@layerzerolabs/lz-v2-stellar-sdk 0.2.8

package/src/generated/endpoint.ts

@@ -0,0 +1,1697 @@
+import { Buffer } from "buffer";
+import { Address } from '@stellar/stellar-sdk';
+import {
+  AssembledTransaction,
+  Client as ContractClient,
+  ClientOptions as ContractClientOptions,
+  MethodOptions,
+  Result,
+  Spec as ContractSpec,
+} from '@stellar/stellar-sdk/contract';
+import type {
+  u32,
+  i32,
+  u64,
+  i64,
+  u128,
+  i128,
+  u256,
+  i256,
+  Option,
+  Typepoint,
+  Duration,
+} from '@stellar/stellar-sdk/contract';
+export * from '@stellar/stellar-sdk'
+export * as contract from '@stellar/stellar-sdk/contract'
+export * as rpc from '@stellar/stellar-sdk/rpc'
+
+
+
+/**
+ * Parameters for sending a cross-chain message.
+ */
+export interface MessagingParams {
+  /**
+ * Destination endpoint ID (chain identifier).
+ */
+dst_eid: u32;
+  /**
+ * The message payload to send.
+ */
+message: Buffer;
+  /**
+ * Encoded executor and DVN options.
+ */
+options: Buffer;
+  /**
+ * Whether to pay fees in ZRO token instead of native token.
+ */
+pay_in_zro: boolean;
+  /**
+ * Receiver address on the destination chain (32 bytes).
+ */
+receiver: Buffer;
+}
+
+
+/**
+ * Source message information identifying where a cross-chain message came from.
+ */
+export interface Origin {
+  /**
+ * Nonce for this pathway.
+ */
+nonce: u64;
+  /**
+ * Sender address on the source chain (32 bytes).
+ */
+sender: Buffer;
+  /**
+ * Source endpoint ID (chain identifier).
+ */
+src_eid: u32;
+}
+
+
+/**
+ * Fee structure for cross-chain messaging.
+ */
+export interface MessagingFee {
+  /**
+ * Fee paid in native token (XLM).
+ */
+native_fee: i128;
+  /**
+ * Fee paid in ZRO token (LayerZero token).
+ */
+zro_fee: i128;
+}
+
+
+/**
+ * Receipt returned after successfully sending a cross-chain message.
+ */
+export interface MessagingReceipt {
+  /**
+ * The fees charged for sending the message.
+ */
+fee: MessagingFee;
+  /**
+ * Globally unique identifier for the message.
+ */
+guid: Buffer;
+  /**
+ * The outbound nonce for this pathway.
+ */
+nonce: u64;
+}
+
+/**
+ * Type of message library indicating supported operations.
+ */
+export type MessageLibType = {tag: "Send", values: void} | {tag: "Receive", values: void} | {tag: "SendAndReceive", values: void};
+
+
+/**
+ * Version information for a message library.
+ * 
+ * Note: `minor` and `endpoint_version` use `u32` instead of `u8` because Stellar does not
+ * support `u8` types in contract interface functions.
+ */
+export interface MessageLibVersion {
+  /**
+ * Endpoint version (should not exceed u8::MAX = 255).
+ */
+endpoint_version: u32;
+  /**
+ * Major version number.
+ */
+major: u64;
+  /**
+ * Minor version number (should not exceed u8::MAX = 255).
+ */
+minor: u32;
+}
+
+
+/**
+ * Timeout configuration for receive library transitions.
+ */
+export interface Timeout {
+  /**
+ * Unix timestamp when the timeout expires.
+ */
+expiry: u64;
+  /**
+ * The new library address to transition to.
+ */
+lib: string;
+}
+
+
+/**
+ * Parameters for setting message library configuration.
+ */
+export interface SetConfigParam {
+  /**
+ * XDR-encoded configuration data.
+ */
+config: Buffer;
+  /**
+ * The type of configuration (e.g., executor, ULN).
+ */
+config_type: u32;
+  /**
+ * The endpoint ID this config applies to.
+ */
+eid: u32;
+}
+
+
+/**
+ * Resolved library information with default status.
+ */
+export interface ResolvedLibrary {
+  /**
+ * Whether this is the default library (true) or OApp-specific (false).
+ */
+is_default: boolean;
+  /**
+ * The resolved library address.
