, 207, 206, 205, 204, 203, 202, 201, 200, 199, 198, 197, 196, 195, 194, 193, 192, 191, 190, 189, 188, 187, 186, 185, 184, 183, 182, 181, 180, 179, 178, 177, 176, 175, 174, 173, 172, 171, 170, 169, 168, 167, 166, 165, 164, 163, 162, 161, 160, 159, 158, 157, 156, 155, 154, 153, 152, 151, 150, 149, 148, 147, 146, 145, 144, 143, 142, 141, 140, 139, 138, 137, 136, 135, 134, 133, 132, 131, 130, 129, 128, 127, 126, 125, 124, 123, 122, 121, 120, 119, 118, 117, 116, 115, 114, 113, 112, 111, 110, 109, 108, 107, 106, 105, 104, 103, 102, 101, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 1000, 999, 998, 997, 996, 995, 994, 993, 992, 991, 990, 989, 988, 987, 986, 985, 984, 983, 982, 981, 980, 979, 978, 977, 976, 975, 974, 973, 972, 971, 970, 969, 968, 967, 966, 965, 964, 963, 962, 961, 960, 959, 958, 957, 956, 955, 954, 953, 952, 951, 950, 949, 948, 947, 946, 945, 944, 943, 942, 941, 940, 939, 938, 937, 936, 935, 934, 933, 932, 931, 930, 929, 928, 927, 926, 925, 924, 923, 922, 921, 920, 919, 918, 917, 916, 915, 914, 913, 912, 911, 910, 909, 908, 907, 906, 905, 904, 903, 902, 901, 900, 899, 898, 897, 896, 895, 894, 893, 892, 891, 890, 889, 888, 887, 886, 885, 884, 883, 882, 881, 880, 879, 878, 877, 876, 875, 874, 873, 872, 871, 870, 869, 868, 867, 866, 865, 864, 863, 862, 861, 860, 859, 858, 857, 856, 855, 854, 853, 852, 851, 850, 849, 848, 847, 846, 845, 844, 843, 842, 841, 840, 839, 838, 837, 836, 835, 834, 833, 832, 831, 830, 829, 828, 827, 826, 825, 824, 823, 822, 821, 820, 819, 818, 817, 816, 815, 814, 813, 812, 811, 810, 809, 808, 807, 806, 805, 804, 803, 802, 801, 800, 799, 798, 797, 796, 795, 794, 793, 792, 791, 790, 789, 788, 787, 786, 785, 784, 783, 782, 781, 780, 779, 778, 777, 776, 775, 774, 773, 772, 771, 770, 769, 768, 767, 766, 765, 764, 763, 762, 761, 760, 759, 758, 757, 756, 755, 754, 753, 752, 751, 750, 749, 748, 747, 746, 745, 744, 743, 742, 741, 740, 739, 738, 737, 736, 735, 734, 733, 732, 731, 730, 729, 728, 727, 726, 725, 724, 723, 722, 721, 720, 719, 718, 717, 716, 715, 714, 713, 712, 711, 710, 709, 708, 707, 706, 705, 704, 703, 702, 701, 700, 699, 698, 697, 696, 695, 694, 693, 692, 691, 690, 689, 688, 687, 686, 685, 684, 683, 682, 681, 680, 679, 678, 677, 676, 675, 674, 673, 672, 671, 670, 669, 668, 667, 666, 665, 664, 663, 662, 661, 660, 659, 658, 657, 656, 655, 654, 653, 652, 651, 650, 649, 648, 647, 646, 645, 644, 643, 642, 641, 640, 639, 638, 637, 636, 635, 634, 633, 632, 631, 630, 629, 628, 627, 626, 625, 624, 623, 622, 621, 620, 619, 618, 617, 616, 615, 614, 613, 612, 611, 610, 609, 608, 607, 606, 605, 604, 603, 602, 601, 600, 599, 598, 597, 596, 595, 594, 593, 592, 591, 590, 589, 588, 587, 586, 585, 584, 583, 582, 581, 580, 579, 578, 577, 576, 575, 574, 573, 572, 571, 570, 569, 568, 567, 566, 565, 564, 563, 562, 561, 560, 559, 558, 557, 556, 555, 554, 553, 552, 551, 550, 549, 548, 547, 546, 545, 544, 543, 542, 541, 540, 539, 538, 537, 536, 535, 534, 533, 532, 531, 530, 529, 528, 527, 526, 525, 524, 523, 522, 521, 520, 519, 518, 517, 516, 515, 514, 513, 512, 511, 510, 509, 508, 507, 506, 505, 504, 503, 502, 501, 500, 499, 498, 497, 496, 495, 494, 493, 492, 491, 490, 489, 488, 487, 486, 485, 484, 483, 482, 481, 480, 479, 478, 477, 476, 475, 474, 473, 472, 471, 470, 469, 468, 467, 466, 465, 464, 463, 462, 461, 460, 459, 458, 457, 456, 455, 454, 453, 452, 451, 450, 449, 448, 447, 446, 445, 444, 443, 442, 441, 440, 439, 438, 437, 436, 435, 434, 433, 432, 431, 430, 429, 428, 427, 426, 425, 424, 423, 422, 421, 420, 419, 418, 417, 416, 415, 414, 413, 412, 411, 410, 409, 408, 407, 406, 405, 404, 403, 402, 401, 400, 399, 398, 397, 396, 395, 394, 393, 392, 391, 390, 389, 388, 387, 386, 385, 384, 383, 382, 381, 380, 379, 378, 377, 376, 375, 374, 373, 372, 371, 370, 369, 368, 367, 366, 365, 364, 363, 362, 361, 360, 359, 358, 357, 356, 355, 354, 353, 352, 351, 350, 349, 348, 347, 346, 345, 344, 343, 342, 341, 340, 339, 338, 337, 336, 335, 334, 333, 332, 331, 330, 329, 328, 327, 326, 325, 324, 323, 322, 321, 320, 319, 318, 317, 316, 315, 314, 313, 312, 311, 310, 309, 308, 307, 306, 305, 304, 303, 302, 301, 300, 299, 298, 297, 296, 295, 294, 293, 292, 291, 290, 289, 288, 287, 286, 285, 284, 283, 282, 281, 280, 279, 278, 277, 276, 275, 274, 273, 272, 271, 270, 269, 268, 267, 266, 265, 264, 263, 262, 261, 260, 259, 258, 257, 256, 255, 254, 253, 252, 251, 250, 249, 248, 247, 246, 245, 244, 243, 242, 241, 240, 239, 238, 237, 236, 235, 234, 233, 232, 231, 230, 229, 228, 227, 226, 225, 224, 223, 222, 221, 220, 219, 218, 217, 216, 215, 214, 213, 212, 211, 210, 209, 208, 207, 206, 205, 204, 203, 202, 201, 200, 199, 198, 197, 196, 195, 194, 193, 192, 191, 190, 189, 188, 187, 186, 185, 184, 183, 182, 181, 180, 179, 178, 177, 176, 175, 174, 173, 172, 171, 170, 169, 168, 167, 166, 165, 164, 163, 162, 161, 160, 159, 158, 157, 156, 155, 154, 153, 152, 151, 150, 149, 148, 147, 146, 145, 144, 143, 142, 141, 140, 139, 138, 137, 136, 135, 134, 133, 132, 131, 130, 129, 128, 127, 126, 125, 124, 123, 122, 121, 120, 119, 118, 117, 116, 115, 114, 113, 112, 111, 110, 109, 108, 107, 106, 105, 104, 103, 102, 101, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 1000, 999, 998, 997, 996, 995, 994, 993, 992, 991, 990, 989, 988, 987, 986, 985, 984, 983, 982, 981, 980, 979, 978, 977, 976, 975, 974, 973, 972, 971, 970, 969, 968, 967, 966, 965, 964, 963, 962, 961, 960, 959, 958, 957, 956, 955, 954, 953, 952, 951, 950, 949, 948, 947, 946, 945, 944, 943, 942, 941, 940, 939, 938, 937, 936, 935, 934, 933, 932, 931, 930, 929, 928, 927, 926, 925, 924, 923, 922, 921, 920, 919, 918, 917, 916, 915, 914, 913, 912, 911, 910, 909, 908, 907, 906, 905, 904, 903, 902, 901, 900, 899, 898, 897, 896, 895, 894, 893, 892, 891, 890, 889, 888, 887, 886, 885, 884, 883, 882, 881, 880, 879, 878, 877, 876, 875, 874, 873, 872, 871, 870, 869, 868, 867, 866, 865, 864, 863, 862, 861, 860, 859, 858, 857, 856, 855, 854, 853, 852, 851, 850, 849, 848, 847, 846, 845, 844, 843, 842, 841, 840, 839, 838, 837, 836, 835, 834, 833, 832, 831, 830, 829, 828, 827, 826, 825, 824, 823, 822, 821, 820, 819, 818, 817, 816, 815, 814, 813, 812, 811, 810, 809, 808, 807, 806, 805, 804, 803, 802, 801, 800, 799, 798, 797, 796, 795, 794, 793, 792, 791, 790, 789, 788, 787, 786, 785, 784, 783, 782, 781, 780, 779, 778, 777, 776, 775, 774, 773, 772, 771, 770, 769, 768, 767, 766, 765, 764, 763, 762, 761, 760, 759, 758, 757, 756, 755, 754, 753, 752, 751, 750, 749, 748, 747, 746, 745, 744, 743, 742, 741, 740, 739, 738, 737, 736, 735, 734, 733, 732, 731, 730, 729, 728, 727, 726, 725, 724, 723, 722, 721, 720, 719, 718, 717, 716, 715, 714, 713, 712, 711, 710, 709, 708, 707, 706, 705, 704, 703, 702, 701, 700, 699, 698, 697, 696, 695, 694, 693, 692, 691, 690, 689, 688, 687, 686, 685, 684, 683, 682, 681, 680, 679, 678, 677, 676, 675, 674, 673, 672, 671, 670, 669, 668, 667, 666, 665, 664, 663, 662, 661, 660, 659, 658, 657, 656, 655, 654, 653, 652, 651, 650, 649, 648, 647, 646, 645, 644, 643, 642, 641, 640, 639, 638, 637, 636, 635, 634, 633, 632, 631, 630, 629, 628, 627, 626, 625, 624, 623, 622, 621, 620, 619, 618, 617, 616, 615, 614, 613, 612, 611, 610, 609, 608, 607, 606, 605, 604, 603, 602, 601, 600, 599, 598, 597, 596, 595, 594, 593, 592, 591, 590, 589, 588, 587, 586, 585, 584, 583, 582, 581, 580, 579, 578, 577, 576, 575, 574, 573, 572, 571, 570, 569, 568, 567, 566, 565, 564, 563, 562, 561, 560, 559, 558, 557, 556, 555, 554, 553, 552, 551, 550, 549, 548, 547, 546, 545, 544, 543, 542, 541, 540, 539, 538, 537, 536, 535, 534, 533, 532, 531, 530, 529, 528, 527, 526, 525, 524, 523, 522, 521, 520, 519, 518, 517, 516, 515, 514, 513, 512, 511, 510, 509, 508, 507, 506, 505, 504, 503, 502, 501, 500, 499, 498, 497, 496, 495, 494, 493, 492, 491, 490, 489, 488, 487, 486, 485, 484, 483, 482, 481, 480, 479, 478, 477, 476, 475, 474, 473, 472, 471, 470, 469, 468, 467, 466, 465, 464, 463, 462, 461, 460, 459, 458, 457, 456, 455, 454, 453, 452, 451, 450, 449, 448, 447, 446, 445, 444, 443, 442, 441, 440, 439, 438, 437, 436, 435, 434, 433, 432, 431, 430, 429, 428, 427, 426, 425, 424, 423, 422, 421, 420, 419, 418, 417, 416, 415, 414, 413, 412, 411, 410, 409, 408, 407, 406, 405, 404, 403, 402, 401, 400, 399, 398, 397, 396, 395, 394, 393, 392, 391, 390, 389, 388, 387, 386, 385, 384, 383, 382, 381, 380, 379, 378, 377, 376, 375, 374, 373, 372, 371, 370, 369, 368, 367, 366, 365, 364, 363, 362, 361, 360, 359, 358, 357, 356, 355, 354, 353, 352, 351, 350, 349, 348, 347, 346, 345, 344, 343, 342, 341, 340, 339, 338, 337, 336, 335, 334, 333, 332, 331, 330, 329, 328, 327, 326, 325, 324, 323, 322, 321, 320, 319, 318, 317, 316, 315, 314, 313, 312, 311, 310, 309, 308, 307, 306, 305, 304, 303, 302, 301, 300, 299, 298, 297, 296, 295, 294, 293, 292, 291, 290, 289, 288, 287, 286, 285, 284, 283, 282, 281, 280, 279, 278, 277, 276, 275, 274, 273, 272, 271, 270, 269, 268, 267, 266, 265, 264, 263, 262, 261, 260, 259, 258, 257, 256, 255, 254, 253, 252, 251, 250, 249, 248, 247, 246, 245, 244, 243, 242, 241, 240, 239, 238, 237, 236, 235, 234, 233, 232, 231, 230, 229, 228, 227, 226, 225, 224, 223, 222, 221, 220, 219, 218, 217, 216, 215, 214, 213, 212, 211, 210, 209, 208, 207, 206, 205, 204, 203, 202, 201, 200, 199, 198, 197, 196, 195, 194, 193, 192, 191, 190, 189, 188, 187, 186, 185, 184, 183, 182, 181, 180, 179, 178, 177, 176, 175, 174, 173, 172, 171, 170, 169, 168, 167, 166, 165, 164, 163, 162, 161, 160, 159, 158, 157, 156, 155, 154, 153, 152, 151, 150, 149, 148, 147, 146, 145, 144, 143, 142, 141, 140, 139, 138, 137, 136, 135, 134, 133, 132, 131, 130, 129, 128, 127, 126, 125, 124, 123, 122, 121, 120, 119, 118, 117, 116, 115, 114, 113, 112, 111, 110, 109, 108, 107, 106, 105, 104, 103, 102, 101, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 1000, 999, 998, 997, 996, 995, 994, 993, 992, 991, 990, 989, 988, 987, 986, 985, 984, 983, 982, 981, 980, 979, 978, 977, 976, 975, 974, 973, 972, 971, 970, 969, 968, 967, 966, 965, 964, 963, 962, 961, 960, 959, 958, 957, 956, 955, 954, 953, 952, 951, 950, 949, 948, 947, 946, 945, 944, 943, 942, 941, 940, 939, 938, 937, 936, 935, 934, 933, 932, 931, 930, 929, 928, 927, 926, 925, 924, 923, 922, 921, 920, 919, 918, 917, 916, 915, 914, 913, 912, 911, 910, 909, 908, 907, 