jbrowse-plugin-msaview 3.9.0 → 4.0.0

package/dist/AddHighlightModel/GenomeMouseoverHighlight.js

@@ -1,7 +1,7 @@
 import React from 'react';
 import { getSession } from '@jbrowse/core/util';
 import { observer } from 'mobx-react';
-import { isMsaView } from '../MsaViewPanel/model';
+import { isMsaView } from '../MsaViewPanel/isMsaView';
 import { hasHoverPosition, useStyles } from './util';
 const GenomeMouseoverHighlight = observer(function ({ model, }) {
     const { hovered, views } = getSession(model);

package/dist/AddHighlightModel/index.js

@@ -1,6 +1,6 @@
 import React from 'react';
 import { getSession } from '@jbrowse/core/util';
-import { isMsaView } from '../MsaViewPanel/model';
+import { isMsaView } from '../MsaViewPanel/isMsaView';
 import HighlightComponents from './HighlightComponents';
 export default function AddHighlightComponentsModelF(pluginManager) {
     pluginManager.addToExtensionPoint(

package/dist/BgzipFastaMsaAdapter/BgzipFastaMsaAdapter.d.ts

@@ -3,14 +3,8 @@ import type { BaseFeatureDataAdapter } from '@jbrowse/core/data_adapters/BaseAda
 export default class BgzipFastaMsaAdapter extends BaseAdapter {
     configureP: Promise<BaseFeatureDataAdapter> | undefined;
     refNamesP: Promise<string[]> | undefined;
-    configurePre(): Promise<BaseFeatureDataAdapter<import("@jbrowse/mobx-state-tree").ModelInstanceTypeProps<Record<string, any>> & {
-        setSubschema(slotName: string, data: Record<string, unknown>): any;
-        setSlot(slotName: string, value: unknown): void;
-    } & import("@jbrowse/mobx-state-tree").IStateTreeNode<import("@jbrowse/core/configuration").AnyConfigurationSchemaType>>>;
-    configure(): Promise<BaseFeatureDataAdapter<import("@jbrowse/mobx-state-tree").ModelInstanceTypeProps<Record<string, any>> & {
-        setSubschema(slotName: string, data: Record<string, unknown>): any;
-        setSlot(slotName: string, value: unknown): void;
-    } & import("@jbrowse/mobx-state-tree").IStateTreeNode<import("@jbrowse/core/configuration").AnyConfigurationSchemaType>>>;
+    configurePre(): Promise<BaseFeatureDataAdapter<import("@jbrowse/core/configuration").AnyConfigurationModel>>;
+    configure(): Promise<BaseFeatureDataAdapter<import("@jbrowse/core/configuration").AnyConfigurationModel>>;
     getMSARefs(): Promise<string[]>;
     getMsaRegex(): RegExp;
     refNameToMsaId(refName: string): string;

package/dist/BgzipFastaMsaAdapter/configSchema.d.ts

@@ -1,7 +1,14 @@
 import type PluginManager from '@jbrowse/core/PluginManager';
 export default function configSchemaF(pluginManager: PluginManager): import("@jbrowse/core/configuration/configurationSchema").ConfigurationSchemaType<{
+    msaRegex: {
+        type: "string";
+    } & {
+        defaultValue: string;
+    };
+} | {
     readonly msaRegex: {
-        readonly type: "string";
-        readonly defaultValue: "_";
+        type: "string";
+    } & {
+        defaultValue: string;
     };
-}, import("@jbrowse/core/configuration/configurationSchema").ConfigurationSchemaOptions<import("@jbrowse/core/configuration").AnyConfigurationSchemaType, undefined>>;
+}, import("@jbrowse/core/configuration/configurationSchema").ConfigurationSchemaOptions<any, undefined, undefined, import("@jbrowse/core/configuration").ConfigurationSchemaRequirement<Partial<Record<string, string[]>>, string>>>;