+ */
+lib: string;
+}
+
+
+/**
+ * Outbound packet containing all information for cross-chain transmission.
+ */
+export interface OutboundPacket {
+  /**
+ * Destination endpoint ID.
+ */
+dst_eid: u32;
+  /**
+ * Globally unique identifier for this message.
+ */
+guid: Buffer;
+  /**
+ * The message payload.
+ */
+message: Buffer;
+  /**
+ * Outbound nonce for this pathway.
+ */
+nonce: u64;
+  /**
+ * Receiver address on destination chain (32 bytes).
+ */
+receiver: Buffer;
+  /**
+ * Sender address on source chain.
+ */
+sender: string;
+  /**
+ * Source endpoint ID.
+ */
+src_eid: u32;
+}
+
+
+/**
+ * A fee recipient with the amount to be paid.
+ */
+export interface FeeRecipient {
+  /**
+ * Address to receive the fee.
+ */
+address: string;
+  /**
+ * Amount of fee to pay.
+ */
+amount: i128;
+}
+
+
+/**
+ * Result of send operation containing fees and encoded packet.
+ */
+export interface FeesAndPacket {
+  /**
+ * The encoded packet ready for transmission.
+ */
+encoded_packet: Buffer;
+  /**
+ * List of native token fee recipients (executor, DVNs, treasury).
+ */
+native_fee_recipients: Array<FeeRecipient>;
+  /**
+ * List of ZRO token fee recipients (treasury).
+ */
+zro_fee_recipients: Array<FeeRecipient>;
+}
+
+export type EndpointStorage = {tag: "ZRO", values: void} | {tag: "Delegate", values: readonly [string]} | {tag: "LazyInboundNonce", values: readonly [string, u32, Buffer]} | {tag: "InboundPayloadHash", values: readonly [string, u32, Buffer, u64]} | {tag: "OutboundNonce", values: readonly [string, u32, Buffer]} | {tag: "RegisteredLibraryCount", values: void} | {tag: "LibraryToIndex", values: readonly [string]} | {tag: "IndexToLibrary", values: readonly [u32]} | {tag: "DefaultSendLibrary", values: readonly [u32]} | {tag: "DefaultReceiveLibrary", values: readonly [u32]} | {tag: "DefaultReceiveLibraryTimeout", values: readonly [u32]} | {tag: "SendLibrary", values: readonly [string, u32]} | {tag: "ReceiveLibrary", values: readonly [string, u32]} | {tag: "ReceiveLibraryTimeout", values: readonly [string, u32]} | {tag: "ComposeQueue", values: readonly [string, string, Buffer, u32]};
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+export const EndpointError = {
+  1: {message:"AlreadyRegistered"},
+  2: {message:"ComposeExists"},
+  3: {message:"ComposeNotFound"},
+  4: {message:"DefaultReceiveLibUnavailable"},
+  5: {message:"DefaultSendLibUnavailable"},
+  6: {message:"InsufficientNativeFee"},
+  7: {message:"InsufficientZROFee"},
+  8: {message:"InvalidExpiry"},
+  9: {message:"InvalidIndex"},
+  10: {message:"InvalidNonce"},
+  11: {message:"InvalidPayloadHash"},
+  12: {message:"InvalidReceiveLibrary"},
+  13: {message:"OnlyNonDefaultLib"},
+  14: {message:"OnlyReceiveLib"},
+  15: {message:"OnlyRegisteredLib"},
+  16: {message:"OnlySendLib"},
+  17: {message:"PathNotInitializable"},
+  18: {message:"PathNotVerifiable"},
+  19: {message:"PayloadHashNotFound"},
+  20: {message:"SameValue"},
+  21: {message:"Unauthorized"},
+  22: {message:"UnsupportedEid"},
+  23: {message:"ZeroZROFee"},
+  24: {message:"ZROUnavailable"}
+}
+
+export const BufferReaderError = {
+  10000: {message:"InvalidLength"},
+  10001: {message:"InvalidAddressPayload"}
+}
+
+export const BufferWriterError = {
+  10100: {message:"InvalidAddressPayload"}
+}
+
+export const TtlError = {
+  10200: {message:"InvalidTtlConfig"},
+  10201: {message:"TtlConfigFrozen"},
+  10202: {message:"TtlConfigAlreadyFrozen"}
+}
+
+export const OwnableError = {
+  10300: {message:"OwnerAlreadySet"},
+  10301: {message:"OwnerNotSet"}
+}
+
+export const BytesExtError = {
+  10400: {message:"LengthMismatch"}
+}
+
+
+
+export type DefaultOwnableStorage = {tag: "Owner", values: void};
+
+
+/**
+ * A pair of TTL values: threshold (when to trigger extension) and extend_to (target TTL).
