@teselagen/ove 0.0.14 → 0.0.16
This diff represents the content of publicly available package versions that have been released to one of the supported registries. The information contained in this diff is provided for informational purposes only and reflects changes between package versions as they appear in their respective public registries.
- package/index.umd.js +164825 -135871
- package/package.json +78 -9
- package/src/AlignmentTool/index.js +16 -0
- package/src/AlignmentView/AlignmentVisibilityTool.js +105 -0
- package/src/AlignmentView/EditTrackNameDialog.js +34 -0
- package/src/AlignmentView/HorizontalPanelDragHandle.js +35 -0
- package/src/AlignmentView/Minimap.js +520 -0
- package/src/AlignmentView/Mismatches.js +134 -0
- package/src/AlignmentView/PairwiseAlignmentView.js +68 -0
- package/src/AlignmentView/PerformantSelectionLayer.js +32 -0
- package/src/AlignmentView/coerceInitialValue.js +7 -0
- package/src/AlignmentView/getGapMap.js +12 -0
- package/src/AlignmentView/getGaps.js +27 -0
- package/src/AlignmentView/getPairwiseOverviewLinearViewOptions.js +38 -0
- package/src/AlignmentView/getTrackFromEvent.js +25 -0
- package/src/AlignmentView/index.js +2058 -0
- package/src/AlignmentView/isTargetWithinEl.js +6 -0
- package/src/AlignmentView/style.css +100 -0
- package/src/AlignmentView/updateTrackHelper.js +58 -0
- package/src/AutoAnnotate.js +500 -0
- package/src/AutoAnnotateBpMatchingDialog.js +208 -0
- package/src/CircularView/Axis.js +40 -0
- package/src/CircularView/AxisNumbers.js +35 -0
- package/src/CircularView/Caret.js +63 -0
- package/src/CircularView/CircularDnaSequence.js +73 -0
- package/src/CircularView/CircularZoomMinimap.js +16 -0
- package/src/CircularView/Cutsite.js +18 -0
- package/src/CircularView/Cutsites.js +113 -0
- package/src/CircularView/DeletionLayer.js +28 -0
- package/src/CircularView/Feature.js +83 -0
- package/src/CircularView/Labels/index.js +536 -0
- package/src/CircularView/Labels/relaxLabelAngles.js +157 -0
- package/src/CircularView/Labels/relaxLabels_DEPRECATED.js +105 -0
- package/src/CircularView/Labels/style.css +55 -0
- package/src/CircularView/Orf.js +25 -0
- package/src/CircularView/Part.js +34 -0
- package/src/CircularView/PositionAnnotationOnCircle.js +26 -0
- package/src/CircularView/Primer.js +41 -0
- package/src/CircularView/RotateCircularViewSlider.js +82 -0
- package/src/CircularView/SelectionLayer.js +132 -0
- package/src/CircularView/VeTopRightContainer.js +12 -0
- package/src/CircularView/ZoomCircularViewSlider.js +62 -0
- package/src/CircularView/drawAnnotations.js +433 -0
- package/src/CircularView/drawDirectedPiePiece.js +142 -0
- package/src/CircularView/getAngleForPositionMidpoint.js +3 -0
- package/src/CircularView/getInternalLabel.js +40 -0
- package/src/CircularView/getRangeAnglesSpecial.js +12 -0
- package/src/CircularView/getYOffset.js +15 -0
- package/src/CircularView/index.d.ts +20 -0
- package/src/CircularView/index.js +930 -0
- package/src/CircularView/normalizeAngle.js +3 -0
- package/src/CircularView/normalizeAngleRange.js +9 -0
- package/src/CircularView/positionCutsites.js +6 -0
- package/src/CircularView/shouldFlipText.js +4 -0
- package/src/CircularView/style.css +47 -0
- package/src/CircularView/utils/polarToSpecialCartesian.js +7 -0
- package/src/CreateAnnotationsPage.js +96 -0
- package/src/CreateCustomEnzyme/index.js +337 -0
- package/src/CreateCustomEnzyme/style.css +100 -0
- package/src/CutsiteFilter/AdditionalCutsiteInfoDialog.js +599 -0
- package/src/CutsiteFilter/index.js +408 -0
- package/src/CutsiteFilter/style.css +23 -0
- package/src/CutsiteFilter/withRestrictionEnzymes.js +15 -0
- package/src/DigestTool/AddLaddersDialog.js +82 -0
- package/src/DigestTool/DigestTool.js +223 -0
- package/src/DigestTool/Ladder.css +20 -0
- package/src/DigestTool/Ladder.js +303 -0
- package/src/DigestTool/createFragmentLines.js +120 -0
- package/src/DigestTool/ladderDefaults.js +26 -0
- package/src/DigestTool/ruler.css +89 -0
- package/src/Editor/CommandHotkeyHandler.js +44 -0
- package/src/Editor/DropHandler.css +21 -0
- package/src/Editor/DropHandler.js +64 -0
- package/src/Editor/FillWindow.js +46 -0
- package/src/Editor/darkmode.css +98 -0
- package/src/Editor/index.js +1005 -0
- package/src/Editor/style.css +235 -0
- package/src/Editor/userDefinedHandlersAndOpts.js +56 -0
- package/src/EnzymeViewer/index.js +81 -0
- package/src/EnzymeViewer/style.css +6 -0
- package/src/FindBar/index.js +411 -0
- package/src/FindBar/style.css +46 -0
- package/src/GlobalDialog.js +66 -0
- package/src/GlobalDialogUtils.js +85 -0
- package/src/LinearView/SequenceName.js +15 -0
- package/src/LinearView/ZoomLinearView.js +47 -0
- package/src/LinearView/index.js +374 -0
- package/src/LinearView/style.css +12 -0
- package/src/ManageEnzymes/index.js +326 -0
- package/src/ManageEnzymes/style.css +100 -0
- package/src/MenuBar/defaultConfig.js +149 -0
- package/src/MenuBar/index.js +98 -0
- package/src/MenuBar/viewSubmenu.js +479 -0
- package/src/PCRTool/PCRTool.js +173 -0
- package/src/Reflex/Browser.js +107 -0
- package/src/Reflex/ReflexContainer.js +802 -0
- package/src/Reflex/ReflexElement.js +160 -0
- package/src/Reflex/ReflexEvents.js +77 -0
- package/src/Reflex/ReflexSplitter.js +205 -0
- package/src/Reflex/index.js +5 -0
- package/src/Reflex/reflex-styles.css +128 -0
- package/src/Reflex/reflex-styles.css.map +9 -0
- package/src/RowItem/AnnotationContainerHolder.js +20 -0
- package/src/RowItem/AnnotationPositioner.js +27 -0
- package/src/RowItem/Axis.js +149 -0
- package/src/RowItem/Caret/index.js +64 -0
- package/src/RowItem/Caret/style.css +8 -0
- package/src/RowItem/Chromatograms/Chromatogram.js +289 -0
- package/src/RowItem/CutsiteSelectionLayers.js +47 -0
- package/src/RowItem/Cutsites.js +271 -0
- package/src/RowItem/DeletionLayers/index.js +113 -0
- package/src/RowItem/DeletionLayers/style.css +5 -0
- package/src/RowItem/Labels.js +327 -0
- package/src/RowItem/Orf.js +109 -0
- package/src/RowItem/Orfs.js +35 -0
- package/src/RowItem/ReplacementLayers/style.css +5 -0
- package/src/RowItem/SelectionLayer/index.js +184 -0
- package/src/RowItem/SelectionLayer/style.css +21 -0
- package/src/RowItem/Sequence.js +269 -0
- package/src/RowItem/StackedAnnotations/PointedAnnotation.js +347 -0
- package/src/RowItem/StackedAnnotations/getStructuredBases.js +97 -0
- package/src/RowItem/StackedAnnotations/index.js +182 -0
- package/src/RowItem/StackedAnnotations/primerBases.js +218 -0
- package/src/RowItem/StackedAnnotations/style.css +14 -0
- package/src/RowItem/Translations/AASliver.js +190 -0
- package/src/RowItem/Translations/Translation.js +162 -0
- package/src/RowItem/Translations/index.js +54 -0
- package/src/RowItem/Translations/style.css +3 -0
- package/src/RowItem/constants.js +3 -0
- package/src/RowItem/getCutsiteLabelHeights.js +56 -0
- package/src/RowItem/getXStartAndWidthFromNonCircularRange.js +12 -0
- package/src/RowItem/getXStartAndWidthOfRangeWrtRow.js +27 -0
- package/src/RowItem/getXStartAndWidthOfRowAnnotation.js +19 -0
- package/src/RowItem/index.js +647 -0
- package/src/RowItem/partOverhangs.js +6 -0
- package/src/RowItem/style.css +103 -0
- package/src/RowItem/utils.js +32 -0
- package/src/RowView/estimateRowHeight.js +184 -0
- package/src/RowView/index.d.ts +10 -0
- package/src/RowView/index.js +554 -0
- package/src/RowView/style.css +12 -0
- package/src/SimpleCircularOrLinearView.js +379 -0
- package/src/SimpleOligoPreview.js +39 -0
- package/src/StatusBar/MeltingTemp.js +81 -0
- package/src/StatusBar/index.js +275 -0
- package/src/StatusBar/style.css +38 -0
- package/src/ToolBar/ToolbarItem.js +194 -0
- package/src/ToolBar/alignmentTool.js +503 -0
- package/src/ToolBar/array_move.js +10 -0
- package/src/ToolBar/cutsiteTool.js +88 -0
- package/src/ToolBar/downloadTool.js +38 -0
- package/src/ToolBar/editTool.js +26 -0
- package/src/ToolBar/featureTool.js +34 -0
- package/src/ToolBar/findTool.js +2 -0
- package/src/ToolBar/importTool.js +27 -0
- package/src/ToolBar/index.js +231 -0
- package/src/ToolBar/inlineFindTool.js +38 -0
- package/src/ToolBar/oligoTool.js +30 -0
- package/src/ToolBar/orfTool.js +141 -0
- package/src/ToolBar/partTool.js +47 -0
- package/src/ToolBar/printTool.js +31 -0
- package/src/ToolBar/redoTool.js +30 -0
- package/src/ToolBar/saveTool.js +48 -0
- package/src/ToolBar/style.css +138 -0
- package/src/ToolBar/undoTool.js +30 -0
- package/src/ToolBar/veToolbarIcons/find.png +0 -0
- package/src/ToolBar/veToolbarIcons/fullscreen.png +0 -0
- package/src/ToolBar/veToolbarIcons/linear.png +0 -0
- package/src/ToolBar/veToolbarIcons/pie.png +0 -0
- package/src/ToolBar/veToolbarIcons/print.png +0 -0
- package/src/ToolBar/veToolbarIcons/save.png +0 -0
- package/src/ToolBar/veToolbarIcons/show_cut_sites.png +0 -0
- package/src/ToolBar/veToolbarIcons/show_features.png +0 -0
- package/src/ToolBar/veToolbarIcons/show_orfs.png +0 -0
- package/src/ToolBar/veToolbarIcons/show_primers.png +0 -0