package/dist/LaunchMsaView/cleanProteinSequence.test.js

@@ -1,8 +1,8 @@
 import { SimpleFeature } from '@jbrowse/core/util';
+import { translateTranscript } from '@jbrowse/core/util/translateTranscript';
 import { genomeToTranscriptSeqMapping } from 'g2p_mapper';
 import { describe, expect, test } from 'vitest';
 import { transcriptPosToVisibleCol } from '../MsaViewPanel/util';
-import { getProteinSequenceFromFeature } from './components/calculateProteinSequence';
 import { findQueryRow } from './detectQueryRow';
 import { cleanProteinSequence } from './util';
 describe('cleanProteinSequence', () => {
@@ -22,7 +22,7 @@ describe('a launched query row read through g2p', () => {
     function rowResidueUnder(genomePos, json) {
         const seq = json.seq;
         const feature = new SimpleFeature(json);
-        const row = cleanProteinSequence(getProteinSequenceFromFeature({ seq, feature }));
+        const row = cleanProteinSequence(translateTranscript({ transcript: feature, seq })?.protein ?? '');
         const { g2p } = genomeToTranscriptSeqMapping(feature.toJSON());
         const col = transcriptPosToVisibleCol({
             querySeqName: 'QUERY',
@@ -52,6 +52,40 @@ describe('a launched query row read through g2p', () => {
         expect(rowResidueUnder(4, json)).toBe('A');
         expect(rowResidueUnder(10, json)).toBe('K');
     });
+    test('on the reverse strand, across an intron, after a partial first codon', () => {
+        // sense G | ATG GCC <intron> TGG AAA TAA, stored as the reverse complement
+        const json = {
+            uniqueId: 't1',
+            refName: 'chr1',
+            start: 0,
+            end: 24,
+            strand: -1,
+            type: 'mRNA',
+            seq: 'TTATTTCCACTACTTACGGCCATC',
+            subfeatures: [
+                {
+                    uniqueId: 'c1',
+                    refName: 'chr1',
+                    type: 'CDS',
+                    start: 17,
+                    end: 24,
+                    phase: 1,
+                },
+                {
+                    uniqueId: 'c2',
+                    refName: 'chr1',
+                    type: 'CDS',
+                    start: 0,
+                    end: 9,
+                    phase: 0,
+                },
+            ],
+        };
+        expect(rowResidueUnder(22, json)).toBe('M');
+        expect(rowResidueUnder(18, json)).toBe('A');
+        expect(rowResidueUnder(7, json)).toBe('W');
+        expect(rowResidueUnder(4, json)).toBe('K');
+    });
     test('after an internal stop', () => {
         // ATG TGA GCC TGG TAA: a selenocysteine GENCODE does not annotate
         const json = transcript('ATGTGAGCCTGGTAA', { type: 'CDS' });

package/dist/LaunchMsaView/components/BlastQuery/BlastAutomaticPanel.js

@@ -103,16 +103,14 @@ const BlastAutomaticPanel = observer(function ({ handleClose, feature, model, ch
                             selectedTranscript: selectedTranscript.toJSON(),
                             proteinSequence,
                         };
-                    submit(() => {
-                        launchConnectedView({
-                            view,
-                            feature: selectedTranscript,
-                            placement,
-                            displayName: getBlastViewTitle(feature, selectedTranscript),
-                            ...builtAlignmentLook,
-                            blastParams,
-                        });
-                    });
+                    submit(() => launchConnectedView({
+                        view,
+                        feature: selectedTranscript,
+                        placement,
+                        displayName: getBlastViewTitle(feature, selectedTranscript),
+                        ...builtAlignmentLook,
+                        blastParams,
+                    }));
                 }
             }, onCancel: handleClose })));
 });

package/dist/LaunchMsaView/components/BlastQuery/BlastManualPanel.js

@@ -85,17 +85,15 @@ const BlastManualPanel = observer(function ({ handleClose, feature, model, child
                     React.createElement(QueryRowSelector, { ...queryRow })))),
         React.createElement(SubmitCancelActions, { model: model, submitDisabled: !selectedTranscript || !msaText.trim(), onSubmit: placement => {
                 if (selectedTranscript) {
-                    submit(() => {
-                        launchConnectedView({
-                            view,
-                            feature: selectedTranscript,
-                            placement,
-                            displayName: getGeneDisplayName(selectedTranscript),
-                            querySeqName: queryRow.querySeqName,
-                            querySeqOffset: queryRow.querySeqOffset,
-                            data: { msa: msaText, tree: treeText },
-                        });
-                    });
+                    submit(() => launchConnectedView({
+                        view,
+                        feature: selectedTranscript,
+                        placement,
+                        displayName: getGeneDisplayName(selectedTranscript),
+                        querySeqName: queryRow.querySeqName,
+                        querySeqOffset: queryRow.querySeqOffset,
+                        data: { msa: msaText, tree: treeText },
+                    }));
                 }
             }, onCancel: handleClose })));
 });