+ */
+export interface TtlConfig {
+  /**
+ * Target TTL after extension (in ledgers).
+ */
+extend_to: u32;
+  /**
+ * TTL threshold that triggers extension (in ledgers).
+ */
+threshold: u32;
+}
+
+export type TtlConfigData = {tag: "Frozen", values: void} | {tag: "Instance", values: void} | {tag: "Persistent", values: void} | {tag: "Temporary", values: void};
+
+export interface Client {
+  /**
+   * Construct and simulate a send_compose transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Sends a composed message from an OApp to a composer.
+   * 
+   * The composer MUST assert the sender because anyone can send compose msg with this function.
+   * With the same GUID, the OApp can send compose to multiple composers at the same time.
+   */
+  send_compose: ({from, to, guid, index, message}: {from: string, to: string, guid: Buffer, index: u32, message: Buffer}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a clear_compose transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Clears a composed message by the composer.
+   * 
+   * This is a PULL mode versus the PUSH mode of `lz_compose`.
+   */
+  clear_compose: ({composer, from, guid, index, message}: {composer: string, from: string, guid: Buffer, index: u32, message: Buffer}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a lz_compose_alert transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Emits an alert event when `lz_compose` execution fails.
+   * 
+   * Called by the executor to notify about failed compose message delivery attempts.
+   */
+  lz_compose_alert: ({executor, from, to, guid, index, gas, value, message, extra_data, reason}: {executor: string, from: string, to: string, guid: Buffer, index: u32, gas: i128, value: i128, message: Buffer, extra_data: Buffer, reason: Buffer}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a compose_queue transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the stored hash for a composed message, or `None` if not queued.
+   */
+  compose_queue: ({from, to, guid, index}: {from: string, to: string, guid: Buffer, index: u32}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Option<Buffer>>>
+
+  /**
+   * Construct and simulate a skip transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Skips the next expected inbound nonce without verifying.
+   * 
+   * The nonce to skip must be the next expected nonce.
+   */
+  skip: ({caller, receiver, src_eid, sender, nonce}: {caller: string, receiver: string, src_eid: u32, sender: Buffer, nonce: u64}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a nilify transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Marks a packet as verified, but disallows execution until it is re-verified.
+   * 
+   * Requires the payload hash not been executed.
+   */
+  nilify: ({caller, receiver, src_eid, sender, nonce, payload_hash}: {caller: string, receiver: string, src_eid: u32, sender: Buffer, nonce: u64, payload_hash: Option<Buffer>}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a burn transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Marks a nonce as unexecutable and un-verifiable. The nonce can never be re-verified or executed.
+   */
+  burn: ({caller, receiver, src_eid, sender, nonce, payload_hash}: {caller: string, receiver: string, src_eid: u32, sender: Buffer, nonce: u64, payload_hash: Buffer}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a next_guid transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Generates the next GUID for an outbound packet.
+   */
+  next_guid: ({sender, dst_eid, receiver}: {sender: string, dst_eid: u32, receiver: Buffer}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Buffer>>
+
+  /**
+   * Construct and simulate a outbound_nonce transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the current outbound nonce for a specific destination.
+   */
+  outbound_nonce: ({sender, dst_eid, receiver}: {sender: string, dst_eid: u32, receiver: Buffer}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<u64>>
+
+  /**
+   * Construct and simulate a inbound_nonce transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the max index of the longest gapless sequence of verified message nonces.
+   * 
+   * The uninitialized value is 0. The first nonce is always 1.
+   * It starts from the `lazy_inbound_nonce` (last checkpoint) and iteratively checks
+   * if the next nonce has been verified.
+   * 
+   * Note: OApp explicitly skipped nonces count as "verified" for these purposes.