- package/src/ToolBar/veToolbarIcons/toggle_views.svg +1 -0
- package/src/ToolBar/versionHistoryTool.js +20 -0
- package/src/ToolBar/visibilityTool.js +39 -0
- package/src/VersionHistoryView/index.js +215 -0
- package/src/addAlignment.js +6 -0
- package/src/commands/getOveHotkeyDefs.js +12 -0
- package/src/commands/index.js +1585 -0
- package/src/constants/constants.js +2 -0
- package/src/constants/dnaToColor.js +17 -0
- package/src/constants/draggableClassnames.js +5 -0
- package/src/constants/findToolConstants.js +1 -0
- package/src/constants/orfFrameToColorMap.js +10 -0
- package/src/constants/rowviewContants.js +3 -0
- package/src/constants/specialCutsiteFilterOptions.js +22 -0
- package/src/constants.js +1 -0
- package/src/createVectorEditor/index.js +138 -0
- package/src/createVectorEditor/makeStore.js +34 -0
- package/src/fileUtils.js +103 -0
- package/src/helperComponents/AddOrEditAnnotationDialog/index.js +711 -0
- package/src/helperComponents/AddOrEditAnnotationDialog/style.css +11 -0
- package/src/helperComponents/AddOrEditFeatureDialog/index.js +58 -0
- package/src/helperComponents/AddOrEditPartDialog/index.js +101 -0
- package/src/helperComponents/AddOrEditPrimerDialog/EditCaretPosition.js +234 -0
- package/src/helperComponents/AddOrEditPrimerDialog/index.js +329 -0
- package/src/helperComponents/AddOrEditPrimerDialog/style.css +41 -0
- package/src/helperComponents/EnzymesDialog/index.js +904 -0
- package/src/helperComponents/EnzymesDialog/style.css +21 -0
- package/src/helperComponents/GoToDialog.js +21 -0
- package/src/helperComponents/MergeFeaturesDialog/index.js +253 -0
- package/src/helperComponents/MergeFeaturesDialog/style.css +3 -0
- package/src/helperComponents/MultipleSeqsDetectedOnImportDialog.js +74 -0
- package/src/helperComponents/PinchHelper/PinchHelper.js +24 -0
- package/src/helperComponents/PrintDialog/index.js +396 -0
- package/src/helperComponents/PrintDialog/style.css +4 -0
- package/src/helperComponents/PropertiesDialog/ColorPicker.js +30 -0
- package/src/helperComponents/PropertiesDialog/CutsiteProperties.js +185 -0
- package/src/helperComponents/PropertiesDialog/FeatureProperties.js +6 -0
- package/src/helperComponents/PropertiesDialog/GenbankView.js +74 -0
- package/src/helperComponents/PropertiesDialog/GeneralProperties.js +140 -0
- package/src/helperComponents/PropertiesDialog/GenericAnnotationProperties.js +406 -0
- package/src/helperComponents/PropertiesDialog/OrfProperties.js +117 -0
- package/src/helperComponents/PropertiesDialog/PartProperties.js +9 -0
- package/src/helperComponents/PropertiesDialog/PrimerProperties.js +19 -0
- package/src/helperComponents/PropertiesDialog/SingleEnzymeCutsiteInfo.js +131 -0
- package/src/helperComponents/PropertiesDialog/TranslationProperties.js +149 -0
- package/src/helperComponents/PropertiesDialog/index.js +166 -0
- package/src/helperComponents/PropertiesDialog/style.css +68 -0
- package/src/helperComponents/PropertiesDialog/typeField.js +24 -0
- package/src/helperComponents/PropertiesDialog/utils.js +37 -0
- package/src/helperComponents/RemoveDuplicates/index.js +194 -0
- package/src/helperComponents/RenameSequenceDialog.js +7 -0
- package/src/helperComponents/SelectDialog.js +150 -0
- package/src/helperComponents/UncontrolledSliderWithPlusMinusBtns.css +5 -0
- package/src/helperComponents/UncontrolledSliderWithPlusMinusBtns.js +134 -0
- package/src/helperComponents/VeWarning/index.js +22 -0
- package/src/helperComponents/VeWarning/style.css +10 -0
- package/src/helperComponents/createSimpleDialog.js +89 -0
- package/src/helperComponents/partTagSearch.js +72 -0
- package/src/helperComponents/simpleDialog.css +13 -0
- package/src/helperComponents/withHover.js +90 -0
- package/src/index.js +60 -0
- package/src/redux/alignments.js +373 -0
- package/src/redux/annotationLabelVisibility.js +53 -0
- package/src/redux/annotationVisibility.js +196 -0
- package/src/redux/annotationsToSupport.js +104 -0
- package/src/redux/caretPosition.js +27 -0
- package/src/redux/charWidth.js +22 -0
- package/src/redux/copyOptions.js +34 -0
- package/src/redux/createYourOwnEnzyme.js +39 -0
- package/src/redux/deletionLayers.js +36 -0
- package/src/redux/digestTool.js +34 -0
- package/src/redux/featureLengthsToHide.js +27 -0
- package/src/redux/findTool.js +79 -0
- package/src/redux/frameTranslations.js +52 -0
- package/src/redux/hoveredAnnotation.js +24 -0
- package/src/redux/index.js +196 -0
- package/src/redux/labelLineIntensity.js +25 -0
- package/src/redux/labelSize.js +23 -0
- package/src/redux/lastSavedId.js +20 -0
- package/src/redux/middleware.js +112 -0
- package/src/redux/minimumOrfSize.js +24 -0
- package/src/redux/modalActions.js +3 -0
- package/src/redux/panelsShown.js +273 -0
- package/src/redux/partLengthsToHide.js +23 -0
- package/src/redux/primerLengthsToHide.js +27 -0
- package/src/redux/propertiesTool.js +40 -0
- package/src/redux/readOnly.js +28 -0
- package/src/redux/replacementLayers.js +36 -0
- package/src/redux/restrictionEnzymes.js +52 -0
- package/src/redux/selectedAnnotations.js +89 -0
- package/src/redux/selectedPartTags.js +21 -0
- package/src/redux/selectionLayer.js +46 -0
- package/src/redux/sequenceData/circular.js +19 -0
- package/src/redux/sequenceData/description.js +21 -0
- package/src/redux/sequenceData/features.js +19 -0
- package/src/redux/sequenceData/index.js +81 -0
- package/src/redux/sequenceData/lineageLines.js +11 -0
- package/src/redux/sequenceData/materiallyAvailable.js +19 -0
- package/src/redux/sequenceData/name.js +19 -0
- package/src/redux/sequenceData/parts.js +19 -0
- package/src/redux/sequenceData/primers.js +19 -0
- package/src/redux/sequenceData/sequence.js +12 -0
- package/src/redux/sequenceData/sharedActionCreators.js +0 -0
- package/src/redux/sequenceData/translations.js +20 -0
- package/src/redux/sequenceData/upsertDeleteActionGenerator.js +31 -0
- package/src/redux/sequenceDataHistory.js +43 -0
- package/src/redux/showGCContent.js +23 -0
- package/src/redux/toolBar.js +25 -0
- package/src/redux/uppercaseSequenceMapFont.js +25 -0
- package/src/redux/useAdditionalOrfStartCodons.js +24 -0
- package/src/redux/utils/addDashesForMatchStartAndEndForTracks/index.js +71 -0
- package/src/redux/utils/addMetaToActionCreators.js +12 -0
- package/src/redux/utils/createMergedDefaultStateReducer.js +30 -0
- package/src/redux/utils/createMetaAction.js +12 -0
- package/src/redux/versionHistory.js +27 -0
- package/src/selectors/annotationLabelVisibility.js +2 -0
- package/src/selectors/annotationSearchSelector.js +24 -0
- package/src/selectors/cdsFeaturesSelector.js +9 -0
- package/src/selectors/circularSelector.js +4 -0
- package/src/selectors/cutsiteLabelColorSelector.js +6 -0
- package/src/selectors/cutsitesByRangeSelector.js +5 -0
- package/src/selectors/cutsitesSelector.js +61 -0
- package/src/selectors/editorSelector.js +2 -0
- package/src/selectors/featuresSelector.js +8 -0
- package/src/selectors/filteredCutsitesSelector.js +137 -0
- package/src/selectors/filteredFeaturesSelector.js +32 -0
- package/src/selectors/filteredPartsSelector.js +57 -0
- package/src/selectors/filteredPrimersSelector.js +27 -0
- package/src/selectors/filteredRestrictionEnzymesSelector.js +1 -0
- package/src/selectors/getAdditionalEnzymesSelector.js +46 -0
- package/src/selectors/index.js +41 -0
- package/src/selectors/isEnzymeFilterAndSelector.js +1 -0
- package/src/selectors/minimumOrfSizeSelector.js +2 -0
- package/src/selectors/orfsSelector.js +15 -0
- package/src/selectors/partsSelector.js +8 -0
- package/src/selectors/primersSelector.js +8 -0
- package/src/selectors/restrictionEnzymesSelector.js +34 -0
- package/src/selectors/searchLayersSelector.js +71 -0
- package/src/selectors/selectedAnnotationsSelector.js +1 -0
- package/src/selectors/selectedCutsitesSelector.js +21 -0
- package/src/selectors/sequenceDataSelector.js +2 -0
- package/src/selectors/sequenceLengthSelector.js +5 -0
- package/src/selectors/sequenceSelector.js +4 -0
- package/src/selectors/tagsToBoldSelector.js +2 -0
- package/src/selectors/translationSearchMatchesSelector.js +14 -0
- package/src/selectors/translationsRawSelector.js +8 -0
- package/src/selectors/translationsSelector.js +137 -0
- package/src/style.css +82 -0
- package/src/updateEditor.js +198 -0
- package/src/utils/PassThrough.js +3 -0
- package/src/utils/addWrappedAddons.js +20 -0
- package/src/utils/annotationTypes.js +37 -0
- package/src/utils/arrayUtils.js +19 -0
- package/src/utils/calculateTickMarkPositionsForGivenRange.js +47 -0
- package/src/utils/cleanSequenceData_DEPRECATED/arrayToObjWithIds.js +17 -0
- package/src/utils/combineReducersDontIgnoreKeys.js +12 -0
- package/src/utils/commandUtils.js +18 -0
- package/src/utils/editorUtils.js +223 -0
- package/src/utils/getAnnotationClassnames.js +12 -0
- package/src/utils/getAnnotationNameAndStartStopString.js +61 -0
- package/src/utils/getVisibleStartEnd.js +7 -0
- package/src/utils/massageTickSpacing.js +19 -0