906, 905, 904, 903, 902, 901, 900, 899, 898, 897, 896, 895, 894, 893, 892, 891, 890, 889, 888, 887, 886, 885, 884, 883, 882, 881, 880, 879, 878, 877, 876, 875, 874, 873, 872, 871, 870, 869, 868, 867, 866, 865, 864, 863, 862, 861, 860, 859, 858, 857, 856, 855, 854, 853, 852, 851, 850, 849, 848, 847, 846, 845, 844, 843, 842, 841, 840, 839, 838, 837, 836, 835, 834, 833, 832, 831, 830, 829, 828, 827, 826, 825, 824, 823, 822, 821, 820, 819, 818, 817, 816, 815, 814, 813, 812, 811, 810, 809, 808, 807, 806, 805, 804, 803, 802, 801, 800, 799, 798, 797, 796, 795, 794, 793, 792, 791, 790, 789, 788, 787, 786, 785, 784, 783, 782, 781, 780, 779, 778, 777, 776, 775, 774, 773, 772, 771, 770, 769, 768, 767, 766, 765, 764, 763, 762, 761, 760, 759, 758, 757, 756, 755, 754, 753, 752, 751, 750, 749, 748, 747, 746, 745, 744, 743, 742, 741, 740, 739, 738, 737, 736, 735, 734, 733, 732, 731, 730, 729, 728, 727, 726, 725, 724, 723, 722, 721, 720, 719, 718, 717, 716, 715, 714, 713, 712, 711, 710, 709, 708, 707, 706, 705, 704, 703, 702, 701, 700, 699, 698, 697, 696, 695, 694, 693, 692, 691, 690, 689, 688, 687, 686, 685, 684, 683, 682, 681, 680, 679, 678, 677, 676, 675, 674, 673, 672, 671, 670, 669, 668, 667, 666, 665, 664, 663, 662, 661, 660, 659, 658, 657, 656, 655, 654, 653, 652, 651, 650, 649, 648, 647, 646, 645, 644, 643, 642, 641, 640, 639, 638, 637, 636, 635, 634, 633, 632, 631, 630, 629, 628, 627, 626, 625, 624, 623, 622, 621, 620, 619, 618, 617, 616, 615, 614, 613, 612, 611, 610, 609, 608, 607, 606, 605, 604, 603, 602, 601, 600, 599, 598, 597, 596, 595, 594, 593, 592, 591, 590, 589, 588, 587, 586, 585, 584, 583, 582, 581, 580, 579, 578, 577, 576, 575, 574, 573, 572, 571, 570, 569, 568, 567, 566, 565, 564, 563, 562, 561, 560, 559, 558, 557, 556, 555, 554, 553, 552, 551, 550, 549, 548, 547, 546, 545, 544, 543, 542, 541, 540, 539, 538, 537, 536, 535, 534, 533, 532, 531, 530, 529, 528, 527, 526, 525, 524, 523, 522, 521, 520, 519, 518, 517, 516, 515, 514, 513, 512, 511, 510, 509, 508, 507, 506, 505, 504, 503, 502, 501, 500, 499, 498, 497, 496, 495, 494, 493, 492, 491, 490, 489, 488, 487, 486, 485, 484, 483, 482, 481, 480, 479, 478, 477, 476, 475, 474, 473, 472, 471, 470, 469, 468, 467, 466, 465, 464, 463, 462, 461, 460, 459, 458, 457, 456, 455, 454, 453, 452, 451, 450, 449, 448, 447, 446, 445, 444, 443, 442, 441, 440, 439, 438, 437, 436, 435, 434, 433, 432, 431, 430, 429, 428, 427, 426, 425, 424, 423, 422, 421, 420, 419, 418, 417, 416, 415, 414, 413, 412, 411, 410, 409, 408, 407, 406, 405, 404, 403, 402, 401, 400, 399, 398, 397, 396, 395, 394, 393, 392, 391, 390, 389, 388, 387, 386, 385, 384, 383, 382, 381, 380, 379, 378, 377, 376, 375, 374, 373, 372, 371, 370, 369, 368, 367, 366, 365, 364, 363, 362, 361, 360, 359, 358, 357, 356, 355, 354, 353, 352, 351, 350, 349, 348, 347, 346, 345, 344, 343, 342, 341, 340, 339, 338, 337, 336, 335, 334, 333, 332, 331, 330, 329, 328, 327, 326, 325, 324, 323, 322, 321, 320, 319, 318, 317, 316, 315, 314, 313, 312, 311, 310, 309, 308, 307, 306, 305, 304, 303, 302, 301, 300, 299, 298, 297, 296, 295, 294, 293, 292, 291, 290, 289, 288, 287, 286, 285, 284, 283, 282, 281, 280, 279, 278, 277, 276, 275, 274, 273, 272, 271, 270, 269, 268, 267, 266, 265, 264, 263, 262, 261, 260, 259, 258, 257, 256, 255, 254, 253, 252, 251, 250, 249, 248, 247, 246, 245, 244, 243, 242, 241, 240, 239, 238, 237, 236, 235, 234, 233, 232, 231, 230, 229, 228, 227, 226, 225, 224, 223, 222, 221, 220, 219, 218, 217, 216, 215, 214, 213, 212, 211, 210, 209, 208, 207, 206, 205, 204, 203, 202, 201, 200, 199, 198, 197, 196, 195, 194, 193, 192, 191, 190, 189, 188, 187, 186, 185, 184, 183, 182, 181, 180, 179, 178, 177, 176, 175, 174, 173, 172, 171, 170, 169, 168, 167, 166, 165, 164, 163, 162, 161, 160, 159, 158, 157, 156, 155, 154, 153, 152, 151, 150, 149, 148, 147, 146, 145, 144, 143, 142, 141, 140, 139, 138, 137, 136, 135, 134, 133, 132, 131, 130, 129, 128, 127, 126, 125, 124, 123, 122, 121, 120, 119, 118, 117, 116, 115, 114, 113, 112, 111, 110, 109, 108, 107, 106, 105, 104, 103, 102, 101, 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0, 994], [5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1000, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1000, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1000, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1000, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, 961, 962, 963, 964, 965, 966, 967, 968, 969, 970, 971, 972, 973, 974, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, 987, 988, 989, 990, 991, 992, 993, 994, 995, 996, 997, 998, 999, 1000]], "loose": false}

