@teselagen/bio-parsers 0.3.7 → 0.3.9
This diff represents the content of publicly available package versions that have been released to one of the supported registries. The information contained in this diff is provided for informational purposes only and reflects changes between package versions as they appear in their respective public registries.
- package/README.md +330 -0
- package/fastaToJson.d.ts +1 -1
- package/index.js +133 -116
- package/index.mjs +133 -116
- package/index.umd.js +132 -115
- package/package.json +1 -2
- package/src/ab1ToJson.js +13 -18
- package/src/anyToJson.js +7 -7
- package/src/fastaToJson.js +12 -7
- package/src/genbankToJson.js +21 -20
- package/src/geneiousXmlToJson.js +3 -6
- package/src/gffToJson.js +5 -5
- package/src/jbeiXmlToJson.js +10 -13
- package/src/jsonToBed.js +4 -3
- package/src/jsonToFasta.js +4 -2
- package/src/jsonToGenbank.js +13 -12
- package/src/jsonToJsonString.js +1 -1
- package/src/sbolXmlToJson.js +9 -9
- package/src/snapgeneToJson.js +14 -12
- package/src/utils/NameUtils.js +1 -1
- package/src/utils/ParserUtil.js +81 -83
- package/src/utils/cleanUpTeselagenJsonForExport.js +8 -9
- package/src/utils/constants.js +22 -22
- package/src/utils/convertOldSequenceDataToNewDataType.js +5 -6
- package/src/utils/createInitialSequence.js +13 -11
- package/src/utils/extractFileExtension.js +11 -13
- package/src/utils/flattenSequenceArray.js +14 -14
- package/src/utils/getArrayBufferFromFile.js +5 -5
- package/src/utils/isBrowser.js +2 -1
- package/src/utils/parseUracilFeatures.js +2 -2
- package/src/utils/pragmasAndTypes.js +3 -2
- package/src/utils/searchWholeObjByName.js +3 -3
- package/src/utils/splitStringIntoLines.js +13 -12
- package/src/utils/validateSequence.js +15 -10
- package/src/utils/validateSequenceArray.js +17 -17
- package/utils/getArrayBufferFromFile.d.ts +1 -1
package/README.md
ADDED
|
@@ -0,0 +1,330 @@
|
|
|
1
|
+
# Bio Parsers
|
|
2
|
+
|
|
3
|
+
<!-- TOC -->
|
|
4
|
+
|
|
5
|
+
- [Bio Parsers](#bio-parsers)
|
|
6
|
+
- [About this Repo](#about-this-repo)
|
|
7
|
+
- [[CHANGELOG](CHANGELOG.md)](#changelogchangelogmd)
|
|
8
|
+
- [Exported Functions](#exported-functions)
|
|
9
|
+
- [Format Specification](#format-specification)
|
|
10
|
+
- [Usage](#usage)
|
|
11
|
+
- [install](#install)
|
|
12
|
+
- [jsonToGenbank (same interface as jsonToFasta)](#jsontogenbank-same-interface-as-jsontofasta)
|
|
13
|
+
- [anyToJson (same interface as genbankToJson, fastaToJson, xxxxToJson) (async required)](#anytojson-same-interface-as-genbanktojson-fastatojson-xxxxtojson-async-required)
|
|
14
|
+
- [Options (for anyToJson or xxxxToJson)](#options-for-anytojson-or-xxxxtojson)
|
|
15
|
+
- [ab1ToJson](#ab1tojson)
|
|
16
|
+
- [snapgeneToJson (.dna files)](#snapgenetojson-dna-files)
|
|
17
|
+
- [genbankToJson](#genbanktojson)
|
|
18
|
+
- [Updating this repo](#updating-this-repo)
|
|
19
|
+
- [Outside collaborators](#outside-collaborators)
|
|
20
|
+
- [Thanks/Collaborators](#thankscollaborators)
|
|
21
|
+
|
|
22
|
+
<!-- /TOC -->
|
|
23
|
+
|
|
24
|
+
## About this Repo
|
|
25
|
+
|
|
26
|
+
This repo contains a set of parsers to convert between datatypes through a generalized JSON format.