- package/src/utils/onlyUpdateForKeysDeep.js +31 -0
- package/src/utils/prepareRowData.js +64 -0
- package/src/utils/proteinUtils.js +3 -0
- package/src/utils/pureNoFunc.js +18 -0
- package/src/utils/selectionLayer.js +25 -0
- package/src/utils/shouldRerender.js +27 -0
- package/src/utils/showFileDialog.js +26 -0
- package/src/utils/updateLabelsForInViewFeatures.js +55 -0
- package/src/utils/updateLabelsForInViewFeaturesCircView.js +41 -0
- package/src/utils/useAAColorType.js +8 -0
- package/src/utils/useAnnotationLimits.js +42 -0
- package/src/utils/useChromatogramPrefs.js +31 -0
- package/src/utils/useLadders.js +6 -0
- package/src/utils/useMeltingTemp.js +7 -0
- package/src/utils/useTmType.js +10 -0
- package/src/withEditorInteractions/Keyboard.js +86 -0
- package/src/withEditorInteractions/clickAndDragUtils.js +576 -0
- package/src/withEditorInteractions/createSequenceInputPopup.js +296 -0
- package/src/withEditorInteractions/createSequenceInputPopupStyle.css +85 -0
- package/src/withEditorInteractions/getBpsPerRow.js +19 -0
- package/src/withEditorInteractions/index.js +1252 -0
- package/src/withEditorInteractions/isElementInViewport.js +29 -0
- package/src/withEditorInteractions/moveCaret.js +58 -0
- package/src/withEditorProps/index.js +1010 -0
- package/index.mjs +0 -193228
| @@ -0,0 +1,100 @@ | |
| 1 | 
            +
            .ove-slider .bp3-slider {
         | 
| 2 | 
            +
              min-width: 10px !important;
         | 
| 3 | 
            +
              margin-bottom: 4px;
         | 
| 4 | 
            +
            }
         | 
| 5 | 
            +
            .alignmentViewTrackContainer:hover .alignmentViewSelectTrackPopover {
         | 
| 6 | 
            +
              opacity: 0.9 !important;
         | 
| 7 | 
            +
            }
         | 
| 8 | 
            +
            .alignmentViewTrackContainer {
         | 
| 9 | 
            +
              position: relative;
         | 
| 10 | 
            +
            }
         | 
| 11 | 
            +
            .alignmentViewTrackContainer,
         | 
| 12 | 
            +
            .alignmentViewTrackContainer .veVectorInteractionWrapper,
         | 
| 13 | 
            +
            .alignmentViewTrackContainer .veVectorInteractionWrapper > div {
         | 
| 14 | 
            +
              width: stretch;
         | 
| 15 | 
            +
              width: fit-content;
         | 
| 16 | 
            +
            }
         | 
| 17 | 
            +
             | 
| 18 | 
            +
            .alignmentViewTrackContainer .veLinearView .veRowItemWrapper {
         | 
| 19 | 
            +
              display: block;
         | 
| 20 | 
            +
            }
         | 
| 21 | 
            +
             | 
| 22 | 
            +
            .alignmentHolder::-webkit-scrollbar {
         | 
| 23 | 
            +
              display: none;
         | 
| 24 | 
            +
            }
         | 
| 25 | 
            +
            .alignmentHolder {
         | 
| 26 | 
            +
              -ms-overflow-style: none; /* Internet Explorer 10+ */
         | 
| 27 | 
            +
              scrollbar-width: none; /* Firefox */
         | 
| 28 | 
            +
            }
         | 
| 29 | 
            +
             | 
| 30 | 
            +
            .alignmentTrackName {
         | 
| 31 | 
            +
              background: white;
         | 
| 32 | 
            +
            }
         | 
| 33 | 
            +
            .alignmentTrackName {
         | 
| 34 | 
            +
              -ms-overflow-style: none; /* Internet Explorer 10+ */
         | 
| 35 | 
            +
              scrollbar-width: none; /* Firefox */
         | 
| 36 | 
            +
            }
         | 
| 37 | 
            +
            .alignmentTrackName::-webkit-scrollbar {
         | 
| 38 | 
            +
              display: none; /* Safari and Chrome */
         | 
| 39 | 
            +
            }
         | 
| 40 | 
            +
            .alignmentMinimapTracks {
         | 
| 41 | 
            +
              -ms-overflow-style: none; /* Internet Explorer 10+ */
         | 
| 42 | 
            +
              scrollbar-width: none; /* Firefox */
         | 
| 43 | 
            +
            }
         | 
| 44 | 
            +
            .alignmentMinimapTracks::-webkit-scrollbar {
         | 
| 45 | 
            +
              display: none; /* Safari and Chrome */
         | 
| 46 | 
            +
            }
         | 
| 47 | 
            +
            .bp3-dark .alignmentTrackName {
         | 
| 48 | 
            +
              background: #30404d;
         | 
| 49 | 
            +
            }
         | 
| 50 | 
            +
            /* .alignmentViewTrackContainer:hover .alignmentTrackNameDiv {
         | 
| 51 | 
            +
              opacity: 1 !important;
         | 
| 52 | 
            +
            } */
         | 
| 53 | 
            +
            .ve-alignment-top-bar > * {
         | 
| 54 | 
            +
              overflow-wrap: normal;
         | 
| 55 | 
            +
              flex: 0 0 auto;
         | 
| 56 | 
            +
              max-width: 100%;
         | 
| 57 | 
            +
              margin-left: 4px;
         | 
| 58 | 
            +
              margin-right: 4px;
         | 
| 59 | 
            +
            }
         | 
| 60 | 
            +
             | 
| 61 | 
            +
            .veAlignmentSelectionLayer {
         | 
| 62 | 
            +
              top: 0;
         | 
| 63 | 
            +
              height: 100% !important;
         | 
| 64 | 
            +
              overflow: hidden;
         | 
| 65 | 
            +
            }
         | 
| 66 | 
            +
            .alignmentView .veSelectionLayer {
         | 
| 67 | 
            +
              top: 0;
         | 
| 68 | 
            +
            }
         | 
| 69 | 
            +
             | 
| 70 | 
            +
            .veTracksAndAlignmentHolder {
         | 
| 71 | 
            +
              position: relative;
         | 
| 72 | 
            +
              width: fit-content;
         | 
| 73 | 
            +
              height: fit-content;
         | 
| 74 | 
            +
            }
         | 
| 75 | 
            +
            /* .isTrackDragging.veTracksAndAlignmentHolder {
         | 
| 76 | 
            +
              transform: none !important;
         | 
| 77 | 
            +
            } */
         | 
| 78 | 
            +
            .veTracksAndAlignmentHolder {
         | 
| 79 | 
            +
              transform: none !important;
         | 
| 80 | 
            +
            }
         | 
| 81 | 
            +
            .alignmentMinimapTracks {
         | 
| 82 | 
            +
              background: #8a9ba8;
         | 
| 83 | 
            +
            }
         | 
| 84 | 
            +
            .minimapLane.lane-hovered .miniBluePath {
         | 
| 85 | 
            +
              fill: rgb(169, 169, 245) !important;
         | 
| 86 | 
            +
            }
         | 
| 87 | 
            +
             | 
| 88 | 
            +
            .veAlignmentName {
         | 
| 89 | 
            +
              padding-top: 1px;
         | 
| 90 | 
            +
              padding-bottom: 1px;
         | 
| 91 | 
            +
              margin-top: 2px;
         | 
| 92 | 
            +
              margin-bottom: 5px;
         | 
| 93 | 
            +
              margin-left: 3px;
         | 
| 94 | 
            +
              font-weight: bold;
         | 
| 95 | 
            +
              font-size: 14px;
         | 
| 96 | 
            +
              max-width: 300px;
         | 
| 97 | 
            +
              /* overflow: hidden; */
         | 
| 98 | 
            +
              text-overflow: ellipsis;
         | 
| 99 | 
            +
              white-space: nowrap;
         | 
| 100 | 
            +
            }
         | 
| @@ -0,0 +1,58 @@ | |
| 1 | 
            +
            import { insertItem, removeItem } from "../utils/arrayUtils";
         | 
| 2 | 
            +
             | 
| 3 | 
            +
            export function updateTrackHelper({
         | 
| 4 | 
            +
              currentPairwiseAlignmentIndex,
         | 
| 5 | 
            +
              pairwiseAlignments,
         | 
| 6 | 
            +
              upsertAlignmentRun,
         | 
| 7 | 
            +
              hasBeenTrimmed,
         | 
| 8 | 
            +
              alignmentId,
         | 
| 9 | 
            +
              alignmentTracks,
         | 
| 10 | 
            +
              alignmentTrackIndex,
         | 
| 11 | 
            +
              update
         | 
| 12 | 
            +
            }) {
         | 
| 13 | 
            +
