@teselagen/sequence-utils 0.3.7 → 0.3.8

package/package.json

@@ -1,7 +1,6 @@
 {
   "name": "@teselagen/sequence-utils",
-  "version": "0.3.7",
-  "type": "commonjs",
+  "version": "0.3.8",
   "dependencies": {
     "@teselagen/range-utils": "0.3.7",
     "bson-objectid": "^2.0.4",

package/src/addGapsToSeqReads.js

@@ -1,6 +1,6 @@
 import insertGapsIntoRefSeq from "./insertGapsIntoRefSeq.js";
 
-import {cloneDeep} from "lodash";
+import { cloneDeep } from "lodash";
 
 // bam.seq: NTGTAAGTCGTGAAAAAANCNNNCATATTNCGGAGGTAAAAATGAAAA...
 // bam.pos: 43
@@ -414,4 +414,4 @@ export default function addGapsToSeqReads(refSeq, seqReads) {
   // seqReadsWithGaps is an array of objects containing the ref seq with gaps first and then all seq reads with gaps
   // e.g. [{ name: "ref seq", sequence: "GG---GA--GA-C--A---CC---"}, { name: "r1", sequence: "-----GATTGA-C-----------"}...]
   return seqReadsWithGaps;
-};
+}

package/src/adjustAnnotationsToInsert.js

@@ -1,5 +1,5 @@
-import {adjustRangeToInsert} from "@teselagen/range-utils";
-import {map} from "lodash";
+import { adjustRangeToInsert } from "@teselagen/range-utils";
+import { map } from "lodash";
 
 export default function adjustAnnotationsToInsert(
   annotationsToBeAdjusted,
@@ -16,4 +16,4 @@ export default function adjustAnnotationsToInsert(
       })
     };
   });
-};
+}

package/src/adjustBpsToReplaceOrInsert.js

@@ -3,7 +3,7 @@ import {
   getSequenceWithinRange,
   getRangeLength,
   invertRange,
-  isPositionWithinRange,
+  isPositionWithinRange
 } from "@teselagen/range-utils";
 
 import spliceString from "string-splice";
@@ -11,7 +11,7 @@ import spliceString from "string-splice";
 export default function adjustBpsToReplaceOrInsert(
   bpString,
   insertString = "",
-  caretPositionOrRange,
+  caretPositionOrRange
 ) {
   let stringToReturn = bpString;
 
@@ -47,4 +47,4 @@ export default function adjustBpsToReplaceOrInsert(
     );
   }
   return stringToReturn;
-};
+}

package/src/adjustBpsToReplaceOrInsert.test.js

@@ -1,6 +1,5 @@
 //tnr: half finished test.
 
-
 import chai from "chai";
 import chaiSubset from "chai-subset";
 

package/src/aminoAcidToDnaRna.test.js

@@ -1,4 +1,4 @@
-import {expect} from "chai";
+import { expect } from "chai";
 import getDegenerateDnaStringFromAAString from "./getDegenerateDnaStringFromAAString";
 import getDegenerateRnaStringFromAAString from "./getDegenerateRnaStringFromAAString";
 

package/src/annotateSingleSeq.js

@@ -1,4 +1,4 @@
-import {autoAnnotate} from "./autoAnnotate";
+import { autoAnnotate } from "./autoAnnotate";
 
 function annotateSingleSeq({ fullSeq, searchSeq }) {
   const fullSeqId = fullSeq.id || "fullSeqId";

package/src/annotateSingleSeq.test.js

@@ -1,5 +1,5 @@
 import annotateSingleSeq from "./annotateSingleSeq";
-import {expect} from "chai";
+import { expect } from "chai";
 
 describe("annotateSingleSeq", () => {
   it(`regexes work - correctly annotates a single seq with a regex annotation`, () => {
@@ -20,7 +20,6 @@ describe("annotateSingleSeq", () => {
         }
       ]
     });
-
   });
   it(`correctly annotates a single seq with multiple matches`, () => {
     const results = annotateSingleSeq({
@@ -46,7 +45,6 @@ describe("annotateSingleSeq", () => {
         }
       ]
     });
-
   });
   it(`correctly finds no matches when there are none`, () => {
     const results = annotateSingleSeq({
@@ -59,6 +57,5 @@ describe("annotateSingleSeq", () => {
     expect(results).to.deep.eq({
       matches: []
     });
-
   });
 });

package/src/autoAnnotate.js

@@ -1,8 +1,11 @@
 /* Copyright (C) 2018 TeselaGen Biotechnology, Inc. */
-import {forEach, omitBy} from "lodash";
+import { forEach, omitBy } from "lodash";
 import { ambiguous_dna_values } from "./bioData";
 import aminoAcidToDegenerateDnaMap from "./aminoAcidToDegenerateDnaMap";
-import {normalizePositionByRangeLength, reversePositionInRange} from "@teselagen/range-utils";
+import {
+  normalizePositionByRangeLength,
+  reversePositionInRange
+} from "@teselagen/range-utils";
 import getReverseComplementSequenceString from "./getReverseComplementSequenceString";
 
 //seqsToAnnotateById must not be length = 0

package/src/autoAnnotate.test.js

@@ -1,7 +1,11 @@
 /* eslint-disable no-unused-expressions */
-import {autoAnnotate, convertApELikeRegexToRegex, convertProteinSeqToDNAIupac} from "./autoAnnotate";
+import {
+  autoAnnotate,
+  convertApELikeRegexToRegex,
+  convertProteinSeqToDNAIupac
+} from "./autoAnnotate";
 
