@teselagen/sequence-utils 0.1.21 → 0.1.23

package/src/autoAnnotate.test.js

@@ -0,0 +1,1039 @@
+/* eslint-disable no-unused-expressions */
+import {autoAnnotate, convertApELikeRegexToRegex, convertProteinSeqToDNAIupac} from "./autoAnnotate";
+
+import {expect} from "chai";
+
+describe("convertApELikeRegexToRegex", () => {
+  it(`converts as expected`, () => {
+    expect(convertApELikeRegexToRegex("TnC")).to.eq("T.C");
+    expect(convertApELikeRegexToRegex("TNC")).to.eq("T.C");
+    expect(convertApELikeRegexToRegex("TBC")).to.eq("T[CGT]C");
+    expect(convertApELikeRegexToRegex("T#C")).to.eq("T[^T]*?C");
+    expect(convertApELikeRegexToRegex("T#C<A")).to.eq("(T[^T]*?C|[^T]*?C|C)?A");
+    expect(convertApELikeRegexToRegex("T(GGGG)GC")).to.eq("TGGGGGC");
+    expect(convertApELikeRegexToRegex("T(#)CC")).to.eq("T[^T]*?CC");
+    expect(convertApELikeRegexToRegex("CA<ATT>TTGAG")).to.eq(
+      "(CA|A)?ATT(TTGAG|TTGA|TTG|TT|T)?"
+    );
+    expect(convertApELikeRegexToRegex("CAA>AT")).to.eq("CAA(AT|A)?");
+    expect(convertApELikeRegexToRegex("CAA>ATT")).to.eq("CAA(ATT|AT|A)?");
+    expect(convertApELikeRegexToRegex("CAA>TBT")).to.eq(
+      "CAA(T[CGT]T|T[CGT]|T)?"
+    );
+    expect(convertApELikeRegexToRegex("CA<ATTT")).to.eq("(CA|A)?ATTT");
+    expect(convertApELikeRegexToRegex("NA<ATTT")).to.eq("(.A|A)?ATTT");
+    expect(convertApELikeRegexToRegex("BA<ATTT")).to.eq("([CGT]A|A)?ATTT");
+    expect(convertApELikeRegexToRegex("CATTT<ATTT")).to.eq(
+      "(CATTT|ATTT|TTT|TT|T)?ATTT"
+    );
+
+  });
+
+  it(`errors as expected`, () => {
+    try {
+      convertApELikeRegexToRegex("T#C<");
+    } catch (e) {
+      expect(e).to.exist;
+    }
+
+  });
+  it(`errors as expected`, () => {
+    try {
+      convertApELikeRegexToRegex("<C<");
+    } catch (e) {
+      expect(e).to.exist;
+    }
+
+  });
+  it(`errors as expected`, () => {
+    try {
+      convertApELikeRegexToRegex(">C>");
+    } catch (e) {
+      expect(e).to.exist;
+    }
+
+  });
+  it(`errors as expected`, () => {
+    try {
+      convertApELikeRegexToRegex(">C#");
+    } catch (e) {
+      expect(e).to.exist;
+    }
+
+  });
+});
+describe("autoAnnotate", () => {
+  //   T#C
+  // AAAATTTTGGGGGCCCCCAAGT
+  // T(GGGG)GC
+  // AAAATTTTGGGGGCCCCCAAGT
+  // T(#)CC
+  // AAAATTTTGGGGGCCCCCAAGT
+  // CA<ATT>TTGAG
+  // AAAATTTTGGGGGCCCCCAAGT
+  // CA<ATTT
+  // AAAATTTTGGGGGCCCCCAAGT
+  it(`regexes work - correctly auto annotates a single seq with a regex annotation`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence: "AAAATTTTGGGGGCCCCCAAGT"
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "TTTT.*CCC",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        //21 = sequenceId
+        //this is the list of new annotations to make
+        {
+          start: 4,
+          end: 17,
+          strand: 1,
+          id: 31
+        }
+      ]
+    });
+
+  });
+  it(`IUPAC # works - T#C should capture part of AAAATTTTGGGGGCCCCCAAGT`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence: "AAAATTTTGGGGGCCCCCAAGT"
+          //        "ACTTGGGGGCCCCCAAAATTTT"
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: convertApELikeRegexToRegex("T#C"),
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        //21 = sequenceId
+        //this is the list of new annotations to make
+        {
+          start: 7,
+          end: 13,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 12,
+          end: 18,
+          strand: -1,
+          id: 31
+        }
+      ]
+    });
+
+  });
+  it(`IUPAC # works - T#C<AAG should capture part of AAAATTTTGGGGGCCCCCAAGT`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence: "AAAATTTTGGGGGCCCCCAAGT"
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: convertApELikeRegexToRegex("T#C<AAG"),
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        //21 = sequenceId
+        //this is the list of new annotations to make
+        {
+          start: 7,
+          end: 20,
+          strand: 1,
+          id: 31
+        }
+      ]
+    });
+
+  });
+  it(`IUPAC > works - CAA>ATT should capture all of CAAATT`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence: "CAAATT"
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: convertApELikeRegexToRegex("CAA>ATT"),
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        //21 = sequenceId
+        //this is the list of new annotations to make
+        {