package/data/problems/reverse-only-letters.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "905", "slug": "reverse-only-letters", "id": 905, "title": "Reverse Only Letters", "difficulty": "Easy", "category": "string", "link": "https://leetcode.com/problems/reverse-only-letters/", "examples": [{"input": "s = \"ab-cd\"", "output": "\"dc-ba\"", "explanation": "The letters reverse to d, c, b, a while the dash stays in place."}, {"input": "s = \"a-bC-dEf-ghIj\"", "output": "\"j-Ih-gfE-dCba\"", "explanation": "Reading the letters backwards gives j, I, h, g, f, E, d, C, b, a; dashes keep their spots."}, {"input": "s = \"Test1ng-Leet=code-Q!\"", "output": "\"Qedo1ct-eeLg=ntse-T!\"", "explanation": "Only English letters move; digits and punctuation never shift."}], "hints": ["Walk in from both ends, skipping anything that is not an English letter.", "Whenever both pointers sit on letters, swap them and move inward.", "Non-letters are never moved, so they automatically end up where they started."], "statement": "You are given a string `s`. Reverse only its English letters (`a` to `z` and `A` to `Z`): every other character (digits, punctuation, spaces) must remain exactly where it is, while the letters appear in reverse order in the letter positions.\n\nReturn the resulting string.\n\n**Constraints:**\n- `1 <= s.length <= 100`\n- `s` consists of printable ASCII characters\n", "solution": "## Approach\n\nUse two pointers starting at opposite ends. Advance either pointer past non-letters, and swap whenever both point at letters. Each position is visited once, letters land in reverse order, and everything else is untouched.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n) for a string of length n.\n- **Space Complexity:** O(n) for the mutable character array (O(1) besides the output).\n\n## Implementation\n\n```python\nclass Solution:\n def reverseOnlyLetters(self, s: str) -> str:\n def is_letter(c: str) -> bool:\n return ('a' <= c <= 'z') or ('A' <= c <= 'Z')\n a = list(s)\n i, j = 0, len(a) - 1\n while i < j:\n if not is_letter(a[i]):\n i += 1\n elif not is_letter(a[j]):\n j -= 1\n else:\n a[i], a[j] = a[j], a[i]\n i += 1\n j -= 1\n return \"\".join(a)\n```\n", "starter": {"go": "package main\n\nfunc ReverseOnlyLetters(s string) string {\n \n}", "python": "class Solution:\n def reverseOnlyLetters(self, s: str) -> str:\n pass", "cpp": "#include <string>\nusing namespace std;\nclass Solution {\npublic:\n string reverseOnlyLetters(string s) {\n return \"\";\n }\n};"}, "fn": "reverseOnlyLetters", "params": [{"name": "s", "type": "string"}], "outputType": "string", "tests": [["ab-cd"], ["a-bC-dEf-ghIj"], ["Test1ng-Leet=code-Q!"], ["abcd"], ["ABCD"], ["a"], ["Z"], ["-"], ["123"], ["a-b"], ["--a--"], ["Hello, World!"], ["xyz"], ["a1b2c3"], ["!@#"], ["Aa"], ["aB"], ["qwerty"], ["QWERTY"], ["a.b,c"], ["(a(b)c)"], ["1a"], ["a1"], ["Ab-Cd-Ef"], [" "], ["a b c"], ["MnOpQr-StUv"], ["z-Z_z"]], "expected": ["dc-ba", "j-Ih-gfE-dCba", "Qedo1ct-eeLg=ntse-T!", "dcba", "DCBA", "a", "Z", "-", "123", "b-a", "--a--", "dlroW, olleH!", "zyx", "c1b2a3", "!@#", "aA", "Ba", "ytrewq", "YTREWQ", "c.b,a", "(c(b)a)", "1a", "a1", "fE-dC-bA", " ", "c b a", "vUtSrQ-pOnM", "z-Z_z"], "loose": false}

package/data/problems/reverse-pairs.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "557", "slug": "reverse-pairs", "id": 557, "title": "Reverse Pairs", "difficulty": "Hard", "category": "array", "link": "https://leetcode.com/problems/reverse-pairs/", "examples": [{"input": "nums = [1,3,2,3,1]", "output": "2", "explanation": "Two index pairs satisfy the greater-than-twice rule."}, {"input": "nums = [2,4,3,5,1]", "output": "3", "explanation": "Three index pairs satisfy the rule."}], "hints": ["A modified merge sort can count cross pairs while sorting: both halves are sorted, so one linear scan counts for each left element.", "Compare with long (64-bit) values because doubling a 32-bit integer may overflow.", "The naive double loop is quadratic; divide and conquer brings it to O(n log n)."], "statement": "Consider all index pairs `(i, j)` with `i < j` in an integer list. Call such a pair reversed when the earlier value is larger than twice the later value, that is `nums[i] > 2 * nums[j]`.\n\nCount how many reversed pairs the list contains and return that total.\n\n**Constraints:**\n- `1 <= nums.length <= 5 * 10^4`\n- `-2^31 <= nums[i] <= 2^31 - 1`\n- Use 64-bit arithmetic when doubling to avoid overflow\n", "solution": "## Approach\n\nSort-and-count with merge sort handles the quadratic bottleneck. After recursively sorting both halves, the right half is in order, so a single moving pointer counts for each left element how many right elements satisfy `left > 2*right`. A standard merge then keeps the segment sorted for upper levels. All doubling uses Python integers (unbounded) so overflow is impossible.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n log n) for the divide-and-conquer counting and merging.\n- **Space Complexity:** O(n) for the temporary merge buffer.