jbrowse-plugin-msaview 3.8.0 → 3.10.0

package/dist/AddHighlightModel/MsaToGenomeHighlight.js

@@ -1,41 +1,25 @@
 import React from 'react';
 import { getSession } from '@jbrowse/core/util';
 import { observer } from 'mobx-react';
-import { isMsaView } from '../MsaViewPanel/model';
+import { connectedHighlights } from './connectedHighlights';
 import { hasHoverPosition, useStyles } from './util';
 const MsaToGenomeHighlight = observer(function MsaToGenomeHighlight2({ model, }) {
     const { views, hovered } = getSession(model);
-    const msaView = views
-        .filter(isMsaView)
-        .find(v => v.connectedViewId === model.id);
-    // The persistent click selection always shows. The hover codon is suppressed
-    // while hovering the LGV — GenomeMouseoverHighlight handles the single-bp
-    // display in that case, so we don't stack a wider codon band on top of it.
-    const highlights = [
-        ...(msaView?.connectedClickHighlights ?? []),
-        ...(hasHoverPosition(hovered)
-            ? []
-            : (msaView?.connectedHoverHighlights ?? [])),
-    ];
+    const highlights = connectedHighlights(views, model.id, hasHoverPosition(hovered));
     return highlights.length ? (React.createElement(MsaToGenomeHighlightRenderer, { model: model, highlights: highlights })) : null;
 });
-// Inner component: handles the scroll-dependent rendering
 const MsaToGenomeHighlightRenderer = observer(function ({ model, highlights, }) {
     const { classes } = useStyles();
     const { offsetPx } = model;
-    return (React.createElement(React.Fragment, null, highlights.map((r, idx) => {
-        // Use the highlight's own refName, which is already in the connected
-        // view's coordinate space (it comes from the connectedFeature the
-        // launcher set on this LGV). Do NOT canonicalize: bpToPx matches
-        // displayed regions by exact refName with no alias resolution, so
-        // rewriting e.g. "chr17" to the assembly-canonical "17" misses a view
-        // whose regions are "chr17". (GenomeMouseoverHighlight does the same.)
+    return (React.createElement(React.Fragment, null, highlights.map(r => {
+        // bpToPx matches refNames exactly, so canonicalizing "chr17" to "17"
+        // would miss a view whose regions say "chr17"
         const s = model.bpToPx({ refName: r.refName, coord: r.start });
         const e = model.bpToPx({ refName: r.refName, coord: r.end });
         if (s && e) {
             const width = Math.max(Math.abs(e.offsetPx - s.offsetPx), 4);
             const left = Math.min(s.offsetPx, e.offsetPx) - offsetPx;
-            return (React.createElement("div", { key: `${r.refName}-${r.start}-${r.end}-${idx}`, className: classes.highlight, style: { left, width } }));
+            return (React.createElement("div", { key: `${r.refName}-${r.start}-${r.end}`, className: classes.highlight, style: { left, width } }));
         }
         return null;
     })));

package/dist/AddHighlightModel/connectedHighlights.d.ts

@@ -0,0 +1,9 @@
+interface Region {
+    refName: string;
+    start: number;
+    end: number;
+}
+export declare function connectedHighlights(views: readonly {
+    type: string;
+}[], genomeViewId: string, genomeHovered: boolean): Region[];
+export {};

package/dist/AddHighlightModel/connectedHighlights.js

@@ -0,0 +1,15 @@
+export function connectedHighlights(views, genomeViewId, genomeHovered) {
+    const regions = views
+        .filter(isLinkedMsaView)
+        .filter(v => v.connectedViewId === genomeViewId)
+        .flatMap(v => [
+        ...v.connectedClickHighlights,
+        ...(genomeHovered ? [] : v.connectedHoverHighlights),
+    ]);
+    return [
+        ...new Map(regions.map(r => [`${r.refName}:${r.start}-${r.end}`, r])).values(),
+    ];
+}
+function isLinkedMsaView(view) {
+    return view.type === 'MsaView';
+}