+          start: 0,
+          end: 5,
+          strand: 1,
+          id: 31
+        }
+      ]
+    });
+
+  });
+  it(`IUPAC > works - CAA>ATT should capture part of CAAATG`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence: "CAAATT"
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: convertApELikeRegexToRegex("CAA>ATT"),
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        //21 = sequenceId
+        //this is the list of new annotations to make
+        {
+          start: 0,
+          end: 5,
+          strand: 1,
+          id: 31
+        }
+      ]
+    });
+
+  });
+  it(`complex IUPAC works - correctly auto annotates a single seq with a regex annotation`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence: "CGCATATTT"
+        }
+      },
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: convertApELikeRegexToRegex("CCAT<ATTT"),
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        //21 = sequenceId
+        //this is the list of new annotations to make
+        {
+          start: 2,
+          end: 8,
+          strand: 1,
+          id: 31
+        }
+      ]
+    });
+
+  });
+  it(`another IUPAC works ccc<cTTT - correctly auto annotates a single seq with a regex annotation`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence: "ccccccTTT"
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: convertApELikeRegexToRegex("ccc<cTTT"),
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        //21 = sequenceId
+        //this is the list of new annotations to make
+        {
+          start: 2,
+          end: 8,
+          strand: 1,
+          id: 31
+        }
+      ]
+    });
+
+  });
+  it(`long iupac < works - correctly auto annotates a single seq with a regex annotation`, () => {
+    const convertReg = convertApELikeRegexToRegex(
+      "gacgtcttatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtc<ctcgc"
+    );
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence:
+            "gacgtcttatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggattctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttgggaatttttaagaaggagatatacatatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgaatacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatctgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctcggcggcggcggcagcaaggtctacggcaaggaacagtttttgcggatgcgccagagcatgttccccgatcgctaaatcgagtaaggatctccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatacctagggtacgggttttgctgcccgcaaacgggctgttctggtgttgctagtttgttatcagaatcgcagatccggcttcagccggtttgccggctgaaagcgctatttcttccagaattgccatgattttttccccacgggaggcgtcactggctcccgtgttgtcggcagctttgattcgataagcagcatcgcctgtttcaggctgtctatgtgtgactgttgagctgtaacaagttgtctcaggtgttcaatttcatgttctagttgctttgttttactggtttcacctgttctattaggtgttacatgctgttcatctgttacattgtcgatctgttcatggtgaacagctttgaatgcaccaaaaactcgtaaaagctctgatgtatctatcttttttacaccgttttcatctgtgcatatggacagttttccctttgatatgtaacggtgaacagttgttctacttttgtttgttagtcttgatgcttcactgatagatacaagagccataagaacctcagatccttccgtatttagccagtatgttctctagtgtggttcgttgtttttgcgtgagccatgagaacgaaccattgagatcatacttactttgcatgtcactcaaaaattttgcctcaaaactggtgagctgaatttttgcagttaaagcatcgtgtagtgtttttcttagtccgttatgtaggtaggaatctgatgtaatggttgttggtattttgtcaccattcatttttatctggttgttctcaagttcggttacgagatccatttgtctatctagttcaacttggaaaatcaacgtatcagtcgggcggcctcgcttatcaaccaccaatttcatattgctgtaagtgtttaaatctttacttattggtttcaaaacccattggttaagccttttaaactcatggtagttattttcaagcattaacatgaacttaaattcatcaaggctaatctctatatttgccttgtgagttttcttttgtgttagttcttttaataaccactcataaatcctcatagagtatttgttttcaaaagacttaacatgttccagattatattttatgaatttttttaactggaaaagataaggcaatatctcttcactaaaaactaattctaatttttcgcttgagaacttggcatagtttgtccactggaaaatctcaaagcctttaaccaaaggattcctgatttccacagttctcgtcatcagctctctggttgctttagctaatacaccataagcattttccctactgatgttcatcatctgagcgtattggttataagtgaacgataccgtccgttctttccttgtagggttttcaatcgtggggttgagtagtgccacacagcataaaattagcttggtttcatgctccgttaagtcatagcgactaatcgctagttcatttgctttgaaaacaactaattcagacatacatctcaattggtctaggtgattttaatcactataccaattgagatgggctagtcaatgataattactagtccttttcccgggtgatctgggtatctgtaaattctgctagacctttgctggaaaacttgtaaattctgctagaccctctgtaaattccgctagacctttgtgtgttttttttgtttatattcaagtggttataatttatagaataaagaaagaataaaaaaagataaaaagaatagatcccagccctgtgtataactcactactttagtcagttccgcagtattacaaaaggatgtcgcaaacgctgtttgctcctctacaaaacagaccttaaaaccctaaaggcttaagtagcaccctcgcaagctcgggcaaatcgctgaatattccttttgtctccgaccatcaggcacctgagtcgctgtctttttcgtgacattcagttcgctgcgctcacggctctggcagtgaatgggggtaaatggcactacaggcgccttttatggattcatgcaaggaaactacccataatacaagaaaagcccgtcacgggcttctcagggcgttttatggcgggtctgctatgtggtgctatctgactttttgctgttcagcagttcctgccctctgattttccagtctgaccacttcggattatcccgtgacaggtcattcagactggctaatgcacccagtaaggcagcggtatcatcaacaggcttacccgtcttactgtccctagtgcttggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagcgagctcgatatcaaattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacgaaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccagatatc"