|
|
27
|
+
|
|
28
|
+
## [CHANGELOG](CHANGELOG.md)
|
|
29
|
+
|
|
30
|
+
## Exported Functions
|
|
31
|
+
|
|
32
|
+
Use the following exports to convert to a generalized JSON format:
|
|
33
|
+
|
|
34
|
+
```
|
|
35
|
+
fastaToJson //handles fasta files (.fa, .fasta)
|
|
36
|
+
genbankToJson //handles genbank files (.gb, .gbk)
|
|
37
|
+
ab1ToJson //handles .ab1 sequencing read files
|
|
38
|
+
sbolXmlToJson //handles .sbol files
|
|
39
|
+
geneiousXmlToJson //handles .genious files
|
|
40
|
+
jbeiXmlToJson //handles jbei .seq or .xml files
|
|
41
|
+
snapgeneToJson //handles snapgene (.dna) files
|
|
42
|
+
anyToJson //this handles any of the above file types based on file extension
|
|
43
|
+
```
|
|
44
|
+
|
|
45
|
+
Use the following exports to convert from a generalized JSON format back to a specific format:
|
|
46
|
+
|
|
47
|
+
```
|
|
48
|
+
jsonToGenbank
|
|
49
|
+
jsonToFasta
|
|
50
|
+
jsonToBed
|
|
51
|
+
```
|
|
52
|
+
|
|
53
|
+
## Format Specification
|
|
54
|
+
|
|
55
|
+
The generalized JSON format looks like:
|
|
56
|
+
|
|
57
|
+
```js
|
|
58
|
+
const generalizedJsonFormat = {
|
|
59
|
+
size: 25,
|
|
60
|
+
sequence: "asaasdgasdgasdgasdgasgdasgdasdgasdgasgdagasdgasdfasdfdfasdfa",
|
|
61
|
+
circular: true,
|
|
62
|
+
name: "pBbS8c-RFP",
|
|
63
|
+
description: "",
|
|
64
|
+
parts: [
|
|
65
|
+
{
|
|
66
|
+
name: "part 1",
|
|
67
|
+
type: "CDS", //optional for parts
|
|
68
|
+
id: "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you
|
|
69
|
+
start: 10, //0-based inclusive index
|
|
70
|
+
end: 30, //0-based inclusive index
|
|
71
|
+
strand: 1,
|
|
72
|
+
notes: {}
|
|
73
|
+
}
|
|
74
|
+
],
|
|
75
|
+
primers: [
|
|
76
|
+
{
|
|
77
|
+
name: "primer 1",
|
|
78
|
+
id: "092j92", //Must be a unique id. If no id is provided, we'll autogenerate one for you
|
|
79
|
+
start: 10, //0-based inclusive index
|
|
80
|
+
end: 30, //0-based inclusive index
|
|
81
|
+
strand: 1,
|
|
82
|
+
notes: {}
|
|
83
|
+
}
|
|
84
|
+
],
|
|
85
|
+
features: [
|
|
86
|
+
{
|
|
87
|
+
name: "anonymous feature",
|
|
88
|
+
type: "misc_feature",
|
|
89
|
+
id: "5590c1978979df000a4f02c7", //Must be a unique id. If no id is provided, we'll autogenerate one for you
|
|
90
|
+
start: 1,
|
|
91
|
+
end: 3,
|
|
92
|
+
strand: 1,
|
|
93
|
+
notes: {}
|
|
94
|
+
},
|
|
95
|
+
{
|
|
96
|
+
name: "coding region 1",
|
|
97
|
+
type: "CDS",
|
|
98
|
+
id: "5590c1d88979df000a4f02f5",
|
|
99
|
+
start: 12,
|
|
100
|
+
end: 9,
|
|
101
|
+
strand: -1,
|
|
102
|
+
notes: {}
|
|
103
|
+
}
|
|
104
|
+
],
|
|
105
|
+
//only if parsing in an ab1 file
|
|
106
|
+
chromatogramData: {
|
|
107
|
+
aTrace: [], //same as cTrace but for a
|
|
108
|
+
tTrace: [], //same as cTrace but for t
|
|
109
|
+
gTrace: [], //same as cTrace but for g
|
|
110
|
+
cTrace: [0, 0, 0, 1, 3, 5, 11, 24, 56, 68, 54, 30, 21, 3, 1, 4, 1, 0, 0, ...etc], //heights of the curve spaced 1 per x position (aka if the cTrace.length === 1000, then the max basePos can be is 1000)
|
|
111
|
+
basePos: [33, 46, 55, ...etc], //x position of the bases (can be unevenly spaced)
|
|
112
|
+
baseCalls: ["A", "T", ...etc],
|
|
113
|
+
qualNums: [] //or undefined if no qualNums are detected on the file
|
|
114
|
+
}
|
|
115
|
+
};
|
|
116
|
+
```
|
|
117
|
+
|
|
118
|
+
## Usage
|
|
119
|
+
|
|
120
|
+
### install
|
|
121
|
+
|
|
122
|
+
`npm install -S @teselagen/bio-parsers`
|
|
123
|
+
|
|
124
|
+
or
|
|
125
|
+
|
|
126
|
+
`yarn add @teselagen/bio-parsers`
|
|
127
|
+
|
|
128
|
+
or
|
|
129
|
+
|
|
130
|
+
use it from a script tag:
|
|
131
|
