@teselagen/ove 0.0.8 → 0.0.13
This diff represents the content of publicly available package versions that have been released to one of the supported registries. The information contained in this diff is provided for informational purposes only and reflects changes between package versions as they appear in their respective public registries.
- package/UMDDemo.html +104 -0
- package/index.mjs +60143 -32172
- package/index.umd.js +85611 -57649
- package/package.json +1 -1
- package/index.js +0 -165245
    
        package/UMDDemo.html
    ADDED
    
    | @@ -0,0 +1,104 @@ | |
| 1 | 
            +
            <html>
         | 
| 2 | 
            +
              <head>
         | 
| 3 | 
            +
                <link
         | 
| 4 | 
            +
                  rel="stylesheet"
         | 
| 5 | 
            +
                  type="text/css"
         | 
| 6 | 
            +
                  href="https://unpkg.com/@teselagen/ove/style.css"
         | 
| 7 | 
            +
                />
         | 
| 8 | 
            +
              </head>
         | 
| 9 | 
            +
              <body style="display: flex">
         | 
| 10 | 
            +
                <a id="backButton"> Back </a>  
         | 
| 11 | 
            +
                <script
         | 
| 12 | 
            +
                  type="text/javascript"
         | 
| 13 | 
            +
                  src="https://unpkg.com/@teselagen/ove/index.umd.js"
         | 
| 14 | 
            +
                ></script>
         | 
| 15 | 
            +
                <script type="text/javascript">
         | 
| 16 | 
            +
                  const hrefToUse = window.location.href.includes("localhost")
         | 
| 17 | 
            +
                    ? `${window.location.origin}/#/Editor`
         | 
| 18 | 
            +
                    : "https://teselagen.github.io/tg-oss/ove-demo/";
         | 
| 19 | 
            +
             | 
| 20 | 
            +
                  document.getElementById("backButton").setAttribute("href", hrefToUse);
         | 
| 21 | 
            +
                  const editor = window.createVectorEditor("createDomNodeForMe", {
         | 
| 22 | 
            +
                    withPreviewMode: true,
         | 
| 23 | 
            +
                    editorName: "FirstSequence",
         | 
| 24 | 
            +
                    showMenuBar: true
         | 
| 25 | 
            +
                  });
         | 
| 26 | 
            +
                  /* createDomNodeForMe will make a dom node for you and append it to the document.body*/
         | 
| 27 | 
            +
                  editor.updateEditor({
         | 
| 28 | 
            +
                    sequenceData: {
         | 
| 29 | 
            +
                      circular: true,
         | 
| 30 | 
            +
                      sequence:
         | 
| 31 | 
            +
                        "gtagagagagagtgagcccgacccccgtagagagagagtgagcccgacccccgtagagagagagtgagcccgacccccgtagagagagagtgagcccgaccccc",
         | 
| 32 | 
            +
                      features: [
         | 
| 33 | 
            +
                        {
         | 
| 34 | 
            +
                          id: "2oi452",
         | 
| 35 | 
            +
                          name: "I'm a feature :)",
         | 
| 36 | 
            +
                          start: 10,
         | 
| 37 | 
            +
                          end: 20
         | 
| 38 | 
            +
                        }
         | 
| 39 | 
            +
                      ]
         | 
| 40 | 
            +
                    }
         | 
| 41 | 
            +
                  });
         | 
| 42 | 
            +
                  const editor2 = window.createVectorEditor("createDomNodeForMe", {
         | 
| 43 | 
            +
                    withPreviewMode: true,
         | 
| 44 | 
            +
                    showMenuBar: true,
         | 
| 45 | 
            +
                    editorName: "AnotherSequence"
         | 
| 46 | 
            +
                  });
         | 
| 47 | 
            +
                  /* createDomNodeForMe will make a dom node for you and append it to the document.body*/
         | 
| 48 | 
            +
                  editor2.updateEditor({
         | 
| 49 | 
            +
                    sequenceData: {
         | 
| 50 | 
            +
                      name: "Another Sequence",
         | 
| 51 | 
            +
                      circular: false,
         | 
| 52 | 
            +
                      sequence: "gtaacccccc",
         | 
| 53 | 
            +
                      features: [
         | 
| 54 | 
            +
                        {
         | 
| 55 | 
            +
                          id: "agog98",
         | 
| 56 | 
            +
                          name: "2nd Feature",
         | 
| 57 | 
            +
                          type: "CDS",
         | 
| 58 | 
            +
                          start: 1,
         | 
| 59 | 
            +
                          end: 5
         | 
| 60 | 
            +
                        }
         | 
| 61 | 
            +
                      ]
         | 
| 62 | 
            +
                    }
         | 
| 63 | 
            +
                  });
         | 
| 64 | 
            +
                  const editor3 = window.createVectorEditor("createDomNodeForMe", {
         | 
| 65 | 
            +
                    withPreviewMode: true,
         | 
| 66 | 
            +
                    showMenuBar: true,
         | 
| 67 | 
            +
                    editorName: "YetAnotherSequence"
         | 
| 68 | 
            +
                  });
         | 
| 69 | 
            +
                  /* createDomNodeForMe will make a dom node for you and append it to the document.body*/
         | 
| 70 | 
            +
                  editor3.updateEditor({
         | 
| 71 | 
            +
                    sequenceData: {
         | 
| 72 | 
            +
                      name: "Wait for Me!",
         | 
| 73 | 
            +
                      circular: true,
         | 
| 74 | 
            +
                      sequence:
         | 
| 75 | 
            +
                        "gtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaacccccc",
         | 
| 76 | 
            +
                      features: [
         | 
| 77 | 
            +
                        {
         | 
| 78 | 
            +
                          id: "19f0fjj",
         | 
| 79 | 
            +
                          name: "abcd",
         | 
| 80 | 
            +
                          type: "RBS",
         | 
| 81 | 
            +
                          start: 1,
         | 
| 82 | 
            +
                          end: 5
         | 
| 83 | 
            +
                        },
         | 
| 84 | 
            +
             | 
| 85 | 
            +
                        {
         | 
| 86 | 
            +
                          id: "24t2t",
         | 
| 87 | 
            +
                          name: "pj1",
         | 
| 88 | 
            +
                          type: "CDS",
         | 
| 89 | 
            +
                          start: 10,
         | 
| 90 | 
            +
                          end: 50
         | 
| 91 | 
            +
                        },
         | 
| 92 | 
            +
                        {
         | 
| 93 | 
            +
                          id: "82020000",
         | 
| 94 | 
            +
                          name: "pj3",
         | 
| 95 | 
            +
                          type: "CDS",
         | 
| 96 | 
            +
                          start: 10,
         | 
| 97 | 
            +
                          end: 50
         | 
| 98 | 
            +
                        }
         | 
| 99 | 
            +
                      ]
         | 
| 100 | 
            +
                    }
         | 
| 101 | 
            +
                  });
         | 
| 102 | 
            +
                </script>
         | 
| 103 | 
            +
              </body>
         | 
| 104 | 
            +
            </html>
         |