-import {expect} from "chai";
+import { expect } from "chai";
 
 describe("convertApELikeRegexToRegex", () => {
   it(`converts as expected`, () => {
@@ -26,7 +30,6 @@ describe("convertApELikeRegexToRegex", () => {
     expect(convertApELikeRegexToRegex("CATTT<ATTT")).to.eq(
       "(CATTT|ATTT|TTT|TT|T)?ATTT"
     );
-
   });
 
   it(`errors as expected`, () => {
@@ -35,7 +38,6 @@ describe("convertApELikeRegexToRegex", () => {
     } catch (e) {
       expect(e).to.exist;
     }
-
   });
   it(`errors as expected`, () => {
     try {
@@ -43,7 +45,6 @@ describe("convertApELikeRegexToRegex", () => {
     } catch (e) {
       expect(e).to.exist;
     }
-
   });
   it(`errors as expected`, () => {
     try {
@@ -51,7 +52,6 @@ describe("convertApELikeRegexToRegex", () => {
     } catch (e) {
       expect(e).to.exist;
     }
-
   });
   it(`errors as expected`, () => {
     try {
@@ -59,7 +59,6 @@ describe("convertApELikeRegexToRegex", () => {
     } catch (e) {
       expect(e).to.exist;
     }
-
   });
 });
 describe("autoAnnotate", () => {
@@ -105,7 +104,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`IUPAC # works - T#C should capture part of AAAATTTTGGGGGCCCCCAAGT`, () => {
     const results = autoAnnotate({
@@ -146,7 +144,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`IUPAC # works - T#C<AAG should capture part of AAAATTTTGGGGGCCCCCAAGT`, () => {
     const results = autoAnnotate({
@@ -180,7 +177,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`IUPAC > works - CAA>ATT should capture all of CAAATT`, () => {
     const results = autoAnnotate({
@@ -214,7 +210,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`IUPAC > works - CAA>ATT should capture part of CAAATG`, () => {
     const results = autoAnnotate({
@@ -248,7 +243,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`complex IUPAC works - correctly auto annotates a single seq with a regex annotation`, () => {
     const results = autoAnnotate({
@@ -281,7 +275,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`another IUPAC works ccc<cTTT - correctly auto annotates a single seq with a regex annotation`, () => {
     const results = autoAnnotate({
@@ -315,7 +308,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`long iupac < works - correctly auto annotates a single seq with a regex annotation`, () => {
     const convertReg = convertApELikeRegexToRegex(
@@ -393,7 +385,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
 
   it(`correctly auto annotates a single dna seq with a single protein annotation`, () => {
@@ -440,7 +431,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`correctly auto annotates a single seq with a single annotation`, () => {
     const results = autoAnnotate({
@@ -501,7 +491,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`correctly auto annotates a single seq with a full spanning annotation`, () => {
     const results = autoAnnotate({
@@ -524,7 +513,6 @@ describe("autoAnnotate", () => {
     expect(results).to.deep.eq({
       21: [{ id: 31, strand: 1, start: 0, end: 6 }]
     });
-
   });
   it(`a "warning threshold" works as expected`, () => {
     const results = autoAnnotate({
@@ -594,7 +582,6 @@ describe("autoAnnotate", () => {
         21: ["31"]
       }
     });
-
   });
   it(`correctly does not auto annotate two seqs when an annotation spans them`, () => {
     const results = autoAnnotate({
@@ -620,7 +607,6 @@ describe("autoAnnotate", () => {
     });
     //this should return an object keyed by the sequence id with the list of annotations to create
     expect(results).to.deep.eq({});
-
   });
   it(`correctly auto annotates two seqs when an annotation spans the origin on the 2nd seq`, () => {
     const results = autoAnnotate({
@@ -656,7 +642,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`correctly auto annotates two seq when the casing on the annotation and seq is wonky`, () => {
     const results = autoAnnotate({
@@ -693,7 +678,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
 
   it(`correctly auto annotates a 1 bp seq`, () => {
@@ -725,7 +709,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`correctly does not auto annotate a 1 bp seq when a feature already spans that seq`, () => {
     const results = autoAnnotate({
@@ -748,7 +731,6 @@ describe("autoAnnotate", () => {
     });
     //this should return an object keyed by the sequence id with the list of annotations to create
     expect(results).to.deep.eq({});
-
   });
   it(`correctly auto annotates a 1 bp seq when compareName:true when a feature with a different name already spans that seq`, () => {
     const results = autoAnnotate({
@@ -781,7 +763,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`correctly does not auto annotate several seqs when annotations already span those seqs`, () => {
     const results = autoAnnotate({
@@ -819,7 +800,6 @@ describe("autoAnnotate", () => {
     });
     //this should return an object keyed by the sequence id with the list of annotations to create
     expect(results).to.deep.eq({});
-
   });
   it(`correctly auto annotates two seqs when a annotation spans the origin on the 2nd seq on the negative strand`, () => {
     const results = autoAnnotate({
@@ -859,7 +839,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`correctly auto annotates a seq when an annotation matches multiple times overlapping`, () => {
     const results = autoAnnotate({
@@ -894,7 +873,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`correctly auto annotates two seqs when an annotation matches multiple times overlapping on the 2nd seq`, () => {
     const results = autoAnnotate({
@@ -942,7 +920,6 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
   it(`correctly auto annotates multiple sequences and multiple annotations`, () => {
     const results = autoAnnotate({
@@ -1034,6 +1011,5 @@ describe("autoAnnotate", () => {
         }
       ]
     });
-
   });
 });