@teselagen/sequence-utils 0.3.25 → 0.3.26

package/index.cjs

@@ -18359,12 +18359,19 @@ function getReverseComplementAminoAcidStringFromSequenceString(sequenceString) {
 }
 __name(getReverseComplementAminoAcidStringFromSequenceString, "getReverseComplementAminoAcidStringFromSequenceString");
 function getReverseComplementAnnotation(annotation, sequenceLength) {
-  return Object.assign({}, annotation, {
+  return Object.assign({}, annotation, __spreadValues({
     start: sequenceLength - (annotation.end + 1),
     end: sequenceLength - (annotation.start + 1),
     forward: !annotation.forward,
     strand: annotation.strand === 1 ? -1 : 1
-  });
+  }, annotation.locations && {
+    locations: annotation.locations.map((location) => {
+      return {
+        start: sequenceLength - (location.end + 1),
+        end: sequenceLength - (location.start + 1)
+      };
+    })
+  }));
 }
 __name(getReverseComplementAnnotation, "getReverseComplementAnnotation");
 function getReverseComplementSequenceAndAnnoations(pSeqObj, options = {}) {

package/index.js

@@ -18357,12 +18357,19 @@ function getReverseComplementAminoAcidStringFromSequenceString(sequenceString) {
 }
 __name(getReverseComplementAminoAcidStringFromSequenceString, "getReverseComplementAminoAcidStringFromSequenceString");
 function getReverseComplementAnnotation(annotation, sequenceLength) {
-  return Object.assign({}, annotation, {
+  return Object.assign({}, annotation, __spreadValues({
     start: sequenceLength - (annotation.end + 1),
     end: sequenceLength - (annotation.start + 1),
     forward: !annotation.forward,
     strand: annotation.strand === 1 ? -1 : 1
-  });
+  }, annotation.locations && {
+    locations: annotation.locations.map((location) => {
+      return {
+        start: sequenceLength - (location.end + 1),
+        end: sequenceLength - (location.start + 1)
+      };
+    })
+  }));
 }
 __name(getReverseComplementAnnotation, "getReverseComplementAnnotation");
 function getReverseComplementSequenceAndAnnoations(pSeqObj, options = {}) {

package/index.umd.cjs

@@ -18361,12 +18361,19 @@ var __name = (target, value) => __defProp(target, "name", { value, configurable:
   }
   __name(getReverseComplementAminoAcidStringFromSequenceString, "getReverseComplementAminoAcidStringFromSequenceString");
   function getReverseComplementAnnotation(annotation, sequenceLength) {
-    return Object.assign({}, annotation, {
+    return Object.assign({}, annotation, __spreadValues({
       start: sequenceLength - (annotation.end + 1),
       end: sequenceLength - (annotation.start + 1),
       forward: !annotation.forward,
       strand: annotation.strand === 1 ? -1 : 1
-    });
+    }, annotation.locations && {
+      locations: annotation.locations.map((location) => {
+        return {
+          start: sequenceLength - (location.end + 1),
+          end: sequenceLength - (location.start + 1)
+        };
+      })
+    }));
   }
   __name(getReverseComplementAnnotation, "getReverseComplementAnnotation");
   function getReverseComplementSequenceAndAnnoations(pSeqObj, options = {}) {

package/package.json

@@ -1,6 +1,6 @@
 {
   "name": "@teselagen/sequence-utils",
-  "version": "0.3.25",
+  "version": "0.3.26",
   "dependencies": {
     "@teselagen/range-utils": "0.3.7",
     "bson-objectid": "^2.0.4",

package/src/calculateNebTm.test.js

@@ -8,7 +8,6 @@ describe("calculate Tm based on SantaLucia 1998 & Owczarzy 2004", () => {
       // 50 mM KCl in Q5 protocol
       monovalentCationConc: 0.05,
       primerConc: 0.0000005
-
     };
     // console.log(`calculateNebTm("AGCGGATAACAATTTCACACAGGA", options),:`,calculateNebTm("AGCGGATAACAATTTCACACAGGA", options),)
     // console.log(`calculateTm("AGCGGATAACAATTTCACACAGGA", options),:`,calculateTm("AGCGGATAACAATTTCACACAGGA", options),)

package/src/getReverseComplementAnnotation.js

@@ -18,6 +18,14 @@ export default function getReverseComplementAnnotation(
     start: sequenceLength - (annotation.end + 1),
     end: sequenceLength - (annotation.start + 1),
     forward: !annotation.forward,
-    strand: annotation.strand === 1 ? -1 : 1
+    strand: annotation.strand === 1 ? -1 : 1,
+    ...(annotation.locations && {
+      locations: annotation.locations.map(location => {
+        return {
+          start: sequenceLength - (location.end + 1),
+          end: sequenceLength - (location.start + 1)
+        };
+      })
+    })
   });
 }

package/src/getReverseComplementSequenceAndAnnotations.test.js

@@ -89,6 +89,57 @@ describe("getReverseComplementSequenceAndAnnotations", () => {
       ]
     });
   });
+  it("handles reverse complementing a feature with locations correctly", () => {
+    const newSeq = getReverseComplementSequenceAndAnnotations(
+      {
+        sequence: "aaatttcccgttttttt",
+        //         01234567890123456
+        //          fffffff
+        //          lll  ll
+        // after: 
+        //         65432109876543210          
+        //                  fffffff
+        //                  ll  lll
+        circular: true,
+        features: [
+          {
+            start: 1,
+            end: 7,
+            locations: [
+              {
+                start: 1,
+                end: 3
+              },
+              {
+                start: 6,
+                end: 7
+              }
+            ]
+          }
+        ]
+      },
+    );
+    newSeq.should.containSubset({
+      // sequence: "tttaaacggg",
+      features: [
+        {
+          start: 9,
+          end: 15,
+          forward: true,
+          locations: [
+            {
+              start: 9,
+              end: 10
+            },
+            {
+              start: 13,
+              end: 15
+            }
+          ]
+        }
+      ]
+    });
+  });
   it("handles a range option correctly and reverse complements a subset of the sequence across the origin ", () => {
     const newSeq = getReverseComplementSequenceAndAnnotations(
       {