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: convertReg,
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        {
+          start: 0,
+          end: 205,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 98,
+          end: 102,
+          strand: -1,
+          id: 31
+        },
+        {
+          start: 341,
+          end: 346,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 618,
+          end: 622,
+          strand: -1,
+          id: 31
+        },
+        {
+          start: 972,
+          end: 976,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 3002,
+          end: 3007,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 4006,
+          end: 4011,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 4496,
+          end: 4500,
+          strand: -1,
+          id: 31
+        }
+      ]
+    });
+
+  });
+
+  it(`correctly auto annotates a single dna seq with a single protein annotation`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence:
+            "gatgttgattctatcatctatctggccagatagatgatagaatcgagcatcgattctatcatctatctgtactatcgattctatcatctatctga",
+          // "DVDSIIYLAR*MIESSIDSIIYLYYRFYHLS"
+          //   tcagatagatgatagaatcgatagtacagatagatgatagaatcgatgctcgattctatcatctatctggccagatagatgatagaatcaacatc
+          annotations: [
+            {
+              start: 5,
+              end: 11
+            }
+          ]
+        }
+      },
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          matchType: "protein",
+          sequence: convertApELikeRegexToRegex(
+            convertProteinSeqToDNAIupac("MIESSIDSIIYL")
+          ),
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        //21 = sequenceId
+        //this is the list of new annotations to make
+        {
+          start: 33,
+          end: 68,
+          strand: 1,
+          id: 31
+        }
+      ]
+    });
+
+  });
+  it(`correctly auto annotates a single seq with a single annotation`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence:
+            "gatgttgattctatcatctatctggccagatagatgatagaatcgagcatcgattctatcatctatctgtactatcgattctatcatctatctga",
+          //   tcagatagatgatagaatcgatagtacagatagatgatagaatcgatgctcgattctatcatctatctggccagatagatgatagaatcaacatc
+          annotations: [
+            {
+              start: 5,
+              end: 11
+            }
+          ]
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "gattctatcatctatctg", //cagatagatgatagaatc <-- rev comp
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+
+    expect(results).to.not.be.undefined;
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        //21 = sequenceId
+        //this is the list of new annotations to make
+        {
+          start: 6,
+          end: 23,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 26,
+          end: 43,
+          strand: -1,
+          id: 31
+        },
+        {
+          start: 51,
+          end: 68,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 76,
+          end: 93,
+          strand: 1,
+          id: 31
+        }
+      ]
+    });
+
+  });
+  it(`correctly auto annotates a single seq with a full spanning annotation`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence: "ttttttt"
+        }
+      },
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "ttttttt",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [{ id: 31, strand: 1, start: 0, end: 6 }]
+    });
+
+  });
+  it(`a "warning threshold" works as expected`, () => {
+    const results = autoAnnotate({
+      warnIfMoreThan: 5,
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence: "ttttttt"
+        }
+      },
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "t",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        {
+          start: 0,
+          end: 0,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 1,
+          end: 1,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 2,