+   * 
+   * Examples: `[1,2,3,4,6,7] => 4`, `[1,2,6,8,10] => 2`, `[1,3,4,5,6] => 1`
+   */
+  inbound_nonce: ({receiver, src_eid, sender}: {receiver: string, src_eid: u32, sender: Buffer}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<u64>>
+
+  /**
+   * Construct and simulate a lazy_inbound_nonce transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the lazy inbound nonce (last checkpoint) for a specific path.
+   */
+  lazy_inbound_nonce: ({receiver, src_eid, sender}: {receiver: string, src_eid: u32, sender: Buffer}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<u64>>
+
+  /**
+   * Construct and simulate a inbound_payload_hash transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the payload hash for a specific inbound nonce.
+   */
+  inbound_payload_hash: ({receiver, src_eid, sender, nonce}: {receiver: string, src_eid: u32, sender: Buffer, nonce: u64}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Option<Buffer>>>
+
+  /**
+   * Construct and simulate a register_library transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Registers a new message library with the endpoint.
+   */
+  register_library: ({new_lib}: {new_lib: string}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a set_default_send_library transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Sets the default send library for a destination endpoint.
+   */
+  set_default_send_library: ({dst_eid, new_lib}: {dst_eid: u32, new_lib: string}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a set_default_receive_library transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Sets the default receive library for a source endpoint.
+   * 
+   * If a grace period is provided and there was a previous library, the old library
+   * remains valid until the grace period expires.
+   */
+  set_default_receive_library: ({src_eid, new_lib, grace_period}: {src_eid: u32, new_lib: string, grace_period: u64}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a set_default_receive_lib_timeout transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Sets or removes the default receive library timeout for a source endpoint.
+   * 
+   * If a timeout is provided, it must be valid and not expired. If no timeout is provided,
+   * the default receive library timeout is removed.
+   */
+  set_default_receive_lib_timeout: ({src_eid, timeout}: {src_eid: u32, timeout: Option<Timeout>}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a set_send_library transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Sets or removes a custom send library for an OApp to a specific destination endpoint.
+   */
+  set_send_library: ({caller, sender, dst_eid, new_lib}: {caller: string, sender: string, dst_eid: u32, new_lib: Option<string>}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a set_receive_library transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Sets or removes a custom receive library for an OApp to a specific source endpoint.
+   * 
+   * If a grace period is provided and there was a previous library, the old library
+   * remains valid until the grace period expires.
+   */
+  set_receive_library: ({caller, receiver, src_eid, new_lib, grace_period}: {caller: string, receiver: string, src_eid: u32, new_lib: Option<string>, grace_period: u64}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a set_receive_library_timeout transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Sets or removes the custom receive library timeout for an OApp.
+   * 
+   * Allows an OApp to extend or remove the validity period of a previously set library
+   * after switching to a new one.
+   */
+  set_receive_library_timeout: ({caller, receiver, src_eid, timeout}: {caller: string, receiver: string, src_eid: u32, timeout: Option<Timeout>}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a set_config transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Sets the configuration for a message library.
+   * 
+   * Requires the caller to be the OApp or its delegate and the library to be registered.
+   */
+  set_config: ({caller, oapp, lib, params}: {caller: string, oapp: string, lib: string, params: Array<SetConfigParam>}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a is_registered_library transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Checks if a message library is registered.
+   */
+  is_registered_library: ({lib}: {lib: string}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<boolean>>
+
+  /**
+   * Construct and simulate a get_library_index transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the index of a message library.
+   */
+  get_library_index: ({lib}: {lib: string}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Option<u32>>>
+
+  /**
+   * Construct and simulate a registered_libraries_count transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the number of registered message libraries.
+   */
+  registered_libraries_count: (txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<u32>>
+
+  /**
+   * Construct and simulate a get_registered_libraries transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns a list of registered message libraries within the specified range.
+   */
+  get_registered_libraries: ({start, max_count}: {start: u32, max_count: u32}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Array<string>>>
+
+  /**
+   * Construct and simulate a is_supported_eid transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Checks if an endpoint ID is supported.
+   * Returns true only if both the default send/receive libraries are set for the given eid
+   */
+  is_supported_eid: ({eid}: {eid: u32}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<boolean>>
+
+  /**
+   * Construct and simulate a default_send_library transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the default send library for a destination endpoint.