package/dist/AddHighlightModel/connectedHighlights.test.js

@@ -0,0 +1,36 @@
+import { describe, expect, it } from 'vitest';
+import { connectedHighlights } from './connectedHighlights';
+const region = (start) => ({ refName: 'chr17', start, end: start + 3 });
+function msaView(id, click, hover) {
+    return {
+        type: 'MsaView',
+        connectedViewId: id,
+        connectedClickHighlights: [region(click)],
+        connectedHoverHighlights: [region(hover)],
+    };
+}
+describe('connectedHighlights', () => {
+    const views = [
+        { type: 'LinearGenomeView' },
+        msaView('lgv1', 100, 200),
+        msaView('lgv2', 300, 400),
+        msaView('lgv1', 500, 600),
+    ];
+    it('collects every MSA view linked to the genome view', () => {
+        expect(connectedHighlights(views, 'lgv1', false).map(r => r.start)).toEqual([100, 200, 500, 600]);
+    });
+    it('drops hover codons while the genome view is hovered', () => {
+        expect(connectedHighlights(views, 'lgv1', true).map(r => r.start)).toEqual([
+            100, 500,
+        ]);
+    });
+    it('draws a codon two views both highlight once', () => {
+        const both = [msaView('lgv1', 100, 200), msaView('lgv1', 100, 200)];
+        expect(connectedHighlights(both, 'lgv1', false).map(r => r.start)).toEqual([
+            100, 200,
+        ]);
+    });
+    it('returns nothing for an unlinked genome view', () => {
+        expect(connectedHighlights(views, 'lgv3', false)).toEqual([]);
+    });
+});

package/dist/AddHighlightModel/index.js

@@ -6,7 +6,6 @@ export default function AddHighlightComponentsModelF(pluginManager) {
     pluginManager.addToExtensionPoint(
     // @ts-expect-error v4 hosts have no contributeToExtensionPoint
     'LinearGenomeView-TracksContainerComponent', (rest, { model }) => {
-        // Quick check: don't add any components if no MSA view exists
         const { views } = getSession(model);
         const hasMsaView = views.some(v => isMsaView(v) && v.connectedViewId === model.id);
         if (!hasMsaView) {

package/dist/BgzipFastaMsaAdapter/BgzipFastaMsaAdapter.d.ts

@@ -3,14 +3,8 @@ import type { BaseFeatureDataAdapter } from '@jbrowse/core/data_adapters/BaseAda
 export default class BgzipFastaMsaAdapter extends BaseAdapter {
     configureP: Promise<BaseFeatureDataAdapter> | undefined;
     refNamesP: Promise<string[]> | undefined;
-    configurePre(): Promise<BaseFeatureDataAdapter<import("@jbrowse/mobx-state-tree").ModelInstanceTypeProps<Record<string, any>> & {
-        setSubschema(slotName: string, data: Record<string, unknown>): any;
-        setSlot(slotName: string, value: unknown): void;
-    } & import("@jbrowse/mobx-state-tree").IStateTreeNode<import("@jbrowse/core/configuration").AnyConfigurationSchemaType>>>;
-    configure(): Promise<BaseFeatureDataAdapter<import("@jbrowse/mobx-state-tree").ModelInstanceTypeProps<Record<string, any>> & {
-        setSubschema(slotName: string, data: Record<string, unknown>): any;
-        setSlot(slotName: string, value: unknown): void;
-    } & import("@jbrowse/mobx-state-tree").IStateTreeNode<import("@jbrowse/core/configuration").AnyConfigurationSchemaType>>>;
+    configurePre(): Promise<BaseFeatureDataAdapter<import("@jbrowse/core/configuration").AnyConfigurationModel>>;
+    configure(): Promise<BaseFeatureDataAdapter<import("@jbrowse/core/configuration").AnyConfigurationModel>>;
     getMSARefs(): Promise<string[]>;
     getMsaRegex(): RegExp;
     refNameToMsaId(refName: string): string;