              const updateATs = (atsToUse, alignmentTrackIndex) => {
         | 
| 14 | 
            +
                const removed = removeItem(atsToUse, alignmentTrackIndex);
         | 
| 15 | 
            +
                return insertItem(
         | 
| 16 | 
            +
                  removed,
         | 
| 17 | 
            +
                  {
         | 
| 18 | 
            +
                    ...atsToUse[alignmentTrackIndex],
         | 
| 19 | 
            +
                    alignmentData: {
         | 
| 20 | 
            +
                      ...atsToUse[alignmentTrackIndex].alignmentData,
         | 
| 21 | 
            +
                      ...update
         | 
| 22 | 
            +
                    },
         | 
| 23 | 
            +
                    sequenceData: {
         | 
| 24 | 
            +
                      ...atsToUse[alignmentTrackIndex].sequenceData,
         | 
| 25 | 
            +
                      ...update
         | 
| 26 | 
            +
                    }
         | 
| 27 | 
            +
                  },
         | 
| 28 | 
            +
                  alignmentTrackIndex
         | 
| 29 | 
            +
                );
         | 
| 30 | 
            +
              };
         | 
| 31 | 
            +
             | 
| 32 | 
            +
              upsertAlignmentRun({
         | 
| 33 | 
            +
                id: alignmentId,
         | 
| 34 | 
            +
                hasBeenTrimmed,
         | 
| 35 | 
            +
                ...(pairwiseAlignments
         | 
| 36 | 
            +
                  ? {
         | 
| 37 | 
            +
                      pairwiseAlignments: pairwiseAlignments.map((ats, i) => {
         | 
| 38 | 
            +
                        if (alignmentTrackIndex === 0) {
         | 
| 39 | 
            +
                          return updateATs(ats, 0);
         | 
| 40 | 
            +
                        }
         | 
| 41 | 
            +
                        if (
         | 
| 42 | 
            +
                          currentPairwiseAlignmentIndex !== undefined
         | 
| 43 | 
            +
                            ? currentPairwiseAlignmentIndex === i
         | 
| 44 | 
            +
                            : alignmentTrackIndex - 1 === i
         | 
| 45 | 
            +
                        ) {
         | 
| 46 | 
            +
                          return updateATs(ats, 1);
         | 
| 47 | 
            +
                        }
         | 
| 48 | 
            +
                        return ats;
         | 
| 49 | 
            +
                      })
         | 
| 50 | 
            +
                    }
         | 
| 51 | 
            +
                  : {
         | 
| 52 | 
            +
                      alignmentTracks: updateATs(
         | 
| 53 | 
            +
                        alignmentTracks,
         | 
| 54 | 
            +
                        Number(alignmentTrackIndex)
         | 
| 55 | 
            +
                      )
         | 
| 56 | 
            +
                    })
         | 
| 57 | 
            +
              });
         | 
| 58 | 
            +
            }
         | 
| @@ -0,0 +1,500 @@ | |
| 1 | 
            +
            /* eslint-disable jsx-a11y/anchor-is-valid */
         | 
| 2 | 
            +
            /* eslint-disable jsx-a11y/anchor-has-content */
         | 
| 3 | 
            +
            /* eslint-disable no-throw-literal */
         | 
| 4 | 
            +
            import { unparse } from "papaparse";
         | 
| 5 | 
            +
            import pluralize from "pluralize";
         | 
| 6 | 
            +
            import  { SubmissionError, reduxForm,  } from "redux-form";
         | 
| 7 | 
            +
            import shortid from "shortid";
         | 
| 8 | 
            +
            import CreateAnnotationsPage from "./CreateAnnotationsPage";
         | 
| 9 | 
            +
            import { formName } from "./constants";
         | 
| 10 | 
            +
            import { AutoAnnotateBpMatchingDialog } from "./AutoAnnotateBpMatchingDialog";
         | 
| 11 | 
            +
            import {
         | 
| 12 | 
            +
              parseCsvFile,
         | 
| 13 | 
            +
              validateCSVRequiredHeaders,
         | 
| 14 | 
            +
              validateCSVRow,
         | 
| 15 | 
            +
            } from "./fileUtils";
         | 
| 16 | 
            +
            import downloadjs from "downloadjs";
         | 
| 17 | 
            +
            import {
         | 
| 18 | 
            +
              autoAnnotate,
         | 
| 19 | 
            +
              convertApELikeRegexToRegex,
         | 
| 20 | 
            +
              convertProteinSeqToDNAIupac,
         | 
| 21 | 
            +
              getFeatureToColorMap,
         | 
| 22 | 
            +
              getFeatureTypes,
         | 
| 23 | 
            +
            } from "@teselagen/sequence-utils";
         | 
| 24 | 
            +
            import { hideDialog, showDialog } from "./GlobalDialogUtils";
         | 
| 25 | 
            +
            import { compose } from "redux";
         | 
| 26 | 
            +
            import {
         | 
| 27 | 
            +
              DataTable,
         | 
| 28 | 
            +
              DialogFooter,
         | 
| 29 | 
            +
              FileUploadField,
         | 
| 30 | 
            +
              InfoHelper,
         | 
| 31 | 
            +
              showConfirmationDialog,
         | 
| 32 | 
            +
              wrapDialog,
         | 
| 33 | 
            +
            } from "@teselagen/ui";
         | 
| 34 | 
            +
            import { startCase } from "lodash";
         | 
| 35 | 
            +
            import withEditorProps from "./withEditorProps";
         | 
| 36 | 
            +
            import { useEffect, useState } from "react";
         | 
| 37 | 
            +
            import { Colors, Tab, Tabs } from "@blueprintjs/core";
         | 
| 38 | 
            +
            import { typeField } from "./helperComponents/PropertiesDialog/typeField";
         | 
| 39 | 
            +
             | 
| 40 | 
            +
            export function autoAnnotateFeatures() {
         | 
| 41 | 
            +
              showDialog({
         | 
| 42 | 
            +
                ModalComponent: AutoAnnotateModal, //we want to use a ModalComponent here so our addon does not
         | 
| 43 | 
            +
                props: {
         | 
| 44 | 
            +
                  annotationType: "feature",
         | 
| 45 | 
            +
                },
         | 
| 46 | 
            +
              });
         | 
| 47 | 
            +
            }
         | 
| 48 | 
            +
            export function autoAnnotateParts() {
         | 
| 49 | 
            +
              showDialog({
         | 
| 50 | 
            +
                ModalComponent: AutoAnnotateModal, //we want to use a ModalComponent here so our addon does not
         | 
| 51 | 
            +
                props: {
         | 
| 52 | 
            +
                  annotationType: "part",
         | 
| 53 | 
            +
                },
         | 
| 54 | 
            +
              });
         | 
| 55 | 
            +
            }
         | 
| 56 | 
            +
            export function autoAnnotatePrimers() {
         | 
| 57 | 
            +
              showDialog({
         | 
| 58 | 
            +
                ModalComponent: AutoAnnotateModal, //we want to use a ModalComponent here so our addon does not
         | 
| 59 | 
            +
                props: {
         | 
| 60 | 
            +
                  annotationType: "primer",
         | 
| 61 | 
            +
                },
         | 
| 62 | 
            +
              });
         | 
| 63 | 
            +
            }
         | 
| 64 | 
            +
             | 
| 65 | 
            +
            export const AutoAnnotateModal = compose(
         | 
| 66 | 
            +
              wrapDialog((p) => ({
         | 
| 67 | 
            +
                canEscapeKeyClose: false,
         | 
| 68 | 
            +
                title: `Auto Annotate ${startCase(pluralize(p.annotationType))}`,
         | 
| 69 | 
            +
              })),
         | 
| 70 | 
            +
              withEditorProps,
         | 
| 71 | 
            +
              reduxForm({ form: formName })
         | 
| 72 | 
            +
            )((props) => {
         | 
| 73 | 
            +
              const {
         | 
| 74 | 
            +
                sequenceData,
         | 
| 75 | 
            +
                handleSubmit,
         | 
| 76 | 
            +