+   */
+  default_send_library: ({dst_eid}: {dst_eid: u32}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Option<string>>>
+
+  /**
+   * Construct and simulate a default_receive_library transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the default receive library for a source endpoint.
+   */
+  default_receive_library: ({src_eid}: {src_eid: u32}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Option<string>>>
+
+  /**
+   * Construct and simulate a default_receive_library_timeout transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the default receive library timeout for a source endpoint.
+   */
+  default_receive_library_timeout: ({src_eid}: {src_eid: u32}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Option<Timeout>>>
+
+  /**
+   * Construct and simulate a get_send_library transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the effective send library for an OApp and destination endpoint.
+   */
+  get_send_library: ({sender, dst_eid}: {sender: string, dst_eid: u32}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<ResolvedLibrary>>
+
+  /**
+   * Construct and simulate a get_receive_library transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the effective receive library for an OApp and source endpoint.
+   */
+  get_receive_library: ({receiver, src_eid}: {receiver: string, src_eid: u32}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<ResolvedLibrary>>
+
+  /**
+   * Construct and simulate a receive_library_timeout transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the receive library timeout for an OApp and source endpoint.
+   */
+  receive_library_timeout: ({receiver, src_eid}: {receiver: string, src_eid: u32}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Option<Timeout>>>
+
+  /**
+   * Construct and simulate a is_valid_receive_library transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Checks if a receive library is valid for an OApp and source endpoint.
+   */
+  is_valid_receive_library: ({receiver, src_eid, actual_lib}: {receiver: string, src_eid: u32, actual_lib: string}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<boolean>>
+
+  /**
+   * Construct and simulate a get_config transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the configuration for a message library for a specific endpoint ID and configuration type.
+   */
+  get_config: ({oapp, lib, eid, config_type}: {oapp: string, lib: string, eid: u32, config_type: u32}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Buffer>>
+
+  /**
+   * Construct and simulate a quote transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Quotes the messaging fee for sending a cross-chain message.
+   */
+  quote: ({sender, params}: {sender: string, params: MessagingParams}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<MessagingFee>>
+
+  /**
+   * Construct and simulate a send transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Sends a cross-chain message to a destination endpoint.
+   * 
+   * OApp sender needs to transfer the fees to the endpoint before sending the message
+   */
+  send: ({sender, params, refund_address}: {sender: string, params: MessagingParams, refund_address: string}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<MessagingReceipt>>
+
+  /**
+   * Construct and simulate a verify transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Verifies an inbound cross-chain message from a configured receive library.
+   */
+  verify: ({receive_lib, origin, receiver, payload_hash}: {receive_lib: string, origin: Origin, receiver: string, payload_hash: Buffer}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a clear transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Clears a verified message from the endpoint.
+   * 
+   * This is a PULL mode versus the PUSH mode of `lz_receive`.
+   */
+  clear: ({caller, origin, receiver, guid, message}: {caller: string, origin: Origin, receiver: string, guid: Buffer, message: Buffer}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a lz_receive_alert transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Emits an alert event when `lz_receive` execution fails.
+   * 
+   * Called by the executor to notify about failed message delivery attempts.
+   */
+  lz_receive_alert: ({executor, origin, receiver, guid, gas, value, message, extra_data, reason}: {executor: string, origin: Origin, receiver: string, guid: Buffer, gas: i128, value: i128, message: Buffer, extra_data: Buffer, reason: Buffer}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a set_zro transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Sets the ZRO token address for fee payments.
+   */
+  set_zro: ({zro}: {zro: string}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a set_delegate transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Sets or removes a delegate address that can act on behalf of the OApp.
+   */
+  set_delegate: ({oapp, new_delegate}: {oapp: string, new_delegate: Option<string>}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a eid transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the endpoint ID.
+   */
+  eid: (txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<u32>>
+
+  /**
+   * Construct and simulate a initializable transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Checks if a messaging path can be/has been initialized for the given origin and receiver.
+   */
+  initializable: ({origin, receiver}: {origin: Origin, receiver: string}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<boolean>>
+
+  /**
+   * Construct and simulate a verifiable transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Checks if a message can be verified for the given origin and receiver.
+   */
+  verifiable: ({origin, receiver}: {origin: Origin, receiver: string}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<boolean>>
+
+  /**
+   * Construct and simulate a native_token transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the native token address used for fee payments.