\n\n## Implementation\n\n```python\nfrom typing import List\n\nclass Solution:\n def reversePairs(self, nums: List[int]) -> int:\n a = list(nums)\n\n def sort_count(l: int, r: int) -> int:\n if l >= r:\n return 0\n m = (l + r) // 2\n cnt = sort_count(l, m) + sort_count(m + 1, r)\n j = m + 1\n for i in range(l, m + 1):\n while j <= r and a[i] > 2 * a[j]:\n j += 1\n cnt += j - (m + 1)\n tmp = []\n i, k = l, m + 1\n while i <= m and k <= r:\n if a[i] <= a[k]:\n tmp.append(a[i])\n i += 1\n else:\n tmp.append(a[k])\n k += 1\n while i <= m:\n tmp.append(a[i])\n i += 1\n while k <= r:\n tmp.append(a[k])\n k += 1\n a[l:r + 1] = tmp\n return cnt\n\n if not a:\n return 0\n return sort_count(0, len(a) - 1)\n```\n", "starter": {"go": "package main\n\nfunc ReversePairs(nums []int) int {\n \n}", "python": "from typing import List\nclass Solution:\n def reversePairs(self, nums: List[int]) -> int:\n pass\n", "cpp": "#include <vector>\nusing namespace std;\nclass Solution {\npublic:\n int reversePairs(vector<int>& nums) {\n return 0;\n }\n};"}, "fn": "reversePairs", "params": [{"name": "nums", "type": "int_array"}], "outputType": "int", "tests": [["[1,3,2,3,1]"], ["[2,4,3,5,1]"], ["[1,2,3,4,5]"], ["[5,4,3,2,1]"], ["[1]"], ["[1,1,1,1]"], ["[2,2,2,2]"], ["[-5,-5]"], ["[0,0,0]"], ["[2147483647,-2147483648]"], ["[-2147483648,-2147483648]"], ["[2147483647,2147483647]"], ["[1,2]"], ["[2,1]"], ["[3,1]"], ["[4,1,2,3]"], ["[5,1,5,1]"], ["[1,3,5,7,2,4,6,8]"], ["[8,7,6,5,4,3,2,1]"], ["[-1,-2,-3]"], ["[0,1,-1,2,-2]"], ["[1000000000,1,1000000000,1]"], ["[2,4,6,1,3,5]"], ["[1,10,2,9,3,8,4,7]"], ["[-3,-1,2]"], ["[5,4,3,2,1,0,-1,-2]"], ["[1,2,3,1,2,3,1]"], ["[0]"]], "expected": [2, 3, 0, 4, 0, 0, 0, 1, 0, 1, 1, 0, 0, 0, 1, 1, 3, 2, 12, 3, 6, 3, 2, 5, 0, 22, 3, 0], "loose": false}

package/data/problems/reverse-string-ii.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "599", "slug": "reverse-string-ii", "id": 599, "title": "Reverse String II", "difficulty": "Easy", "category": "string", "link": "https://leetcode.com/problems/reverse-string-ii/", "examples": [{"input": "s = \"abcdefg\", k = 2", "output": "\"bacdfeg\"", "explanation": "Flip the first k of every 2k block."}, {"input": "s = \"abcd\", k = 2", "output": "\"bacd\"", "explanation": "First two flipped, last two kept."}, {"input": "s = \"a\", k = 2", "output": "\"a\""}], "hints": ["Step the start index by 2k and reverse the slice [start, min(start+k-1, end)].", "Reversing can be done in place with two pointers moving toward each other."], "statement": "You are given a string `s` and a positive integer `k`. Walk through the string from left to right in consecutive blocks of `2k` characters.\n\nWithin each block, flip the order of the first `k` characters and leave the remaining characters of that block untouched. When fewer than `k` characters remain at the end, flip all of them. When between `k` and `2k` characters remain, flip the first `k` and keep the rest as is.\n\nReturn the resulting string.\n\n**Constraints:**\n- `1 <= s.length <= 10^4`\n- `s` holds only lowercase English letters\n- `1 <= k <= 10^4`\n", "solution": "## Approach\n\nScan start positions 0, 2k, 4k and reverse the window of up to k characters beginning there with an in-place two-pointer swap. Characters outside those windows are never touched.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n)\n- **Space Complexity:** O(n) for the mutable character array.\n\n## Implementation\n\n```python\nclass Solution:\n def reverseStr(self, s: str, k: int) -> str:\n a = list(s)\n for start in range(0, len(a), 2 * k):\n i, j = start, min(start + k - 1, len(a) - 1)\n while i < j:\n a[i], a[j] = a[j], a[i]\n i += 1\n j -= 1\n return \"\".join(a)\n```\n", "starter": {"go": "package main\n\nfunc ReverseStr(s string, k int) string {\n \n}", "python": "class Solution:\n def reverseStr(self, s: str, k: int) -> str:\n pass", "cpp": "#include <string>\nusing namespace std;\nclass Solution {\npublic:\n string reverseStr(string s, int k) {\n return \"\";\n }\n};"}, "fn": "reverseStr", "params": [{"name": "s", "type": "string"}, {"name": "k", "type": "int"}], "outputType": "string", "tests": [["abcdefg", "2"], ["abcd", "2"], ["a", "2"], ["ab", "2"], ["abc", "2"], ["abcdef", "2"], ["abcdefgh", "3"], ["abcd", "1"], ["abcd", "4"], ["abcd", "5"], ["abcde", "2"], ["abcdefg", "3"], ["abcdefg", "1"], ["abcdefg", "8"], ["hyzqyljrnigxvdtnease", "6"], ["abcdefghij", "2"], ["abcdefghij", "4"], ["aaaaa", "2"], ["abcdef", "3"], ["ab", "1"], ["xyz", "2"], ["abcdefgh", "2"], ["qwerty", "3"], ["mnopqr", "10"], ["hello", "2"], ["world", "3"], ["abcdefghijk", "3"], ["zzzzzzzz", "3"]], "expected": ["bacdfeg", "bacd", "a", "ba", "bac", "bacdfe", "cbadefhg", "abcd", "dcba", "dcba", "bacde", "cbadefg", "abcdefg", "gfedcba", "lyqzyhjrnigxaentdvse", "bacdfeghji", "dcbaefghji", "aaaaa", "cbadef", "ab", "yxz", "bacdfegh", "ewqrty", "rqponm", "ehllo", "rowld", "cbadefihgjk", "zzzzzzzz"], "loose": false}