package/dist/LaunchMsaView/components/BlastQuery/CachedBlastResults.js

@@ -70,8 +70,10 @@ const CachedBlastResults = observer(function ({ model, handleClose, feature, })
             displayName: `BLAST - ${getResultDisplayName(cached)}`,
             ...builtAlignmentLook,
             data: { msa, tree, treeMetadata },
+        }).then(handleClose, (e) => {
+            console.error(e);
+            setOperationError(e);
         });
-        handleClose();
     };
     const displayError = error ?? operationError;
     return displayError ? (React.createElement(ErrorMessage, { error: displayError })) : isLoading ? (React.createElement(Typography, null, "Loading cached results...")) : results.length === 0 ? (React.createElement(Typography, { color: "textSecondary" }, "No cached BLAST results found for this gene. Run a BLAST query to cache results.")) : (React.createElement("div", null,

package/dist/LaunchMsaView/components/ManualMSALoader/ManualMSALoader.js

@@ -80,22 +80,20 @@ const ManualMSALoader = observer(function PreLoadedMSA2({ model, feature, handle
                 (inputMethod === 'file' && !msaFileLocation) ||
                 (inputMethod === 'text' && !msaText.trim()), onSubmit: placement => {
                 if (selectedTranscript) {
-                    submit(() => {
-                        launchConnectedView({
-                            view,
-                            feature: selectedTranscript,
-                            placement,
-                            displayName: getGeneDisplayName(selectedTranscript),
-                            querySeqName: queryRow.querySeqName,
-                            querySeqOffset: queryRow.querySeqOffset,
-                            ...(inputMethod === 'file'
-                                ? {
-                                    msaFilehandle: msaFileLocation,
-                                    treeFilehandle: treeFileLocation,
-                                }
-                                : { data: { msa: msaText, tree: treeText } }),
-                        });
-                    });
+                    submit(() => launchConnectedView({
+                        view,
+                        feature: selectedTranscript,
+                        placement,
+                        displayName: getGeneDisplayName(selectedTranscript),
+                        querySeqName: queryRow.querySeqName,
+                        querySeqOffset: queryRow.querySeqOffset,
+                        ...(inputMethod === 'file'
+                            ? {
+                                msaFilehandle: msaFileLocation,
+                                treeFilehandle: treeFileLocation,
+                            }
+                            : { data: { msa: msaText, tree: treeText } }),
+                    }));
                 }
             }, onCancel: handleClose })));
 });

package/dist/LaunchMsaView/components/OrthologQuery/OrthologPanel.js

@@ -60,24 +60,22 @@ const OrthologPanel = observer(function ({ handleClose, feature, model, preferre
             React.createElement(TranscriptSelector, { feature: feature, ...transcriptSelection })),
         React.createElement(SubmitCancelActions, { model: model, hint: React.createElement(SequenceStatusMessage, { status: sequenceStatus }), submitDisabled: !proteinSequence || !rowCountValid, onSubmit: placement => {
                 if (selectedTranscript) {
-                    submit(() => {
-                        launchConnectedView({
-                            view,
-                            feature: selectedTranscript,
-                            placement,
-                            displayName: `Orthologs - ${getGeneDisplayName(feature)} - ${getTranscriptDisplayName(selectedTranscript)}`,
-                            ...builtAlignmentLook,
-                            orthologParams: {
-                                taxId,
-                                source,
-                                maxSpecies: rowCount,
-                                geneCandidates,
-                                msaAlgorithm,
-                                selectedTranscript: selectedTranscript.toJSON(),
-                                proteinSequence,
-                            },
-                        });
-                    });
+                    submit(() => launchConnectedView({
+                        view,
+                        feature: selectedTranscript,
+                        placement,
+                        displayName: `Orthologs - ${getGeneDisplayName(feature)} - ${getTranscriptDisplayName(selectedTranscript)}`,
+                        ...builtAlignmentLook,
+                        orthologParams: {
+                            taxId,
+                            source,
+                            maxSpecies: rowCount,
+                            geneCandidates,
+                            msaAlgorithm,
+                            selectedTranscript: selectedTranscript.toJSON(),
+                            proteinSequence,
+                        },
+                    }));
                 }
             }, onCancel: handleClose })));
 });