                annotationType = "feature",
         | 
| 77 | 
            +
                error,
         | 
| 78 | 
            +
                getCustomAutoAnnotateList,
         | 
| 79 | 
            +
              } = props;
         | 
| 80 | 
            +
              const [fileType, setSelectedImportType] = useState("csvFile");
         | 
| 81 | 
            +
              const [newAnnotations, setNewAnns] = useState(false);
         | 
| 82 | 
            +
              const [customAnnResponse, setCustomAnnResponse] = useState();
         | 
| 83 | 
            +
              const [loadingCustomAnnList, setLoadingCustomAnnList] = useState();
         | 
| 84 | 
            +
              useEffect(() => {
         | 
| 85 | 
            +
                (async () => {
         | 
| 86 | 
            +
                  if (getCustomAutoAnnotateList) {
         | 
| 87 | 
            +
                    setLoadingCustomAnnList(true);
         | 
| 88 | 
            +
                    try {
         | 
| 89 | 
            +
                      const anns = await getCustomAutoAnnotateList(props);
         | 
| 90 | 
            +
                      setCustomAnnResponse(anns);
         | 
| 91 | 
            +
                    } catch (e) {
         | 
| 92 | 
            +
                      window.toastr.warning("Error loading custom annotation list");
         | 
| 93 | 
            +
                      console.error(`e:`, e);
         | 
| 94 | 
            +
                    } finally {
         | 
| 95 | 
            +
                      setLoadingCustomAnnList(false);
         | 
| 96 | 
            +
                    }
         | 
| 97 | 
            +
                  }
         | 
| 98 | 
            +
                })();
         | 
| 99 | 
            +
                // eslint-disable-next-line react-hooks/exhaustive-deps
         | 
| 100 | 
            +
              }, []);
         | 
| 101 | 
            +
              if (newAnnotations) {
         | 
| 102 | 
            +
                return (
         | 
| 103 | 
            +
                  <CreateAnnotationsPage
         | 
| 104 | 
            +
                    {...props}
         | 
| 105 | 
            +
                    newAnnotations={newAnnotations}
         | 
| 106 | 
            +
                  ></CreateAnnotationsPage>
         | 
| 107 | 
            +
                );
         | 
| 108 | 
            +
              }
         | 
| 109 | 
            +
              return (
         | 
| 110 | 
            +
                <div className="bp3-dialog-body">
         | 
| 111 | 
            +
                  <Tabs
         | 
| 112 | 
            +
                    renderActiveTabPanelOnly
         | 
| 113 | 
            +
                    onChange={setSelectedImportType}
         | 
| 114 | 
            +
                    selectedTabId={fileType}
         | 
| 115 | 
            +
                  >
         | 
| 116 | 
            +
                    <Tab
         | 
| 117 | 
            +
                      panel={
         | 
| 118 | 
            +
                        <div>
         | 
| 119 | 
            +
                          <div>
         | 
| 120 | 
            +
                            Select a CSV file (
         | 
| 121 | 
            +
                            <a
         | 
| 122 | 
            +
                              onClick={() => {
         | 
| 123 | 
            +
                                const rows = [
         | 
| 124 | 
            +
                                  {
         | 
| 125 | 
            +
                                    name: `Example ${startCase(annotationType)} 1`,
         | 
| 126 | 
            +
                                    description: "I'm a description",
         | 
| 127 | 
            +
                                    sequence: `gatNNtacaggttt`,
         | 
| 128 | 
            +
                                    ...(annotationType === "feature" && {
         | 
| 129 | 
            +
                                      type: `cds`,
         | 
| 130 | 
            +
                                    }),
         | 
| 131 | 
            +
                                    isRegex: false,
         | 
| 132 | 
            +
                                    matchType: "dna",
         | 
| 133 | 
            +
                                  },
         | 
| 134 | 
            +
                                  {
         | 
| 135 | 
            +
                                    name: `Example Protein ${startCase(annotationType)}`,
         | 
| 136 | 
            +
                                    description: "I'm a description",
         | 
| 137 | 
            +
                                    sequence: `APGSGTGGGSGSAPG`,
         | 
| 138 | 
            +
                                    ...(annotationType === "feature" && {
         | 
| 139 | 
            +
                                      type: `cds`,
         | 
| 140 | 
            +
                                    }),
         | 
| 141 | 
            +
                                    isRegex: false,
         | 
| 142 | 
            +
                                    matchType: "protein",
         | 
| 143 | 
            +
                                  },
         | 
| 144 | 
            +
                                  {
         | 
| 145 | 
            +
                                    name: `Example ${startCase(annotationType)} 2`,
         | 
| 146 | 
            +
                                    description: "I'm another description",
         | 
| 147 | 
            +
                                    sequence: `gat.*tacccc.*aggttt`,
         | 
| 148 | 
            +
                                    ...(annotationType === "feature" && {
         | 
| 149 | 
            +
                                      type: `cds`,
         | 
| 150 | 
            +
                                    }),
         | 
| 151 | 
            +
                                    isRegex: true,
         | 
| 152 | 
            +
                                    matchType: "dna",
         | 
| 153 | 
            +
                                  },
         | 
| 154 | 
            +
                                ];
         | 
| 155 | 
            +
                                const csv = unparse(rows);
         | 
| 156 | 
            +
                                // const blob = new Blob([convert(sequenceData)], { type: "text/plain" });
         | 
| 157 | 
            +
                                // const filename = `${sequenceData.name || "Untitled_Sequence"}.${fileExt}`;
         | 
| 158 | 
            +
                                // FileSaver.saveAs(blob, filename);
         | 
| 159 | 
            +
                                downloadjs(
         | 
| 160 | 
            +
                                  csv,
         | 
| 161 | 
            +
                                  `Example CSV Annotation Upload File.csv`,
         | 
| 162 | 
            +
                                  "text/plain"
         | 
| 163 | 
            +
                                );
         | 
| 164 | 
            +
                              }}
         | 
| 165 | 
            +
                            >
         | 
| 166 | 
            +
                              download example
         | 
| 167 | 
            +
                            </a>
         | 
| 168 | 
            +
                            ) with the following columns:<br></br>
         | 
| 169 | 
            +
                            <br></br>
         | 
| 170 | 
            +
                            <div style={{ display: "flex" }}>
         | 
| 171 | 
            +
                              name,description,sequence,type,
         | 
| 172 | 
            +
                              <span style={{ display: "flex" }}>
         | 
| 173 | 
            +
                                isRegex  
         | 
| 174 | 
            +
                                <InfoHelper
         | 
| 175 | 
            +
                                  onClick={(e) => {
         | 
| 176 | 
            +
                                    e.stopPropagation();
         | 
| 177 | 
            +
                                    e.preventDefault();
         | 
| 178 | 
            +
                                    showDialog({
         | 
| 179 | 
            +
                                      ModalComponent: AutoAnnotateBpMatchingDialog,
         | 
| 180 | 
            +
                                    });
         | 
| 181 | 
            +
                                  }}
         | 
| 182 | 
            +
                                  content={
         | 
| 183 | 