package/dist/BgzipFastaMsaAdapter/configSchema.d.ts

@@ -1,7 +1,14 @@
 import type PluginManager from '@jbrowse/core/PluginManager';
 export default function configSchemaF(pluginManager: PluginManager): import("@jbrowse/core/configuration/configurationSchema").ConfigurationSchemaType<{
+    msaRegex: {
+        type: "string";
+    } & {
+        defaultValue: string;
+    };
+} | {
     readonly msaRegex: {
-        readonly type: "string";
-        readonly defaultValue: "_";
+        type: "string";
+    } & {
+        defaultValue: string;
     };
-}, import("@jbrowse/core/configuration/configurationSchema").ConfigurationSchemaOptions<import("@jbrowse/core/configuration").AnyConfigurationSchemaType, undefined>>;
+}, import("@jbrowse/core/configuration/configurationSchema").ConfigurationSchemaOptions<any, undefined, undefined, import("@jbrowse/core/configuration").ConfigurationSchemaRequirement<Partial<Record<string, string[]>>, string>>>;

package/dist/LaunchMsaView/cleanProteinSequence.test.js

@@ -1,8 +1,8 @@
 import { SimpleFeature } from '@jbrowse/core/util';
+import { translateTranscript } from '@jbrowse/core/util/translateTranscript';
 import { genomeToTranscriptSeqMapping } from 'g2p_mapper';
 import { describe, expect, test } from 'vitest';
 import { transcriptPosToVisibleCol } from '../MsaViewPanel/util';
-import { getProteinSequenceFromFeature } from './components/calculateProteinSequence';
 import { findQueryRow } from './detectQueryRow';
 import { cleanProteinSequence } from './util';
 describe('cleanProteinSequence', () => {
@@ -22,7 +22,7 @@ describe('a launched query row read through g2p', () => {
     function rowResidueUnder(genomePos, json) {
         const seq = json.seq;
         const feature = new SimpleFeature(json);
-        const row = cleanProteinSequence(getProteinSequenceFromFeature({ seq, feature }));
+        const row = cleanProteinSequence(translateTranscript({ transcript: feature, seq })?.protein ?? '');
         const { g2p } = genomeToTranscriptSeqMapping(feature.toJSON());
         const col = transcriptPosToVisibleCol({
             querySeqName: 'QUERY',
@@ -52,6 +52,40 @@ describe('a launched query row read through g2p', () => {
         expect(rowResidueUnder(4, json)).toBe('A');
         expect(rowResidueUnder(10, json)).toBe('K');
     });
+    test('on the reverse strand, across an intron, after a partial first codon', () => {
+        // sense G | ATG GCC <intron> TGG AAA TAA, stored as the reverse complement
+        const json = {
+            uniqueId: 't1',
+            refName: 'chr1',
+            start: 0,
+            end: 24,
+            strand: -1,
+            type: 'mRNA',
+            seq: 'TTATTTCCACTACTTACGGCCATC',
+            subfeatures: [
+                {
+                    uniqueId: 'c1',
+                    refName: 'chr1',
+                    type: 'CDS',
+                    start: 17,
+                    end: 24,
+                    phase: 1,
+                },
+                {
+                    uniqueId: 'c2',
+                    refName: 'chr1',
+                    type: 'CDS',
+                    start: 0,
+                    end: 9,
+                    phase: 0,
+                },
+            ],
+        };
+        expect(rowResidueUnder(22, json)).toBe('M');
+        expect(rowResidueUnder(18, json)).toBe('A');
+        expect(rowResidueUnder(7, json)).toBe('W');
+        expect(rowResidueUnder(4, json)).toBe('K');
+    });
     test('after an internal stop', () => {
         // ATG TGA GCC TGG TAA: a selenocysteine GENCODE does not annotate
         const json = transcript('ATGTGAGCCTGGTAA', { type: 'CDS' });