package/dist/LaunchMsaView/components/PreLoadedMSA/PreLoadedMSADataPanel.js

@@ -82,25 +82,23 @@ const PreLoadedMSA = observer(function ({ model, feature, handleClose, preferred
             // dataset that does not cover this gene
             submitDisabled: !selectedTranscript || !msaData?.length || !querySeqName, onSubmit: placement => {
                 if (selectedTranscript && msaText) {
-                    submit(() => {
-                        launchConnectedView({
-                            view,
-                            feature: selectedTranscript,
-                            placement,
-                            displayName: getGeneDisplayName(selectedTranscript),
-                            treeAreaWidth: 200,
-                            treeWidth: 100,
-                            drawNodeBubbles: false,
-                            labelsAlignRight: true,
-                            showBranchLen: false,
-                            colWidth: 10,
-                            rowHeight: 12,
-                            colorSchemeName: 'percent_identity_dynamic',
-                            querySeqName,
-                            querySeqOffset: queryRow.querySeqOffset,
-                            data: { msa: msaText },
-                        });
-                    });
+                    submit(() => launchConnectedView({
+                        view,
+                        feature: selectedTranscript,
+                        placement,
+                        displayName: getGeneDisplayName(selectedTranscript),
+                        treeAreaWidth: 200,
+                        treeWidth: 100,
+                        drawNodeBubbles: false,
+                        labelsAlignRight: true,
+                        showBranchLen: false,
+                        colWidth: 10,
+                        rowHeight: 12,
+                        colorSchemeName: 'percent_identity_dynamic',
+                        querySeqName,
+                        querySeqOffset: queryRow.querySeqOffset,
+                        data: { msa: msaText },
+                    }));
                 }
             }, onCancel: handleClose })));
 });

package/dist/LaunchMsaView/components/launchConnectedView.d.ts

@@ -15,9 +15,9 @@ export declare function launchConnectedView({ view, feature, placement, ...snaps
     view: LinearGenomeViewModel;
     feature?: Feature;
     placement: MsaViewPlacement;
-} & Record<string, unknown>): void;
+} & Record<string, unknown>): Promise<import("@jbrowse/core/util").AbstractViewModel>;
 /** runs a panel's launch, closing the dialog on success and keeping the error */
 export declare function useLaunchSubmit(handleClose: () => void): {
     launchError: unknown;
-    submit: (launch: () => void) => void;
+    submit: (launch: () => Promise<unknown>) => void;
 };

package/dist/LaunchMsaView/components/launchConnectedView.js

@@ -12,7 +12,7 @@ export const builtAlignmentLook = {
  * through `feature` to the transcript whose codons its query row is read by.
  */
 export function launchConnectedView({ view, feature, placement, ...snapshot }) {
-    launchMsaView(getSession(view), {
+    return launchMsaView(getSession(view), {
         placement,
         connectedViewId: view.id,
         connectedFeature: feature?.toJSON(),
@@ -25,15 +25,11 @@ export function useLaunchSubmit(handleClose) {
     return {
         launchError,
         submit: (launch) => {
-            try {
-                setLaunchError(undefined);
-                launch();
-                handleClose();
-            }
-            catch (e) {
+            setLaunchError(undefined);
+            launch().then(handleClose, (e) => {
                 console.error(e);
                 setLaunchError(e);
-            }
+            });
         },
     };
 }

package/dist/LaunchMsaView/components/useFeatureSequence.js

@@ -1,6 +1,6 @@
 import { getSession } from '@jbrowse/core/util';
+import { translateTranscript } from '@jbrowse/core/util/translateTranscript';
 import { useFetch } from '../../utils/useFetch';
-import { getProteinSequenceFromFeature } from './calculateProteinSequence';
 import { fetchSeq } from './fetchSeq';
 export function useFeatureSequence({ view, feature, }) {
     const assemblyName = view?.assemblyNames?.[0];
@@ -18,11 +18,8 @@ export function useFeatureSequence({ view, feature, }) {
     });
     return {
         proteinSequence: sequence && feature
-            ? getProteinSequenceFromFeature({
-                seq: sequence.seq,
-                feature,
-                assemblyGeneticCodeId: sequence.assemblyGeneticCodeId,
-            })
+            ? (translateTranscript({ transcript: feature, ...sequence })?.protein ??
+                '')
             : '',
         sequence,
         error,