            +
                                    <span>
         | 
| 184 | 
            +
                                      Any valid regexes allowed. Click for more info about
         | 
| 185 | 
            +
                                      regex matching
         | 
| 186 | 
            +
                                    </span>
         | 
| 187 | 
            +
                                  }
         | 
| 188 | 
            +
                                ></InfoHelper>
         | 
| 189 | 
            +
                              </span>
         | 
| 190 | 
            +
                              ,matchType
         | 
| 191 | 
            +
                            </div>
         | 
| 192 | 
            +
                            <br></br>
         | 
| 193 | 
            +
                            {annotationType !== "feature" && (
         | 
| 194 | 
            +
                              <>
         | 
| 195 | 
            +
                                <i>Note: the "type" column is optional</i>
         | 
| 196 | 
            +
                                <br></br>
         | 
| 197 | 
            +
                              </>
         | 
| 198 | 
            +
                            )}
         | 
| 199 | 
            +
                          </div>
         | 
| 200 | 
            +
                          <FileUploadField
         | 
| 201 | 
            +
                            validateAgainstSchema={validateAgainstSchema}
         | 
| 202 | 
            +
                            name="csvFile"
         | 
| 203 | 
            +
                            fileLimit={1}
         | 
| 204 | 
            +
                            isRequired
         | 
| 205 | 
            +
                            accept=".csv"
         | 
| 206 | 
            +
                          ></FileUploadField>
         | 
| 207 | 
            +
                        </div>
         | 
| 208 | 
            +
                      }
         | 
| 209 | 
            +
                      id="csvFile"
         | 
| 210 | 
            +
                      title="CSV"
         | 
| 211 | 
            +
                    ></Tab>
         | 
| 212 | 
            +
                    <Tab
         | 
| 213 | 
            +
                      panel={
         | 
| 214 | 
            +
                        <div>
         | 
| 215 | 
            +
                          <div>
         | 
| 216 | 
            +
                            Select an ApE style features .txt file (
         | 
| 217 | 
            +
                            <a
         | 
| 218 | 
            +
                              onClick={() => {
         | 
| 219 | 
            +
                                downloadjs(
         | 
| 220 | 
            +
                                  `T3	ATTAACCCTCACTAAAGGGA	primer_bind	cyan	green	0	0
         | 
| 221 | 
            +
            M13-fwd	TGTAAAACGACGGCCAGT	primer_bind	cyan	green	0	0
         | 
| 222 | 
            +
            FRT	GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC	misc_recomb	orchid	pink	0	0`,
         | 
| 223 | 
            +
                                  `Example APE Feature List Upload File.txt`,
         | 
| 224 | 
            +
                                  "text/plain"
         | 
| 225 | 
            +
                                );
         | 
| 226 | 
            +
                              }}
         | 
| 227 | 
            +
                            >
         | 
| 228 | 
            +
                              download example
         | 
| 229 | 
            +
                            </a>
         | 
| 230 | 
            +
                            ):
         | 
| 231 | 
            +
                          </div>
         | 
| 232 | 
            +
                          <FileUploadField
         | 
| 233 | 
            +
                            fileLimit={1}
         | 
| 234 | 
            +
                            name="apeFile"
         | 
| 235 | 
            +
                            isRequired
         | 
| 236 | 
            +
                            accept=".txt"
         | 
| 237 | 
            +
                          ></FileUploadField>
         | 
| 238 | 
            +
                          {error && (
         | 
| 239 | 
            +
                            <div style={{ padding: 5, color: Colors.RED1 }}>{error}</div>
         | 
| 240 | 
            +
                          )}
         | 
| 241 | 
            +
                        </div>
         | 
| 242 | 
            +
                      }
         | 
| 243 | 
            +
                      id="apeFile"
         | 
| 244 | 
            +
                      title="ApE File"
         | 
| 245 | 
            +
                    ></Tab>
         | 
| 246 | 
            +
                    {getCustomAutoAnnotateList &&
         | 
| 247 | 
            +
                      (loadingCustomAnnList ? (
         | 
| 248 | 
            +
                        <Tab disabled title="Loading..."></Tab>
         | 
| 249 | 
            +
                      ) : (
         | 
| 250 | 
            +
                        customAnnResponse &&
         | 
| 251 | 
            +
                        customAnnResponse.list && (
         | 
| 252 | 
            +
                          <Tab
         | 
| 253 | 
            +
                            id="implementerDefined"
         | 
| 254 | 
            +
                            title={customAnnResponse.title || "Custom List"}
         | 
| 255 | 
            +
                            panel={
         | 
| 256 | 
            +
                              customAnnResponse.list.length ? (
         | 
| 257 | 
            +
                                <div>
         | 
| 258 | 
            +
                                  <DataTable
         | 
| 259 | 
            +
                                    isInfinite
         | 
| 260 | 
            +
                                    schema={
         | 
| 261 | 
            +
                                      annotationType === "feature"
         | 
| 262 | 
            +
                                        ? customAnnsSchema
         | 
| 263 | 
            +
                                        : customAnnsSchemaNoType
         | 
| 264 | 
            +
                                    }
         | 
| 265 | 
            +
                                    entities={customAnnResponse.list}
         | 
| 266 | 
            +
                                  ></DataTable>
         | 
| 267 | 
            +
                                </div>
         | 
| 268 | 
            +
                              ) : (
         | 
| 269 | 
            +
                                <div>No Annotations Found</div>
         | 
| 270 | 
            +
                              )
         | 
| 271 | 
            +
                            }
         | 
| 272 | 
            +
                          ></Tab>
         | 
| 273 | 
            +
                        )
         | 
| 274 | 
            +
                      ))}
         | 
| 275 | 
            +
                  </Tabs>
         | 
| 276 | 
            +
                  <DialogFooter
         | 
| 277 | 
            +
                    hideModal={hideDialog}
         | 
| 278 | 
            +
                    disabled={
         | 
| 279 | 
            +
                      fileType === "implementerDefined" &&
         | 
| 280 | 
            +
                      !(
         | 
| 281 | 
            +
                        customAnnResponse &&
         | 
| 282 | 
            +
                        customAnnResponse.list &&
         | 
| 283 | 
            +
                        customAnnResponse.list.length
         | 
| 284 | 
            +
                      )
         | 
| 285 | 
            +
                    }
         | 
| 286 | 
            +
                    onClick={handleSubmit(async ({ apeFile, csvFile }) => {
         | 
| 287 | 
            +
                      let convertNonStandardTypes = false;
         | 
| 288 | 
            +
                      const annsToCheck = [];
         | 
| 289 | 
            +
                      try {
         | 
| 290 | 
            +
                        const validateRow = async (row, rowName) => {
         | 
| 291 | 
            +
                          const { type = "", sequence } = row;
         | 
| 292 | 
            +
                          let regexConvertedSeq;
         | 
| 293 | 
            +
             | 
| 294 | 
            +
                          if (annotationType === "feature") {
         | 
| 295 | 
            +