package/dist/LaunchMsaView/components/BlastQuery/consts.d.ts

@@ -13,8 +13,10 @@ export type EbiMsaAlgorithm = (typeof ebiMsaAlgorithms)[number];
  * page and the rows merged on the query (utils/browserAlign.ts), with the tree
  * built by react-msaview's neighbour joining. It is the aligner for a launch
  * that must not depend on EBI, and for one that wants to be quick -- a
- * hundred rows take a second or two against a Job Dispatcher queue that has
- * been measured at anything from ten seconds to fifteen minutes.
+ * hundred 400-residue rows take under a second, and a hundred 1400-residue
+ * rows eight, against a Job Dispatcher queue that has been measured at
+ * anything from ten seconds to fifteen minutes. Past the per-sequence limit in
+ * browserAlign.ts it refuses and names an EBI aligner instead.
  */
 export declare const msaAlgorithms: readonly ["clustalo", "muscle", "kalign", "mafft", "browser"];
 export type MsaAlgorithm = (typeof msaAlgorithms)[number];
@@ -28,7 +30,6 @@ export declare const msaAlgorithmLabels: Record<MsaAlgorithm, string>;
  */
 export declare const blastDatabaseOptions: readonly ["uniprotkb_swissprot", "uniprotkb", "pan_proteomes", "uniprotkb_trembl"];
 export type BlastDatabase = (typeof blastDatabaseOptions)[number];
-export declare const defaultBlastDatabase: BlastDatabase;
 export declare const searchPrograms: readonly ["blastp", "phmmer"];
 export type SearchProgram = (typeof searchPrograms)[number];
 export declare const searchProgramLabels: Record<SearchProgram, string>;
@@ -46,7 +47,6 @@ export declare const searchProgramLabels: Record<SearchProgram, string>;
  */
 export declare const phmmerDatabaseOptions: readonly ["swissprot", "uniprotkb", "uniprotrefprot", "rp75", "rp55", "rp35", "rp15"];
 export type PhmmerDatabase = (typeof phmmerDatabaseOptions)[number];
-export declare const defaultPhmmerDatabase: PhmmerDatabase;
 export declare const defaultMaxHits = 100;
 export declare function snapBlastHitCount(maxHits: number): number;
 /**

package/dist/LaunchMsaView/components/BlastQuery/consts.js

@@ -17,8 +17,10 @@ export const ebiMsaAlgorithms = [
  * page and the rows merged on the query (utils/browserAlign.ts), with the tree
  * built by react-msaview's neighbour joining. It is the aligner for a launch
  * that must not depend on EBI, and for one that wants to be quick -- a
- * hundred rows take a second or two against a Job Dispatcher queue that has
- * been measured at anything from ten seconds to fifteen minutes.
+ * hundred 400-residue rows take under a second, and a hundred 1400-residue
+ * rows eight, against a Job Dispatcher queue that has been measured at
+ * anything from ten seconds to fifteen minutes. Past the per-sequence limit in
+ * browserAlign.ts it refuses and names an EBI aligner instead.
  */
 export const msaAlgorithms = [...ebiMsaAlgorithms, 'browser'];
 export const msaAlgorithmLabels = {
@@ -43,7 +45,7 @@ export const blastDatabaseOptions = [
 ];
 // curated, so it returns roughly one good sequence per species rather than the
 // many near-identical TrEMBL entries an alignment reads poorly
-export const defaultBlastDatabase = 'uniprotkb_swissprot';
+const defaultBlastDatabase = 'uniprotkb_swissprot';
 export const searchPrograms = ['blastp', 'phmmer'];
 export const searchProgramLabels = {
     blastp: 'blastp (sequence search)',
@@ -70,7 +72,7 @@ export const phmmerDatabaseOptions = [
     'rp35',
     'rp15',
 ];
-export const defaultPhmmerDatabase = 'swissprot';
+const defaultPhmmerDatabase = 'swissprot';
 /**
  * The hit counts EBI's ncbiblast accepts for `alignments` and `scores`. A value
  * off this list is a 400 at submit time, so a request is rounded up to the next

package/dist/LaunchMsaView/components/BlastQuery/searchChoiceStorage.d.ts

@@ -1,6 +1,4 @@
 import type { MsaAlgorithm, SearchChoice } from './consts';
-export declare const SEARCH_CHOICE_STORAGE_KEY = "msaView-blastSearch";
-export declare const MSA_ALGORITHM_STORAGE_KEY = "msaView-msaAlgorithm";
 export declare function validSearchChoice(stored: unknown): SearchChoice;
 export declare function validMsaAlgorithm(stored: unknown): MsaAlgorithm;
 export declare function useStoredSearchChoice(): readonly [SearchChoice, (choice: SearchChoice) => void];