+   */
+  native_token: (txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<string>>
+
+  /**
+   * Construct and simulate a zro transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the ZRO token address if set.
+   */
+  zro: (txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Option<string>>>
+
+  /**
+   * Construct and simulate a delegate transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Returns the delegate address for an OApp if set.
+   */
+  delegate: ({oapp}: {oapp: string}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Option<string>>>
+
+  /**
+   * Construct and simulate a recover_token transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   * Recovers tokens sent to this contract by mistake.
+   * 
+   * # Arguments
+   * * `token` - The token address to recover
+   * * `to` - The address to send the token to
+   * * `amount` - The amount to send
+   */
+  recover_token: ({token, to, amount}: {token: string, to: string, amount: i128}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a owner transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   */
+  owner: (txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<Option<string>>>
+
+  /**
+   * Construct and simulate a transfer_ownership transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   */
+  transfer_ownership: ({new_owner}: {new_owner: string}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a renounce_ownership transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   */
+  renounce_ownership: (txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a set_ttl_config transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   */
+  set_ttl_config: ({instance, persistent, temporary}: {instance: Option<TtlConfig>, persistent: Option<TtlConfig>, temporary: Option<TtlConfig>}, txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a ttl_config transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   */
+  ttl_config: (txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<readonly [Option<TtlConfig>, Option<TtlConfig>, Option<TtlConfig>]>>
+
+  /**
+   * Construct and simulate a freeze_ttl_config transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   */
+  freeze_ttl_config: (txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<null>>
+
+  /**
+   * Construct and simulate a is_ttl_config_frozen transaction. Returns an `AssembledTransaction` object which will have a `result` field containing the result of the simulation. If this transaction changes contract state, you will need to call `signAndSend()` on the returned object.
+   */
+  is_ttl_config_frozen: (txnOptions?: {
+    /**
+     * The fee to pay for the transaction. Default: BASE_FEE
+     */
+    fee?: number;
+
+    /**
+     * The maximum amount of time to wait for the transaction to complete. Default: DEFAULT_TIMEOUT
+     */
+    timeoutInSeconds?: number;
+
+    /**
+     * Whether to automatically simulate the transaction when constructing the AssembledTransaction. Default: true
+     */
+    simulate?: boolean;
+  }) => Promise<AssembledTransaction<boolean>>
+
+}
+export class Client extends ContractClient {