                            const cleanedType = getFeatureTypes().find(
         | 
| 296 | 
            +
                              (t) => t.toLowerCase() === type.toLowerCase()
         | 
| 297 | 
            +
                            );
         | 
| 298 | 
            +
                            if (!cleanedType) {
         | 
| 299 | 
            +
                              if (!convertNonStandardTypes) {
         | 
| 300 | 
            +
                                convertNonStandardTypes = await showConfirmationDialog({
         | 
| 301 | 
            +
                                  cancelButtonText: "Stop Auto-Annotate",
         | 
| 302 | 
            +
                                  text: `Detected that ${rowName} has a non-standard type of ${type}. We will assign it and all subsequent non-standard types to use the misc_feature type instead`,
         | 
| 303 | 
            +
                                });
         | 
| 304 | 
            +
                                if (!convertNonStandardTypes) {
         | 
| 305 | 
            +
                                  throw {
         | 
| 306 | 
            +
                                    validationError: `${rowName} specifies the feature type ${type} which is not valid`,
         | 
| 307 | 
            +
                                  };
         | 
| 308 | 
            +
                                }
         | 
| 309 | 
            +
                              }
         | 
| 310 | 
            +
                              row.type = "misc_feature";
         | 
| 311 | 
            +
                            } else {
         | 
| 312 | 
            +
                              row.type = cleanedType;
         | 
| 313 | 
            +
                            }
         | 
| 314 | 
            +
                          }
         | 
| 315 | 
            +
                          if (!sequence) {
         | 
| 316 | 
            +
                            throw {
         | 
| 317 | 
            +
                              validationError: `${rowName} did not have a sequence`,
         | 
| 318 | 
            +
                            };
         | 
| 319 | 
            +
                          }
         | 
| 320 | 
            +
                          if (row.isRegex && row.isRegex.toUpperCase() === "TRUE") {
         | 
| 321 | 
            +
                            try {
         | 
| 322 | 
            +
                              new RegExp(regexConvertedSeq); //just trying out whether the regexConvertedSeq will work as a valid regex
         | 
| 323 | 
            +
                            } catch (error) {
         | 
| 324 | 
            +
                              throw {
         | 
| 325 | 
            +
                                validationError: `${rowName} has an invalid sequence/regex. Please fix it manually.`,
         | 
| 326 | 
            +
                              };
         | 
| 327 | 
            +
                            }
         | 
| 328 | 
            +
                            row.isRegex = true;
         | 
| 329 | 
            +
                          } else {
         | 
| 330 | 
            +
                            row.isRegex = undefined;
         | 
| 331 | 
            +
                          }
         | 
| 332 | 
            +
                          annsToCheck.push(row);
         | 
| 333 | 
            +
                        };
         | 
| 334 | 
            +
                        if (fileType === "implementerDefined") {
         | 
| 335 | 
            +
                          for (const [
         | 
| 336 | 
            +
                            // eslint-disable-next-line no-unused-vars
         | 
| 337 | 
            +
                            i,
         | 
| 338 | 
            +
                            // eslint-disable-next-line no-unused-vars
         | 
| 339 | 
            +
                            { name, sequence, matchType, type, isRegex },
         | 
| 340 | 
            +
                          ] of customAnnResponse.list.entries()) {
         | 
| 341 | 
            +
                            await validateRow(
         | 
| 342 | 
            +
                              {
         | 
| 343 | 
            +
                                name,
         | 
| 344 | 
            +
                                sequence,
         | 
| 345 | 
            +
                                matchType,
         | 
| 346 | 
            +
                                type,
         | 
| 347 | 
            +
                                isRegex: isRegex ? "TRUE" : "FALSE",
         | 
| 348 | 
            +
                              },
         | 
| 349 | 
            +
                              `Row ${i + 1} (${name})`
         | 
| 350 | 
            +
                            );
         | 
| 351 | 
            +
                          }
         | 
| 352 | 
            +
                        } else if (fileType === "csvFile") {
         | 
| 353 | 
            +
                          const csvHeaders = ["name", "description", "sequence"];
         | 
| 354 | 
            +
                          if (annotationType === "feature") {
         | 
| 355 | 
            +
                            csvHeaders.push("type");
         | 
| 356 | 
            +
                          }
         | 
| 357 | 
            +
                          csvHeaders.push("isRegex");
         | 
| 358 | 
            +
                          const {
         | 
| 359 | 
            +
                            data,
         | 
| 360 | 
            +
                            meta: { fields },
         | 
| 361 | 
            +
                          } = await parseCsvFile(csvFile[0]);
         | 
| 362 | 
            +
                          const error = validateCSVRequiredHeaders(fields, csvHeaders);
         | 
| 363 | 
            +
                          if (error) {
         | 
| 364 | 
            +
                            throw {
         | 
| 365 | 
            +
                              validationError: error,
         | 
| 366 | 
            +
                            };
         | 
| 367 | 
            +
                          }
         | 
| 368 | 
            +
             | 
| 369 | 
            +
                          // eslint-disable-next-line no-unused-vars
         | 
| 370 | 
            +
                          for (const [index, row] of data.entries()) {
         | 
| 371 | 
            +
                            const error = validateCSVRow(row, csvHeaders, index);
         | 
| 372 | 
            +
                            if (error) {
         | 
| 373 | 
            +
                              throw {
         | 
| 374 | 
            +
                                validationError: error,
         | 
| 375 | 
            +
                              };
         | 
| 376 | 
            +
                            }
         | 
| 377 | 
            +
                            await validateRow(row, `Row ${index + 1} (${row.name})`);
         | 
| 378 | 
            +
                          }
         | 
| 379 | 
            +
                        } else if (fileType === "apeFile") {
         | 
| 380 | 
            +
                          const { data } = await parseCsvFile(apeFile[0], {
         | 
| 381 | 
            +
                            header: false,
         | 
| 382 | 
            +
                          });
         | 
| 383 | 
            +
                          // eslint-disable-next-line no-unused-vars
         | 
| 384 | 
            +
                          for (const [i, [name, sequence, type]] of data.entries()) {
         | 
| 385 | 
            +
                            await validateRow(
         | 
| 386 | 
            +
                              { name, sequence, type },
         | 
| 387 | 
            +
                              `Row ${i + 1} (${name})`
         | 
| 388 | 
            +
                            );
         | 
| 389 | 
            +
                          }
         | 
| 390 | 
            +
                        } else {
         | 
| 391 | 
            +
                          console.info(`we shouldn't be here!`);
         | 
| 392 | 
            +
                          console.info(`fileType:`, fileType);
         | 
| 393 | 
            +
                        }
         | 
| 394 | 
            +
             | 
| 395 | 
            +
                        if (!annsToCheck.length) {
         | 
| 396 | 
            +
                          return window.toastr.warning(
         | 
| 397 | 
            +
                            "No Annotations Detected on File. Please check that your file is in the correct format."