+
|
|
132
|
+
```html
|
|
133
|
+
<script src="https://unpkg.com/bio-parsers/umd/bio-parsers.js"></script>
|
|
134
|
+
<script>
|
|
135
|
+
async function main() {
|
|
136
|
+
var jsonOutput = await window.bioParsers.genbankToJson(
|
|
137
|
+
`LOCUS kc2 108 bp DNA linear 01-NOV-2016
|
|
138
|
+
COMMENT teselagen_unique_id: 581929a7bc6d3e00ac7394e8
|
|
139
|
+
FEATURES Location/Qualifiers
|
|
140
|
+
CDS 1..108
|
|
141
|
+
/label="GFPuv"
|
|
142
|
+
misc_feature 61..108
|
|
143
|
+
/label="gly_ser_linker"
|
|
144
|
+
bogus_dude 4..60
|
|
145
|
+
/label="ccmN_sig_pep"
|
|
146
|
+
misc_feature 4..60
|
|
147
|
+
/label="ccmN_nterm_sig_pep"
|
|
148
|
+
/pragma="Teselagen_Part"
|
|
149
|
+
/preferred5PrimeOverhangs=""
|
|
150
|
+
/preferred3PrimeOverhangs=""
|
|
151
|
+
ORIGIN
|
|
152
|
+
1 atgaaggtct acggcaagga acagtttttg cggatgcgcc agagcatgtt ccccgatcgc
|
|
153
|
+
61 ggtggcagtg gtagcgggag ctcgggtggc tcaggctctg ggg
|
|
154
|
+
//`
|
|
155
|
+
);
|
|
156
|
+
console.log("jsonOutput:", jsonOutput);
|
|
157
|
+
var genbankString = window.bioParsers.jsonToGenbank(jsonOutput[0].parsedSequence);
|
|
158
|
+
console.log(genbankString);
|
|
159
|
+
}
|
|
160
|
+
main();
|
|
161
|
+
</script>
|
|
162
|
+
```
|
|
163
|
+
|
|
164
|
+
see the `./umd_demo.html` file for a full working example
|
|
165
|
+
|
|
166
|
+
### jsonToGenbank (same interface as jsonToFasta)
|
|
167
|
+
|
|
168
|
+
```js
|
|
169
|
+
//To go from json to genbank:
|
|
170
|
+
import { jsonToGenbank } from "bio-parsers"
|
|
171
|
+
//You can pass an optional options object as the second argument. Here are the defaults
|
|
172
|
+
const options = {
|
|
173
|
+
isProtein: false, //by default the sequence will be parsed and validated as type DNA (unless U's instead of T's are found). If isProtein=true the sequence will be parsed and validated as a PROTEIN type (seqData.isProtein === true)
|
|
174
|
+
guessIfProtein: false, //if true the parser will attempt to guess if the sequence is of type DNA or type PROTEIN (this will override the isProtein flag)
|
|
175
|
+
guessIfProteinOptions: {
|
|
176
|
+
threshold = 0.90, //percent of characters that must be DNA letters to be considered of type DNA
|
|
177
|
+
dnaLetters = ['G', 'A', 'T', 'C'] //customizable set of letters to use as DNA
|
|
178
|
+
},
|
|
179
|
+
inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive
|
|
180
|
+
inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive
|
|
181
|
+
// Example:
|
|
182
|
+
// 0123456
|
|
183
|
+
// ATGAGAG
|
|
184
|
+
// --fff-- (the feature covers GAG)
|
|
185
|
+
// 0-based inclusive start:
|
|
186
|
+
// feature.start = 2
|
|
187
|
+
// 1-based inclusive start:
|
|
188
|
+
// feature.start = 3
|
|
189
|
+
// 0-based inclusive end:
|
|
190
|
+
// feature.end = 4
|
|
191
|
+
// 1-based inclusive end:
|
|
192
|
+
// feature.end = 5
|
|
193
|
+
}
|
|
194
|
+
const genbankString = jsonToGenbank(generalizedJsonFormat, options)
|
|
195
|
+
|
|
196
|
+
```
|
|
197
|
+
|
|
198
|
+
### anyToJson (same interface as genbankToJson, fastaToJson, xxxxToJson) (async required)
|
|
199
|
+
|
|
200
|
+
```js
|
|
201
|
+
import { anyToJson } from "bio-parsers";
|
|
202
|
+
|
|
203
|
+
//note, anyToJson should be called using an await to allow for file parsing to occur (if a file is being passed)
|
|
204
|
+
const results = await anyToJson(
|
|
205
|
+
stringOrFile, //if ab1 files are being passed in you should pass files only, otherwise strings or files are fine as inputs
|
|
206
|
+
options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to!