package/dist/LaunchMsaView/index.js

@@ -1,8 +1,9 @@
+import { lazy } from 'react';
 import { getContainingTrack, getSession } from '@jbrowse/core/util';
 import AddIcon from '@mui/icons-material/Add';
 import { isCodingFeature } from './codingFeature';
-import LaunchMsaViewDialog from './components/LaunchMsaViewDialog';
 import { launchTarget } from './launchTarget';
+const LaunchMsaViewDialog = lazy(() => import('./components/LaunchMsaViewDialog'));
 function isDisplay(elt) {
     return elt.name === 'LinearBasicDisplay';
 }

package/dist/LaunchMsaView/launchTarget.test.js

@@ -52,7 +52,7 @@ describe('launchTarget', () => {
     test('offers nothing when nothing was clicked', () => {
         expect(launchTarget({ contextMenuItems: () => [] })).toBeUndefined();
     });
-    // v3.7.0 hosts have contextMenuFeature and nothing else; dropping this
+    // v4.3.0 and earlier have contextMenuFeature and nothing else; dropping this
     // fallback once took "Launch MSA view" off every host in the wild.
     test('falls back to a synchronous contextMenuFeature', () => {
         const target = launchTarget(legacyHost(feature('mRNA')));

package/dist/LaunchMsaViewExtensionPoint/index.js

@@ -1,4 +1,3 @@
-import { expandSpec } from 'react-msaview';
 import { launchMsaView } from '../utils/launchMsaView';
 /**
  * `msa` and `tree` onto the plugin's own sources, so a url still goes through
@@ -23,7 +22,7 @@ function withLongSources({ msa, tree, ...args }) {
     };
 }
 export default function LaunchMsaViewExtensionPointF(pluginManager) {
-    pluginManager.addToExtensionPoint('LaunchView-MsaView', (args) => {
+    pluginManager.addToExtensionPoint('LaunchView-MsaView', async (args) => {
         const { session, query, data, msaFileLocation, msaIndexedLocation, msaName, treeFileLocation, querySeqName, searchParams, ...rest } = withLongSources(args);
         // `orthologParams` and `searchParams` name no alignment at all — the
         // view builds one at launch, which is the dialog's Orthologs and BLAST
@@ -49,7 +48,8 @@ export default function LaunchMsaViewExtensionPointF(pluginManager) {
             msaName,
             querySeqName,
         };
-        launchMsaView(session, {
+        const { expandSpec } = await import('react-msaview');
+        await launchMsaView(session, {
             ...expandSpec({ ...rest, query }),
             ...(searchParams ? { blastParams: searchParams } : {}),
             data,