package/data/problems/reverse-string.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "165", "slug": "reverse-string", "id": 165, "title": "Reverse String", "difficulty": "Easy", "category": "two-pointer", "link": "https://leetcode.com/problems/reverse-string/", "examples": [{"input": "s = \"hello\"", "output": "\"olleh\"", "explanation": "Reversing \"hello\" gives \"olleh\"."}, {"input": "s = \"Hannah\"", "output": "\"hannaH\"", "explanation": "Reversing \"Hannah\" gives \"hannaH\"."}], "hints": ["Use two pointers starting at opposite ends and swap characters while moving toward the center.", "Reversing can also be done by building the result from the end of the string to the start."], "statement": "Given a string `s`, reverse the string and return the reversed string.\n\n**Constraints:**\n\n- 1 \u2264 s.length \u2264 10^5\n- s[i] is a printable ascii character.\n", "solution": "## Approach\n\nUse two pointers starting at opposite ends of the string. Swap the characters at the two pointers and move them toward the center until they meet. This reverses the string in a single pass.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n), where n is the length of the string. Each character is visited once.\n- **Space Complexity:** O(n) for the returned string (O(1) extra if reversing a mutable character array in place).\n\n## Implementation\n\n```python\nclass Solution:\n def reverseString(self, s: str) -> str:\n a = list(s)\n i, j = 0, len(a) - 1\n while i < j:\n a[i], a[j] = a[j], a[i]\n i += 1\n j -= 1\n return \"\".join(a)\n```\n", "starter": {"go": "package main\n\nfunc ReverseString(s string) string {\n return \"\"\n}", "python": "class Solution:\n def reverseString(self, s: str) -> str:\n return \"\"\n", "cpp": "#include <string>\nusing namespace std;\n\nclass Solution {\npublic:\n string reverseString(string s) {\n return \"\";\n }\n};"}, "fn": "reverseString", "params": [{"name": "s", "type": "string"}], "outputType": "string", "tests": [["hello"], ["Hannah"], ["a"], ["ab"], ["abc"], ["abcd"], ["A man, a plan, a canal: Panama"], ["12345"], ["racecar"], ["hello world"], ["AaBbCc"], ["!@#$%^"], [" "], ["~"], ["0"], ["01"], ["a b"], [" leading"], ["trailing "], [" two spaces "], ["The quick brown fox."], ["[]{}()"], ["9876543210"], ["MixedCASE123"], ["palindromeemordnilap"], ["\\path\\to\\file"], ["quote: \"test\""], ["tabs\tinside"], ["line1-line2"], [".,;:!?"]], "expected": ["olleh", "hannaH", "a", "ba", "cba", "dcba", "amanaP :lanac a ,nalp a ,nam A", "54321", "racecar", "dlrow olleh", "cCbBaA", "^%$#@!", " ", "~", "0", "10", "b a", "gnidael ", " gniliart", " secaps owt ", ".xof nworb kciuq ehT", ")(}{][", "0123456789", "321ESACdexiM", "palindromeemordnilap", "elif\\ot\\htap\\", "\"tset\" :etouq", "edisni\tsbat", "2enil-1enil", "?!:;,."], "loose": false}

package/data/problems/reverse-vowels-of-a-string.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "426", "slug": "reverse-vowels-of-a-string", "id": 426, "title": "Reverse Vowels of a String", "difficulty": "Easy", "category": "string", "link": "https://leetcode.com/problems/reverse-vowels-of-a-string/", "examples": [{"input": "s = \"IceCreAm\"", "output": "\"AceCreIm\"", "explanation": "The four vowels I,e,e,A are written back as A,e,e,I."}, {"input": "s = \"leetcode\"", "output": "\"leotcede\"", "explanation": "The vowels e,e,o,e are written back as e,o,e,e."}], "hints": ["Walk in from both ends, skipping non-vowels, and exchange vowels when both pointers land on one.", "Test vowel membership case-insensitively against the set {a,e,i,o,u}."], "statement": "Take the string `s` and flip the order of its vowels while leaving every other character exactly where it is.\n\nVowels are the letters `a`, `e`, `i`, `o`, `u` in either upper or lower case. Collect them in the order they appear, then write them back in reverse across the same vowel positions. Consonants, digits, spaces, and punctuation never move.\n\nReturn the resulting string.\n\n**Constraints:**\n- `1 <= s.length <= 3 * 10^5`\n- `s` consists of printable ASCII characters.\n", "solution": "## Approach\n\nConvert the string to a mutable array and place pointers at both ends. Move each pointer inward past non-vowels; when both rest on vowels, swap them and step onward. Vowel-only positions are therefore reversed while every other character stays fixed. Membership is tested against both cases of a, e, i, o, u.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n), each character visited at most once.\n- **Space Complexity:** O(n) for the mutable copy (O(1) besides output in languages with mutable strings).\n\n## Implementation\n\n```python\nclass Solution:\n def reverseVowels(self, s: str) -> str:\n vowels = set(\"aeiouAEIOU\")\n a = list(s)\n i, j = 0, len(a) - 1\n while i < j:\n while i < j and a[i] not in vowels:\n i += 1\n while i < j and a[j] not in vowels:\n j -= 1\n if i < j:\n a[i], a[j] = a[j], a[i]\n i += 1\n j -= 1\n return \"\".join(a)\n```\n", "starter": {"go": "package main\n\nfunc ReverseVowels(s string) string {\n return \"\"\n}", "python": "class Solution:\n def reverseVowels(self, s: str) -> str:\n return \"\"\n", "cpp": "#include <string>\nusing namespace std;\nclass Solution {\npublic:\n string reverseVowels(string s) {\n return \"\";\n }\n};"}, "fn": "reverseVowels", "params": [{"name": "s", "type": "string"}], "outputType": "string", "tests": [["IceCreAm"], ["leetcode"], ["aA"], ["hello"], ["a"], ["b"], ["AEIOU"], ["aeiou"], ["bcdfg"], ["aAaaAA"], ["race car"], [".,"], ["Hello, World!"], ["Aa"], ["ab"], [" programming "], ["Euston saw I was not Sue"], ["!!!aaa!!!"], ["AbcEe"], ["u"], ["UV"], ["The quick brown fox"], ["Mmm"], ["a1e2i3o4u5"], ["AbCdEfGh"], ["OOOooo"], ["xyzAEIxyz"]], "expected": ["AceCreIm", "leotcede", "Aa", "holle", "a", "b", "UOIEA", "uoiea", "bcdfg", "AAaaAa", "race car", ".,", "Hollo, Werld!", "aA", "ab", " prigrammong ", "euston saw I was not SuE", "!!!aaa!!!", "ebcEA", "u", "UV", "Tho qoick bruwn fex", "Mmm", "u1o2i3e4a5", "EbCdAfGh", "oooOOO", "xyzIEAxyz"], "loose": false}