+          end: 2,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 3,
+          end: 3,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 4,
+          end: 4,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 5,
+          end: 5,
+          strand: 1,
+          id: 31
+        },
+        {
+          start: 6,
+          end: 6,
+          strand: 1,
+          id: 31
+        }
+      ],
+      __more_than_warnings: {
+        21: ["31"]
+      }
+    });
+
+  });
+  it(`correctly does not auto annotate two seqs when an annotation spans them`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence: "ttttttt"
+        },
+        22: {
+          id: 22,
+          sequence: "aaaaaaa"
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "tttaaa",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({});
+
+  });
+  it(`correctly auto annotates two seqs when an annotation spans the origin on the 2nd seq`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          circular: true,
+          id: 21,
+          sequence: "ttttttt"
+        },
+        22: {
+          circular: true,
+          id: 22,
+          sequence: "aaaaaaaattg"
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "attga",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    expect(results).to.deep.eq({
+      22: [
+        {
+          start: 7,
+          end: 0,
+          strand: 1,
+          id: 31
+        }
+      ]
+    });
+
+  });
+  it(`correctly auto annotates two seq when the casing on the annotation and seq is wonky`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          circular: true,
+          id: 21,
+          sequence: "ttttTtt"
+        },
+        22: {
+          circular: true,
+          id: 22,
+          sequence: "aAaaaaaaTtg"
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "atTgA",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      22: [
+        {
+          id: 31,
+          strand: 1,
+          start: 7,
+          end: 0
+        }
+      ]
+    });
+
+  });
+
+  it(`correctly auto annotates a 1 bp seq`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          circular: true,
+          id: 21,
+          sequence: "t"
+        }
+      },
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "t",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        {
+          id: 31,
+          strand: 1,
+          start: 0,
+          end: 0
+        }
+      ]
+    });
+
+  });
+  it(`correctly does not auto annotate a 1 bp seq when a feature already spans that seq`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          circular: true,
+          id: 21,
+          sequence: "t",
+          annotations: [{ start: 0, end: 0 }]
+        }
+      },
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "t",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({});
+
+  });
+  it(`correctly auto annotates a 1 bp seq when compareName:true when a feature with a different name already spans that seq`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          circular: true,
+          id: 21,
+          sequence: "t",
+          annotations: [{ start: 0, end: 0, name: "someothername" }]
+        }
+      },
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "t",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      },
+      compareName: true
+    });
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      21: [
+        {
+          id: 31,
+          strand: 1,
+          start: 0,
+          end: 0
+        }
+      ]
+    });
+
+  });
+  it(`correctly does not auto annotate several seqs when annotations already span those seqs`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          circular: true,
+          id: 21,
+          sequence: "t",
+          annotations: [{ start: 0, end: 0, strand: 1 }]
+        },
+        22: {
+          circular: true,
+          id: 22,
+          sequence: "gggggt",
+          annotations: [
+            { start: 3, end: 5 },
+            { start: 5, end: 5 }
+          ]
+        }
+      },
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "t",
+          name: "ann1",
+          type: "misc_feature"
+        },
+        32: {
+          id: 32,
+          sequence: "ggt",
+          name: "ann2",
+          type: "misc_feature"
+        }
+      }
+    });
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({});
+
+  });
