@rnacanvas/code 1.4.0 → 1.6.0

package/README.md

@@ -0,0 +1,67 @@
+# Console Interaction
+
+RNAcanvas Code can be interacted with using the web browser console.
+
+The web browser console can be opened with `Ctrl+Shift+J` (or `Cmd+Option+J` on Mac).
+
+# Quickstart
+
+### Drawing a structure
+
+```typescript
+// the structure to draw
+var seq = 'AGAGUAGCAUUCUGCUUUAGACUGUUAACUUUAUGAACCACGCGUGUCACGUGGGGAGAGUUAACAGCGCCC';
+var dotBracket = '(((((((....)))))))...(((((((((((.....(((((.......)))))..))))))))))).....';
+
+app.drawDotBracket(seq, dotBracket);
+
+// add some extra space around the drawn structure
+// (and ensure that the drawing is big enough for the drawn structure)
+app.drawing.setPadding(500);
+
+// fit the user's view of the drawing to the drawn structure
+app.drawingView.fitToContent();
+```
+
+### Controlling the layout of bases
+
+See the [full documentation](https://pzhaojohnson.github.io/rnacanvas.bases-layout/)
+for the `@rnacanvas/bases-layout` package.
+
+```typescript
+// all bases in the drawing
+var bases = [...app.drawing.bases];
+
+// shift the bases by the given vector
+shift(bases, { x: 500, y: -350 });
+
+// rotate the bases by 120 degrees clockwise
+rotate(bases, 2 * Math.PI / 3);
+
+// represents the central point of all bases
+let centroid = new Centroid(bases);
+
+// recenter the bases at (912, 204)
+centroid.set({ x: 912, y: 204 });
+centroid.get(); // { x: 912, y: 204 }
+
+// all base-pairs in the secondary structure of the drawing
+var basePairs = [...app.drawing.secondaryBonds].map(sb => [...sb.basePair]];
+
+// radialize the bases
+// (the default layout for the bases in a structure)
+radialize(bases, basePairs, { spacing: 20, basePairSpacing: 10, hairpinLoopSpacing: 10 });
+```
+
+### Exporting a drawing
+
+Drawings can be exported in SVG format,
+which can be opened (and edited further) in vector graphics softwares
+like Adobe Illustrator and Inkscape.
+
+```typescript
+// the outer HTML of the drawing is SVG XML that can be exported
+var file = new DownloadableFile(app.drawing.outerHTML);
+
+file.downloadAs('drawing.svg', { type: 'text/plain' });
+```

package/_config.yml

@@ -0,0 +1 @@
+theme: jekyll-theme-minimal