package/dist/LaunchMsaView/components/BlastQuery/searchChoiceStorage.js

@@ -8,8 +8,8 @@ import { databaseOptionsFor, defaultSearchFor, msaAlgorithms, searchPrograms, }
 // comes back is checked against the current options before it is used — an
 // option this plugin has since dropped would otherwise reach EBI and come back
 // a 400, minutes after the user pressed Submit.
-export const SEARCH_CHOICE_STORAGE_KEY = 'msaView-blastSearch';
-export const MSA_ALGORITHM_STORAGE_KEY = 'msaView-msaAlgorithm';
+const SEARCH_CHOICE_STORAGE_KEY = 'msaView-blastSearch';
+const MSA_ALGORITHM_STORAGE_KEY = 'msaView-msaAlgorithm';
 const defaultSearch = defaultSearchFor('blastp');
 const defaultMsaAlgorithm = 'clustalo';
 export function validSearchChoice(stored) {

package/dist/LaunchMsaView/components/OrthologQuery/OrthologSourceSelect.d.ts

@@ -1,6 +1,5 @@
 import React from 'react';
 import type { OrthologSource } from '../../../MsaViewPanel/model';
-export declare const orthologSourceLabels: Record<OrthologSource, string>;
 export declare function validOrthologSource(stored: unknown): OrthologSource;
 export declare function useStoredOrthologSource(): readonly ["ncbi" | "panther" | "uniref", (source: OrthologSource) => void];
 export default function OrthologSourceSelect({ value, onChange, className, }: {

package/dist/LaunchMsaView/components/OrthologQuery/OrthologSourceSelect.js

@@ -3,7 +3,7 @@ import { MenuItem } from '@mui/material';
 import TextField2 from '../../../components/TextField2';
 import { useLocalStorage } from '../../../utils/useLocalStorage';
 const ORTHOLOG_SOURCE_STORAGE_KEY = 'msaview-ortholog-source';
-export const orthologSourceLabels = {
+const orthologSourceLabels = {
     ncbi: 'NCBI orthologs',
     panther: 'PANTHER',
     uniref: 'UniRef cluster',

package/dist/LaunchMsaView/components/OrthologQuery/QuerySpeciesSelect.js

@@ -3,12 +3,12 @@ import TextField2 from '../../../components/TextField2';
 import { resolveAssemblySpecies, resolveTaxId, } from '../../../utils/ncbiTaxonomy';
 import { fetchTaxonomyInfo } from '../../../utils/taxonomyNames';
 import { useDebounced, useFetch } from '../../../utils/useFetch';
-async function describeTaxon(query) {
-    const taxId = await resolveTaxId(query);
+async function describeTaxon(query, signal) {
+    const taxId = await resolveTaxId(query, signal);
     if (!taxId) {
         throw new Error(`No NCBI taxon matches "${query}"`);
     }
-    const info = (await fetchTaxonomyInfo([taxId])).get(taxId);
+    const info = (await fetchTaxonomyInfo([taxId], signal)).get(taxId);
     const label = [info?.sciname, info?.commonName && `(${info.commonName})`]
         .filter(Boolean)
         .join(' ');
@@ -40,14 +40,14 @@ export default function QuerySpeciesSelect({ value, assemblyName, onChange, clas
     // reported the throttle as "blocked by CORS policy" in the helper text.
     const { data: fromAssembly } = useFetch(assemblyName && typed === undefined
         ? [assemblyName, 'assembly-species']
-        : null, () => resolveAssemblySpecies(assemblyName), {
+        : null, signal => resolveAssemblySpecies(assemblyName, signal), {
         onSuccess: found => {
             if (found) {
                 onChange(found.taxId);
             }
         },
     });
-    const { data: fromText, error } = useFetch(debounced?.trim() ? [debounced.trim(), 'taxon'] : null, () => describeTaxon(debounced), {
+    const { data: fromText, error } = useFetch(debounced?.trim() ? [debounced.trim(), 'taxon'] : null, signal => describeTaxon(debounced, signal), {
         onSuccess: ({ taxId }) => {
             onChange(taxId);
         },