+  it(`correctly auto annotates two seqs when a annotation spans the origin on the 2nd seq on the negative strand`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          circular: true,
+          id: 21,
+          sequence: "ttttttt"
+        },
+        22: {
+          circular: true, //
+          id: 22, //01234567890
+          //caat      t
+          sequence: "aaaaaaaattg" //caatttttttt
+          //aaaaaaaattg
+          //a      attg
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "tcaat",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    //this should return an object keyed by the sequence id with the list of annotations to create
+    expect(results).to.deep.eq({
+      22: [
+        {
+          id: 31,
+          strand: -1,
+          start: 7,
+          end: 0
+        }
+      ]
+    });
+
+  });
+  it(`correctly auto annotates a seq when an annotation matches multiple times overlapping`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        22: {
+          id: 22,
+          sequence: "aaaaa"
+        }
+      },
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "aaaa",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    expect(results).to.deep.eq({
+      22: [
+        {
+          id: 31,
+          strand: 1,
+          start: 0,
+          end: 3
+        },
+        {
+          id: 31,
+          strand: 1,
+          start: 1,
+          end: 4
+        }
+      ]
+    });
+
+  });
+  it(`correctly auto annotates two seqs when an annotation matches multiple times overlapping on the 2nd seq`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        20: {
+          id: 20,
+          sequence: "aaaagg"
+        },
+        22: {
+          id: 22,
+          sequence: "aaaaa"
+        }
+      },
+
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "aaaa",
+          name: "ann1",
+          type: "misc_feature"
+        }
+      }
+    });
+    expect(results).to.deep.eq({
+      20: [
+        {
+          id: 31,
+          strand: 1,
+          start: 0,
+          end: 3
+        }
+      ],
+      22: [
+        {
+          id: 31,
+          strand: 1,
+          start: 0,
+          end: 3
+        },
+        {
+          id: 31,
+          strand: 1,
+          start: 1,
+          end: 4
+        }
+      ]
+    });
+
+  });
+  it(`correctly auto annotates multiple sequences and multiple annotations`, () => {
+    const results = autoAnnotate({
+      seqsToAnnotateById: {
+        21: {
+          id: 21,
+          sequence: "gatgttgattctatcatctatctggcgagcatctactatca",
+          annotations: [
+            {
+              strand: -1, //this annotation should not be matched cause it is on the reverse strand!
+              start: 5,
+              end: 11
+            }
+          ]
+        },
+        45: {
+          id: 45,
+          circular: true,
+          sequence:
+            "gatgttgattctatcgtttttttttttaaaaaaagatgttgattctatcgtttttttttttaaaaaaactggcgagcatctactatca"
+        }
+      },
+      annotationsToCheckById: {
+        31: {
+          id: 31,
+          sequence: "ttttttttttaaaaa" //tttttaaaaaaaaaa
+        },
+        84: {
+          id: 84,
+          sequence: "tgattct", //agaatca
+          name: "zoink1"
+        },
+        90: {
+          id: 90,
+          sequence: "ctatcagatgttg" //crosses the origin on seq45 //caacatctgatag
+        },
+        91: {
+          id: 91,
+          sequence: "ctcgccagatagatga" //tcatctatctggcgag revcomp on 21
+        }
+      }
+    });
+    expect(results).to.not.be.undefined;
+    expect(results).to.deep.eq({
+      21: [
+        {
+          strand: 1,
+          start: 5,
+          end: 11,
+          id: 84
+        },
+        {
+          strand: -1,
+          start: 13,
+          end: 28,
+          id: 91
+        }
+      ],
+      45: [
+        {
+          strand: 1,
+          start: 5,
+          end: 11,
+          id: 84
+        },
+        {
+          strand: 1,
+          start: 17,
+          end: 31,
+          id: 31
+        },
+        {
+          strand: 1,
+          start: 39,
+          end: 45,
+          id: 84
+        },
+        {
+          strand: 1,
+          start: 51,
+          end: 65,
+          id: 31
+        },
+        {
+          strand: 1,
+          start: 82,
+          end: 6,
+          id: 90
+        }
+      ]
+    });
+
+  });
+});