|
|
207
|
+
);
|
|
208
|
+
|
|
209
|
+
//we always return an array of results because some files my contain multiple sequences
|
|
210
|
+
results[0].success; //either true or false
|
|
211
|
+
results[0].messages; //either an array of strings giving any warnings or errors generated during the parsing process
|
|
212
|
+
results[0].parsedSequence; //this will be the generalized json format as specified above :)
|
|
213
|
+
//chromatogram data will be here (ab1 only):
|
|
214
|
+
results[0].parsedSequence.chromatogramData;
|
|
215
|
+
```
|
|
216
|
+
|
|
217
|
+
### Options (for anyToJson or xxxxToJson)
|
|
218
|
+
|
|
219
|
+
```js
|
|
220
|
+
//You can pass an optional options object as the third argument. Here are the defaults
|
|
221
|
+
const options = {
|
|
222
|
+
fileName: "example.gb", //the filename is used if none is found in the genbank
|
|
223
|
+
isProtein: false, //if you know that it is a protein string being parsed you can pass true here
|
|
224
|
+
parseFastaAsCircular: false; //by default fasta files are parsed as linear sequences. You can change this by setting parseFastaAsCircular=true
|
|
225
|
+
//genbankToJson options only
|
|
226
|
+
inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive
|
|
227
|
+
inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive
|
|
228
|
+
acceptParts: true //by default features with a feature.notes.pragma[0] === "Teselagen_Part" are added to the sequenceData.parts array. Setting this to false will keep them as features instead
|
|
229
|
+
// fastaToJson options only
|
|
230
|
+
parseName: true //by default attempt to parse the name and description of sequence from the comment line. Setting this to false will keep the name unchanged with no description
|
|
231
|
+
}
|
|
232
|
+
```
|
|
233
|
+
|
|
234
|
+
### ab1ToJson
|
|
235
|
+
|
|
236
|
+
```js
|
|
237
|
+
import { ab1ToJson } from "bio-parsers";
|
|
238
|
+
const results = await ab1ToJson(
|
|
239
|
+
//this can be either a browser file <input type="file" id="input" multiple onchange="ab1ToJson(this.files[0])">
|
|
240
|
+
// or a node file ab1ToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1')));
|
|
241
|
+
file,
|
|
242
|
+
options //options.fileName (eg "pBad.ab1" or "pCherry.fasta") is important to pass here in order for the parser to!