         | 
| 398 | 
            +
                          );
         | 
| 399 | 
            +
                        }
         | 
| 400 | 
            +
                        const annotationsToCheckById = {};
         | 
| 401 | 
            +
                        annsToCheck.forEach((ann) => {
         | 
| 402 | 
            +
                          if (ann.matchType === "protein") {
         | 
| 403 | 
            +
                            ann.sequence = convertProteinSeqToDNAIupac(ann.sequence);
         | 
| 404 | 
            +
                          }
         | 
| 405 | 
            +
                          const id = shortid();
         | 
| 406 | 
            +
                          annotationsToCheckById[id] = {
         | 
| 407 | 
            +
                            ...ann,
         | 
| 408 | 
            +
                            sequence: ann.isRegex
         | 
| 409 | 
            +
                              ? ann.sequence
         | 
| 410 | 
            +
                              : convertApELikeRegexToRegex(ann.sequence),
         | 
| 411 | 
            +
                            id,
         | 
| 412 | 
            +
                          };
         | 
| 413 | 
            +
                        });
         | 
| 414 | 
            +
             | 
| 415 | 
            +
                        const seqId = "placeholderId";
         | 
| 416 | 
            +
                        const { [seqId]: newAnns } = autoAnnotate({
         | 
| 417 | 
            +
                          seqsToAnnotateById: {
         | 
| 418 | 
            +
                            [seqId]: { ...sequenceData, id: seqId },
         | 
| 419 | 
            +
                          },
         | 
| 420 | 
            +
                          annotationsToCheckById,
         | 
| 421 | 
            +
                        });
         | 
| 422 | 
            +
             | 
| 423 | 
            +
                        if (newAnns && newAnns.length) {
         | 
| 424 | 
            +
                          setNewAnns(
         | 
| 425 | 
            +
                            newAnns.map((a) => {
         | 
| 426 | 
            +
                              const toRet = {
         | 
| 427 | 
            +
                                ...annotationsToCheckById[a.id],
         | 
| 428 | 
            +
                                ...a,
         | 
| 429 | 
            +
                                forward: a.strand !== -1,
         | 
| 430 | 
            +
                                id: shortid(),
         | 
| 431 | 
            +
                              };
         | 
| 432 | 
            +
                              toRet.color =
         | 
| 433 | 
            +
                                toRet.color || getFeatureToColorMap()[toRet.type];
         | 
| 434 | 
            +
                              return toRet;
         | 
| 435 | 
            +
                            })
         | 
| 436 | 
            +
                          );
         | 
| 437 | 
            +
                        } else {
         | 
| 438 | 
            +
                          window.toastr.warning(
         | 
| 439 | 
            +
                            `No ${annotationType}s detected on sequence.`
         | 
| 440 | 
            +
                          );
         | 
| 441 | 
            +
                        }
         | 
| 442 | 
            +
                      } catch (error) {
         | 
| 443 | 
            +
                        console.error(`error:`, error);
         | 
| 444 | 
            +
                        if (error.validationError) {
         | 
| 445 | 
            +
                          throw new SubmissionError({ [fileType]: error.validationError });
         | 
| 446 | 
            +
                        } else {
         | 
| 447 | 
            +
                          window.toastr.error(
         | 
| 448 | 
            +
                            `Error annotating ${annotationType}(s). Double check your file to make sure it is valid!`
         | 
| 449 | 
            +
                          );
         | 
| 450 | 
            +
                        }
         | 
| 451 | 
            +
                      }
         | 
| 452 | 
            +
                    })}
         | 
| 453 | 
            +
                    text="Annotate"
         | 
| 454 | 
            +
                  ></DialogFooter>
         | 
| 455 | 
            +
                </div>
         | 
| 456 | 
            +
              );
         | 
| 457 | 
            +
            });
         | 
| 458 | 
            +
             | 
| 459 | 
            +
            if (!window._ove_addons) window._ove_addons = {};
         | 
| 460 | 
            +
            window._ove_addons.autoAnnotateFeatures = autoAnnotateFeatures;
         | 
| 461 | 
            +
            window._ove_addons.autoAnnotateParts = autoAnnotateParts;
         | 
| 462 | 
            +
            window._ove_addons.autoAnnotatePrimers = autoAnnotatePrimers;
         | 
| 463 | 
            +
             | 
| 464 | 
            +
            const customAnnsSchema = ["name", "sequence", typeField, "isRegex"];
         | 
| 465 | 
            +
            const customAnnsSchemaNoType = ["name", "sequence", typeField, "isRegex"];
         | 
| 466 | 
            +
             | 
| 467 | 
            +
            const validateAgainstSchema = {
         | 
| 468 | 
            +
              fields: [
         | 
| 469 | 
            +
                {
         | 
| 470 | 
            +
                  path: "name",
         | 
| 471 | 
            +
                  type: "string",
         | 
| 472 | 
            +
                  isRequired: true,
         | 
| 473 | 
            +
                },
         | 
| 474 | 
            +
                {
         | 
| 475 | 
            +
                  path: "description",
         | 
| 476 | 
            +
                  type: "string",
         | 
| 477 | 
            +
                },
         | 
| 478 | 
            +
                {
         | 
| 479 | 
            +
                  path: "sequence",
         | 
| 480 | 
            +
                  type: "string",
         | 
| 481 | 
            +
                  isRequired: true,
         | 
| 482 | 
            +
                },
         | 
| 483 | 
            +
                {
         | 
| 484 | 
            +
                  path: "type",
         | 
| 485 | 
            +
                  type: "dropdown",
         | 
| 486 | 
            +
                  values: getFeatureTypes(),
         | 
| 487 | 
            +
                  defaultValue: "misc_feature",
         | 
| 488 | 
            +
                },
         | 
| 489 | 
            +
                {
         | 
| 490 | 
            +
                  path: "isRegex",
         | 
| 491 | 
            +
                  type: "boolean",
         | 
| 492 | 
            +
                },
         | 
| 493 | 
            +
                {
         | 
| 494 | 
            +
                  path: "matchType",
         | 
| 495 | 
            +
                  type: "dropdown",
         | 
| 496 | 
            +
                  defaultValue: "dna",
         | 
| 497 | 
            +
                  values: ["dna", "protein"],
         | 
| 498 | 
            +
                },
         | 
| 499 | 
            +
              ],
         | 
| 500 | 
            +
            };
         |