package/dist/LaunchMsaView/components/useFeatureSequence.js

@@ -1,6 +1,6 @@
 import { getSession } from '@jbrowse/core/util';
+import { translateTranscript } from '@jbrowse/core/util/translateTranscript';
 import { useFetch } from '../../utils/useFetch';
-import { getProteinSequenceFromFeature } from './calculateProteinSequence';
 import { fetchSeq } from './fetchSeq';
 export function useFeatureSequence({ view, feature, }) {
     const assemblyName = view?.assemblyNames?.[0];
@@ -18,11 +18,8 @@ export function useFeatureSequence({ view, feature, }) {
     });
     return {
         proteinSequence: sequence && feature
-            ? getProteinSequenceFromFeature({
-                seq: sequence.seq,
-                feature,
-                assemblyGeneticCodeId: sequence.assemblyGeneticCodeId,
-            })
+            ? (translateTranscript({ transcript: feature, ...sequence })?.protein ??
+                '')
             : '',
         sequence,
         error,

package/dist/LaunchMsaView/launchTarget.test.js

@@ -52,7 +52,7 @@ describe('launchTarget', () => {
     test('offers nothing when nothing was clicked', () => {
         expect(launchTarget({ contextMenuItems: () => [] })).toBeUndefined();
     });
-    // v3.7.0 hosts have contextMenuFeature and nothing else; dropping this
+    // v4.3.0 and earlier have contextMenuFeature and nothing else; dropping this
     // fallback once took "Launch MSA view" off every host in the wild.
     test('falls back to a synchronous contextMenuFeature', () => {
         const target = launchTarget(legacyHost(feature('mRNA')));

package/dist/LaunchMsaView/util.d.ts

@@ -7,7 +7,6 @@ export declare function getTranscriptLength(feature: Feature): {
     mod: number;
 };
 export declare function getId(val?: Feature): string;
-export declare function getMatchableIds(val?: Feature): string[];
 export declare function featureMatchesId(feature: Feature, id: string): boolean;
 export declare function getTranscriptDisplayName(val?: Feature): string;
 export declare function getGeneDisplayName(val?: Feature): string;

package/dist/LaunchMsaView/util.js

@@ -39,7 +39,7 @@ export function getTranscriptLength(feature) {
 export function getId(val) {
     return val?.id() ?? '';
 }
-export function getMatchableIds(val) {
+function getMatchableIds(val) {
     return val
         ? uniqueDefined([
             val.id(),

package/dist/MsaViewPanel/afterCreateAutoruns.d.ts

@@ -1,20 +1,11 @@
 import type { JBrowsePluginMsaViewModel } from './model';
 export declare function loadStoredData(self: JBrowsePluginMsaViewModel): void;
 /**
- * Keep IndexedDB holding what the view holds. The first run writes a new row and
- * records its id in the session snapshot; later runs update that row, because
- * the alignment keeps changing after it arrives — react-msaview's
- * "calculate neighbor-joining tree" replaces `data.tree` — and a session
- * reopened against a stale row restores the wrong picture.
- *
- * `lastStoredData` is what makes that safe to run on every data change: it is
- * the only thing separating "this is new" from "this is what we just wrote", and
- * it is recorded whether or not the write succeeded, so a browser refusing
- * IndexedDB (private mode) fails once rather than in a loop.
- *
- * A view whose data comes from a filehandle -- or from the indexed block its
- * kept `init` names -- stores nothing at all: the file is the source of truth
- * and it is refetched at startup.
+ * Keep IndexedDB holding `unsavedDocuments`. A view writes in place only to a
+ * row it created (`ownsDataStoreRow`), and never deletes one, since other
+ * views may name it: an emptied set drops the id and cleanupOldData ages the
+ * row out. `lastStoredData` is recorded even when a write fails, so a browser
+ * refusing IndexedDB fails once rather than in a loop.
  */
 export declare function storeDataToIndexedDB(self: JBrowsePluginMsaViewModel): void;
 /**