package/data/problems/reverse-words-in-a-string-ii.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "326", "slug": "reverse-words-in-a-string-ii", "id": 326, "title": "Reverse Words in a String II", "difficulty": "Medium", "category": "string", "link": "https://leetcode.com/problems/reverse-words-in-a-string-ii/", "examples": [{"explanation": "The four words appear in the opposite order.", "input": "s = \"the sky is blue\"", "output": "\"blue is sky the\""}, {"explanation": "A single word stays the same.", "input": "s = \"hello\"", "output": "\"hello\""}, {"explanation": "Three one-letter words are flipped.", "input": "s = \"a b c\"", "output": "\"c b a\""}], "hints": ["Split on spaces, reverse the word list, and join with single spaces.", "The classic in-place method reverses the whole array then each word; the offline version may allocate the result."], "statement": "This is an offline adaptation of an in-place task. The original asks you to reverse the order of words inside a character array without extra space. Here you receive the text as a string and return a new string with the words in reverse order.\n\nWords are separated by single spaces, with no leading or trailing spaces. Keep every word intact and join them with single spaces in the new order.\n\n**Constraints:**\n- `1 <= s.length <= 10^4`\n- `s` holds letters and single spaces between words.\n- No leading or trailing spaces appear.\n", "solution": "## Approach\n\nSplit the string on spaces to get the words, flip the list, and glue the pieces back with single spaces. This mirrors the classic two-step in-place method (reverse everything, then reverse each word) but allocates the answer, which fits the offline string-in/string-out form.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n), where n is the string length.\n- **Space Complexity:** O(n) for the word list and the result.\n\n## Implementation\n\n```python\nclass Solution:\n def reverseWords(self, s: str) -> str:\n words = s.split(\" \")\n words.reverse()\n return \" \".join(words)\n```\n", "starter": {"go": "package main\n\nfunc ReverseWords(s string) string {\n return \"\"\n}", "python": "class Solution:\n def reverseWords(self, s: str) -> str:\n pass", "cpp": "#include <string>\n#include <vector>\nusing namespace std;\nclass Solution {\npublic:\n string reverseWords(string s) {\n return \"\";\n }\n};"}, "fn": "reverseWords", "params": [{"name": "s", "type": "string"}], "outputType": "string", "tests": [["the sky is blue"], ["hello"], ["a b c"], ["one two"], ["a"], ["ab cd"], ["hello world"], ["a b"], ["word"], ["this is a test"], ["one"], ["x y z w"], ["abc def ghi"], ["aa bb cc dd"], ["q w e r t"], ["lorem ipsum dolor"], ["a bc def"], ["foo bar baz qux"], ["z"], ["hi there"], ["one two three four five"], ["alpha beta"], ["m n"], ["pq rs tu"], ["cat dog"], ["red green blue yellow"]], "expected": ["blue is sky the", "hello", "c b a", "two one", "a", "cd ab", "world hello", "b a", "word", "test a is this", "one", "w z y x", "ghi def abc", "dd cc bb aa", "t r e w q", "dolor ipsum lorem", "def bc a", "qux baz bar foo", "z", "there hi", "five four three two one", "beta alpha", "n m", "tu rs pq", "dog cat", "yellow blue green red"], "loose": false}

package/data/problems/reverse-words-in-a-string-iii.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "613", "slug": "reverse-words-in-a-string-iii", "id": 613, "title": "Reverse Words in a String III", "difficulty": "Easy", "category": "string", "link": "https://leetcode.com/problems/reverse-words-in-a-string-iii/", "examples": [{"input": "s = \"Let's take LeetCode contest\"", "output": "\"s'teL ekat edoCteeL tsetnoc\"", "explanation": "Each word is flipped in place; gaps stay put."}, {"input": "s = \"God Ding\"", "output": "\"doG gniD\"", "explanation": "Both words are reversed independently."}, {"input": "s = \"Hello\"", "output": "\"olleH\"", "explanation": "A single word is simply mirrored."}], "hints": ["Split the sentence on spaces to isolate each word.", "Reverse every word on its own, then rejoin with single spaces.", "A two-pointer scan that flips each word in place also works in one pass."], "statement": "Given a sentence `s` made of words separated by single spaces (no leading or trailing spaces), reverse the characters of each individual word while keeping the word order and spacing exactly the same.\n\nFor instance, each maximal block of non-space characters should appear backwards in the answer, but the blocks themselves stay where they were.\n\n**Constraints:**\n- `1 <= s.length <= 5 * 10^4`\n- `s` contains printable ASCII characters.\n- Words are separated by single spaces with no leading or trailing spaces.