|
|
243
|
+
);
|
|
244
|
+
|
|
245
|
+
//we always return an array of results because some files my contain multiple sequences
|
|
246
|
+
results[0].success; //either true or false
|
|
247
|
+
results[0].messages; //either an array of strings giving any warnings or errors generated during the parsing process
|
|
248
|
+
results[0].parsedSequence; //this will be the generalized json format as specified above :)
|
|
249
|
+
//chromatogram data will be here (ab1 only):
|
|
250
|
+
results[0].parsedSequence.chromatogramData;
|
|
251
|
+
```
|
|
252
|
+
|
|
253
|
+
### snapgeneToJson (.dna files)
|
|
254
|
+
|
|
255
|
+
```js
|
|
256
|
+
import { snapgeneToJson } from "bio-parsers";
|
|
257
|
+
//file can be either a browser file <input type="file" id="input" multiple onchange="snapgeneToJson(this.files[0])">
|
|
258
|
+
// or a node file snapgeneToJson(fs.readFileSync(path.join(__dirname, './testData/ab1/example1.ab1')));
|
|
259
|
+
const results = await snapgeneToJson(file, options);
|
|
260
|
+
```
|
|
261
|
+
|
|
262
|
+
### genbankToJson
|
|
263
|
+
|
|
264
|
+
```js
|
|
265
|
+
import { genbankToJson } from "bio-parsers";
|
|
266
|
+
|
|
267
|
+
const result = genbankToJson(string, options);
|
|
268
|
+
|
|
269
|
+
console.info(result);
|
|
270
|
+
// [
|
|
271
|
+
// {
|
|
272
|
+
// "messages": [
|
|
273
|
+
// "Import Error: Illegal character(s) detected and removed from sequence. Allowed characters are: atgcyrswkmbvdhn",
|
|
274
|
+
// "Invalid feature end: 1384 detected for Homo sapiens and set to 1",
|
|
275
|
+
// ],
|
|
276
|
+
// "success": true,
|
|
277
|
+
// "parsedSequence": {
|
|
278
|
+
// "features": [
|
|
279
|
+
// {
|
|
280
|
+
// "notes": {
|
|
281
|
+
// "organism": [
|
|
282
|
+
// "Homo sapiens"
|
|
283
|
+
// ],
|
|
284
|
+
// "db_xref": [
|
|
285
|
+
// "taxon:9606"
|
|
286
|
+
// ],
|
|
287
|
+
// "chromosome": [
|
|
288
|
+
// "17"
|
|
289
|
+
// ],
|
|
290
|
+
// "map": [
|
|
291
|
+
// "17q21"
|
|
292
|
+
// ]
|
|
293
|
+
// },
|
|
294
|
+
// "type": "source",
|
|
295
|
+
// "strand": 1,
|
|
296
|
+
// "name": "Homo sapiens",
|
|
297
|
+
// "start": 0,
|
|
298
|
+
// "end": 1
|
|
299
|
+
// }
|
|
300
|
+
// ],
|
|
301
|
+
// "name": "NP_003623",
|
|
302
|
+
// "sequence": "gagaggggggttatccccccttcgtcagtcgatcgtaacgtatcagcagcgcgcgagattttctggcgcagtcag",
|
|
303
|
+
// "circular": true,
|
|
304
|
+
// "extraLines": [
|
|
305
|
+
// "DEFINITION contactin-associated protein 1 precursor [Homo sapiens].",
|
|
306
|
+
// "ACCESSION NP_003623",
|
|
307
|
+
// "VERSION NP_003623.1 GI:4505463",
|
|
308
|
+
// "DBSOURCE REFSEQ: accession NM_003632.2",
|
|
309
|
+
// "KEYWORDS RefSeq."
|
|
310
|
+
// ],
|
|
311
|
+
// "type": "DNA",
|
|
312
|
+
// "size": 925
|
|
313
|
+
// }
|
|
314
|
+
// }
|
|
315
|
+
// ]
|
|
316
|
+
```
|
|
317
|
+
|
|
318
|
+
You can see more examples by looking at the tests.
|
|
319
|
+
|
|
320
|
+
## Updating this repo
|
|
321
|
+
|
|
322
|
+
### Outside collaborators
|
|
323
|
+
|
|
324
|
+
fork and pull request please :)
|
|
325
|
+
|
|
326
|
+
## Thanks/Collaborators
|
|
327
|
+
|
|
328
|
+
- IsaacLuo - https://github.com/IsaacLuo/SnapGeneFileReader (from which the snapgene parser was adapted)
|
|
329
|
+
- Joshua Nixon (original collaborator)
|
|
330
|
+
- Thomas Rich (original collaborator)
|
package/fastaToJson.d.ts
CHANGED
|
@@ -5,4 +5,4 @@ export default fastaToJson;
|
|
|
5
5
|
* @param {[function]} onFileParsed [callback for a parsed sequence]
|
|
6
6
|
* @author Joshua P Nixon
|
|
7
7
|
*/
|
|
8
|
-
declare function fastaToJson(fileString: [string], options
|
|
8
|
+
declare function fastaToJson(fileString: [string], options?: {}): any;
|