package/dist/LaunchMsaViewExtensionPoint/index.test.js

@@ -1,6 +1,6 @@
 import { expect, test } from 'vitest';
 import LaunchMsaViewExtensionPointF from './index';
-function launch(args) {
+async function launch(args) {
     let run;
     LaunchMsaViewExtensionPointF({
         addToExtensionPoint(_name, cb) {
@@ -9,20 +9,20 @@ function launch(args) {
     });
     const added = [];
     const session = {
-        addView(_type, snapshot) {
+        async launchView(_type, snapshot) {
             added.push(snapshot);
             return { id: 'view-1' };
         },
     };
-    run({ session, ...args });
+    await run({ session, ...args });
     return added[0];
 }
-test('inline data carries no init, which the panel would read as a launch in flight', () => {
-    const snapshot = launch({ data: { msa: '>a\nMEEP' } });
+test('inline data carries no init, which the panel would read as a launch in flight', async () => {
+    const snapshot = await launch({ data: { msa: '>a\nMEEP' } });
     expect('init' in snapshot).toBe(false);
 });
-test('a file location travels through init', () => {
-    const snapshot = launch({
+test('a file location travels through init', async () => {
+    const snapshot = await launch({
         msaFileLocation: { uri: 'http://example.com/a.fa' },
     });
     expect(snapshot.init).toEqual({
@@ -32,8 +32,8 @@ test('a file location travels through init', () => {
         querySeqName: undefined,
     });
 });
-test('searchParams is a source, stored under the name the dialog uses', () => {
-    const snapshot = launch({
+test('searchParams is a source, stored under the name the dialog uses', async () => {
+    const snapshot = await launch({
         searchParams: {
             searchProgram: 'phmmer',
             blastDatabase: 'rp15',
@@ -50,13 +50,13 @@ test('searchParams is a source, stored under the name the dialog uses', () => {
     expect('searchParams' in snapshot).toBe(false);
     expect(snapshot.connectedTranscript).toBe('NM_000546.6');
 });
-test('a launch naming no source at all is refused', () => {
-    expect(() => launch({ connectedViewId: 'lgv1' })).toThrow(/searchParams/);
+test('a launch naming no source at all is refused', async () => {
+    await expect(launch({ connectedViewId: 'lgv1' })).rejects.toThrow(/searchParams/);
 });
-test('region and the data-layer keys reach the view as snapshot properties', () => {
+test('region and the data-layer keys reach the view as snapshot properties', async () => {
     const region = { row: 'Human', start: 245, end: 249 };
     const clades = [{ mrca: ['Human', 'Mouse'], tips: 2, mark: 'bracket' }];
-    const snapshot = launch({
+    const snapshot = await launch({
         data: { msa: '>Human\nMEEP' },
         region,
         clades,
@@ -68,8 +68,11 @@ test('region and the data-layer keys reach the view as snapshot properties', ()
     expect(snapshot.relativeTo).toBe('Human');
     expect(snapshot.gffFilehandle).toEqual({ uri: 'http://example.com/a.gff' });
 });
-test('one field set is enough to need init', () => {
-    const snapshot = launch({ data: { msa: '>a\nMEEP' }, querySeqName: 'QUERY' });
+test('one field set is enough to need init', async () => {
+    const snapshot = await launch({
+        data: { msa: '>a\nMEEP' },
+        querySeqName: 'QUERY',
+    });
     expect(snapshot.init).toEqual({
         msaUrl: undefined,
         msaIndexedLocation: undefined,
@@ -77,8 +80,8 @@ test('one field set is enough to need init', () => {
         querySeqName: 'QUERY',
     });
 });
-test('msa and tree urls reach the plugin sources, query the query row', () => {
-    const snapshot = launch({
+test('msa and tree urls reach the plugin sources, query the query row', async () => {
+    const snapshot = await launch({
         msa: 'https://example.com/p53.afa',
         tree: 'https://example.com/p53.nh',
         query: 'Human',
@@ -94,13 +97,13 @@ test('msa and tree urls reach the plugin sources, query the query row', () => {
     expect(snapshot.relativeTo).toBe('Human');
     expect('msa' in snapshot || 'query' in snapshot).toBe(false);
 });
-test('inline msa and newick text become inline data', () => {
-    const snapshot = launch({ msa: '>a\nMEEP\n>b\nMEEP', tree: '(a,b);' });
+test('inline msa and newick text become inline data', async () => {
+    const snapshot = await launch({ msa: '>a\nMEEP\n>b\nMEEP', tree: '(a,b);' });
     expect(snapshot.data).toEqual({ msa: '>a\nMEEP\n>b\nMEEP', tree: '(a,b);' });
     expect('init' in snapshot).toBe(false);
 });
-test('highlights, region and column tracks expand onto the query row', () => {
-    const snapshot = launch({
+test('highlights, region and column tracks expand onto the query row', async () => {
+    const snapshot = await launch({
         msa: 'https://example.com/p53.afa',
         query: 'Human',
         highlights: ['102-292 DNA-binding', 175],

package/dist/MsaViewPanel/index.js

@@ -1,13 +1,13 @@
 import { lazy } from 'react';
 import ViewType from '@jbrowse/core/pluggableElementTypes/ViewType';
-import stateModelFactory from './model';
-// lazies
 const MsaViewPanel = lazy(() => import('./components/MsaViewPanel'));
 export default function MsaViewF(pluginManager) {
     pluginManager.addViewType(() => {
         return new ViewType({
             name: 'MsaView',
-            stateModel: stateModelFactory(),
+            // a thunk, so react-msaview loads with the first view rather than with
+            // the plugin; addView refuses the type until then, hence launchView
+            stateModel: () => import('./model').then(m => m.default()),
             ReactComponent: MsaViewPanel,
         });
     });

package/dist/MsaViewPanel/isMsaView.d.ts

@@ -0,0 +1,4 @@
+import type { JBrowsePluginMsaViewModel } from './model';
+export declare function isMsaView(view: {
+    type: string;
+}): view is JBrowsePluginMsaViewModel;

package/dist/MsaViewPanel/isMsaView.js

@@ -0,0 +1,3 @@
+export function isMsaView(view) {
+    return view.type === 'MsaView';
+}