\n", "solution": "## Approach\n\nSplit the sentence at each space to obtain the words, flip every word's characters, and glue the pieces back together with single spaces. Because the split preserves word boundaries, the order and spacing of the sentence are untouched.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n), where n is the sentence length. Each character is visited a constant number of times.\n- **Space Complexity:** O(n) for the word list and the rebuilt answer.\n\n## Implementation\n\n```python\nclass Solution:\n def reverseWords(self, s: str) -> str:\n return \" \".join(w[::-1] for w in s.split(\" \"))\n```\n", "starter": {"go": "package main\n\nfunc ReverseWords(s string) string {\n return \"\"\n}", "python": "class Solution:\n def reverseWords(self, s: str) -> str:\n return \"\"\n", "cpp": "#include <string>\nusing namespace std;\nclass Solution {\npublic:\n string reverseWords(string s) {\n return \"\";\n }\n};"}, "fn": "reverseWords", "params": [{"name": "s", "type": "string"}], "outputType": "string", "tests": [["Let's take LeetCode contest"], ["God Ding"], ["Hello"], ["a b c"], ["Hello World"], ["The quick brown fox jumps"], ["a"], ["AB CD"], ["123 456 789"], ["word"], ["Hi my name is Bob"], ["x y z"], ["Single"], ["one two three four five"], ["UPPER lower MiXeD"], ["a1 b2 c3"], ["longwordwithoutspaces"], ["I love Cojudge"], ["race a car"], ["ab cd ef gh"], ["q w e r t y"], ["contest today is rainy"], ["s'teL ekat"], ["Aa Bb Cc"], ["12345"], ["hello, world!"], ["foo bar baz qux"], ["z"]], "expected": ["s'teL ekat edoCteeL tsetnoc", "doG gniD", "olleH", "a b c", "olleH dlroW", "ehT kciuq nworb xof spmuj", "a", "BA DC", "321 654 987", "drow", "iH ym eman si boB", "x y z", "elgniS", "eno owt eerht ruof evif", "REPPU rewol DeXiM", "1a 2b 3c", "secapstuohtiwdrowgnol", "I evol egdujoC", "ecar a rac", "ba dc fe hg", "q w e r t y", "tsetnoc yadot si yniar", "Let's take", "aA bB cC", "54321", ",olleh !dlrow", "oof rab zab xuq", "z"], "loose": false}

package/data/problems/reverse-words-in-a-string.json ADDED Viewed

@@ -0,0 +1 @@

+ {"basic": false, "label": "307", "slug": "reverse-words-in-a-string", "id": 307, "title": "Reverse Words in a String", "difficulty": "Medium", "category": "string", "link": "https://leetcode.com/problems/reverse-words-in-a-string/", "examples": [{"input": "s = \"the sky is blue\"", "output": "\"blue is sky the\"", "explanation": "The four words appear in opposite order."}, {"input": "s = \" hello world \"", "output": "\"world hello\"", "explanation": "Extra edge spaces disappear in the answer."}, {"input": "s = \"a good example\"", "output": "\"example good a\"", "explanation": "Multiple gaps between words shrink to one space."}], "hints": ["Split on whitespace and drop empty tokens, then reverse the word list.", "Join with a single space to normalize all gaps automatically.", "A two-pointer in-place variant can also run in O(1) extra space."], "statement": "You are given a string `s` holding words separated by spaces. A word is a maximal run of non-space characters.\n\nReverse the order of the words and join them with exactly one space. Remove any leading or trailing spaces, and collapse every run of interior spaces to a single separator.\n\n**Constraints:**\n- `1 <= s.length <= 10^4`\n- `s` holds English letters (both cases), digits, and spaces.\n- At least one word exists in `s`.\n", "solution": "## Approach\n\nTrim the input, split on runs of whitespace, discard empties, reverse the word list, and rejoin with single spaces. The split-plus-join naturally removes edge spaces and collapses interior gaps.\n\n## Complexity Analysis\n\n- **Time Complexity:** O(n), where n is the string length. Splitting, reversing, and joining each touch the data once.\n- **Space Complexity:** O(n) for the word list and output.\n\n## Implementation\n\n```python\nclass Solution:\n def reverseWords(self, s: str) -> str:\n return \" \".join(reversed(s.split()))\n```\n", "starter": {"go": "package main\n\nfunc ReverseWords(s string) string {\n \n}", "python": "class Solution:\n def reverseWords(self, s: str) -> str:\n pass", "cpp": "#include <string>\nusing namespace std;\nclass Solution {\npublic:\n string reverseWords(string s) {\n return \"\";\n }\n};"}, "fn": "reverseWords", "params": [{"name": "s", "type": "string"}], "outputType": "string", "tests": [["the sky is blue"], [" hello world "], ["a good example"], ["a"], [" a "], ["hello"], [" hello "], ["one two"], ["one two three"], [" a b c "], ["Alice loves Bob"], ["a1 b2 c3"], [" 123 456 789 "], ["x y z w"], ["word"], [" word "], ["a b c d e f g"], [" multiple spaces here "], ["UPPER lower MiXeD"], ["1 2 3 4 5"], [" leading"], ["trailing "], ["a b"], ["ab cd ef gh ij"], [" The Quick Brown Fox "], ["0 0 0"], ["hello world"], [" a b c d e "]], "expected": ["blue is sky the", "world hello", "example good a", "a", "a", "hello", "hello", "two one", "three two one", "c b a", "Bob loves Alice", "c3 b2 a1", "789 456 123", "w z y x", "word", "word", "g f e d c b a", "here spaces multiple", "MiXeD lower UPPER", "5 4 3 2 1", "leading", "trailing", "b a", "ij gh ef cd ab", "Fox Brown Quick The", "0 0 0", "world hello", "e d c b a"], "loose": false}