+  static async deploy<T = Client>(
+        /** Constructor/Initialization Args for the contract's `__constructor` method */
+        {owner}: {owner: string},
+    /** Options for initializing a Client as well as for calling a method, with extras specific to deploying. */
+    options: MethodOptions &
+      Omit<ContractClientOptions, "contractId"> & {
+        /** The hash of the Wasm blob, which must already be installed on-chain. */
+        wasmHash: Buffer | string;
+        /** Salt used to generate the contract's ID. Passed through to {@link Operation.createCustomContract}. Default: random. */
+        salt?: Buffer | Uint8Array;
+        /** The format used to decode `wasmHash`, if it's provided as a string. */
+        format?: "hex" | "base64";
+      }
+  ): Promise<AssembledTransaction<T>> {
+    return ContractClient.deploy({owner}, options)
+  }
+  constructor(public readonly options: ContractClientOptions) {
+    super(
+      new ContractSpec([ "AAAAAQAAAC1QYXJhbWV0ZXJzIGZvciBzZW5kaW5nIGEgY3Jvc3MtY2hhaW4gbWVzc2FnZS4AAAAAAAAAAAAAD01lc3NhZ2luZ1BhcmFtcwAAAAAFAAAAK0Rlc3RpbmF0aW9uIGVuZHBvaW50IElEIChjaGFpbiBpZGVudGlmaWVyKS4AAAAAB2RzdF9laWQAAAAABAAAABxUaGUgbWVzc2FnZSBwYXlsb2FkIHRvIHNlbmQuAAAAB21lc3NhZ2UAAAAADgAAACFFbmNvZGVkIGV4ZWN1dG9yIGFuZCBEVk4gb3B0aW9ucy4AAAAAAAAHb3B0aW9ucwAAAAAOAAAAOVdoZXRoZXIgdG8gcGF5IGZlZXMgaW4gWlJPIHRva2VuIGluc3RlYWQgb2YgbmF0aXZlIHRva2VuLgAAAAAAAApwYXlfaW5fenJvAAAAAAABAAAANVJlY2VpdmVyIGFkZHJlc3Mgb24gdGhlIGRlc3RpbmF0aW9uIGNoYWluICgzMiBieXRlcykuAAAAAAAACHJlY2VpdmVyAAAD7gAAACA=",
+        "AAAAAQAAAE1Tb3VyY2UgbWVzc2FnZSBpbmZvcm1hdGlvbiBpZGVudGlmeWluZyB3aGVyZSBhIGNyb3NzLWNoYWluIG1lc3NhZ2UgY2FtZSBmcm9tLgAAAAAAAAAAAAAGT3JpZ2luAAAAAAADAAAAF05vbmNlIGZvciB0aGlzIHBhdGh3YXkuAAAAAAVub25jZQAAAAAAAAYAAAAuU2VuZGVyIGFkZHJlc3Mgb24gdGhlIHNvdXJjZSBjaGFpbiAoMzIgYnl0ZXMpLgAAAAAABnNlbmRlcgAAAAAD7gAAACAAAAAmU291cmNlIGVuZHBvaW50IElEIChjaGFpbiBpZGVudGlmaWVyKS4AAAAAAAdzcmNfZWlkAAAAAAQ=",
+        "AAAAAQAAAChGZWUgc3RydWN0dXJlIGZvciBjcm9zcy1jaGFpbiBtZXNzYWdpbmcuAAAAAAAAAAxNZXNzYWdpbmdGZWUAAAACAAAAH0ZlZSBwYWlkIGluIG5hdGl2ZSB0b2tlbiAoWExNKS4AAAAACm5hdGl2ZV9mZWUAAAAAAAsAAAAoRmVlIHBhaWQgaW4gWlJPIHRva2VuIChMYXllclplcm8gdG9rZW4pLgAAAAd6cm9fZmVlAAAAAAs=",
+        "AAAAAQAAAEJSZWNlaXB0IHJldHVybmVkIGFmdGVyIHN1Y2Nlc3NmdWxseSBzZW5kaW5nIGEgY3Jvc3MtY2hhaW4gbWVzc2FnZS4AAAAAAAAAAAAQTWVzc2FnaW5nUmVjZWlwdAAAAAMAAAApVGhlIGZlZXMgY2hhcmdlZCBmb3Igc2VuZGluZyB0aGUgbWVzc2FnZS4AAAAAAAADZmVlAAAAB9AAAAAMTWVzc2FnaW5nRmVlAAAAK0dsb2JhbGx5IHVuaXF1ZSBpZGVudGlmaWVyIGZvciB0aGUgbWVzc2FnZS4AAAAABGd1aWQAAAPuAAAAIAAAACRUaGUgb3V0Ym91bmQgbm9uY2UgZm9yIHRoaXMgcGF0aHdheS4AAAAFbm9uY2UAAAAAAAAG",
+        "AAAAAgAAADhUeXBlIG9mIG1lc3NhZ2UgbGlicmFyeSBpbmRpY2F0aW5nIHN1cHBvcnRlZCBvcGVyYXRpb25zLgAAAAAAAAAOTWVzc2FnZUxpYlR5cGUAAAAAAAMAAAAAAAAAH1N1cHBvcnRzIG9ubHkgc2VuZGluZyBtZXNzYWdlcy4AAAAABFNlbmQAAAAAAAAAIVN1cHBvcnRzIG9ubHkgcmVjZWl2aW5nIG1lc3NhZ2VzLgAAAAAAAAdSZWNlaXZlAAAAAAAAAAAtU3VwcG9ydHMgYm90aCBzZW5kaW5nIGFuZCByZWNlaXZpbmcgbWVzc2FnZXMuAAAAAAAADlNlbmRBbmRSZWNlaXZlAAA=",
+        "AAAAAQAAALdWZXJzaW9uIGluZm9ybWF0aW9uIGZvciBhIG1lc3NhZ2UgbGlicmFyeS4KCk5vdGU6IGBtaW5vcmAgYW5kIGBlbmRwb2ludF92ZXJzaW9uYCB1c2UgYHUzMmAgaW5zdGVhZCBvZiBgdThgIGJlY2F1c2UgU3RlbGxhciBkb2VzIG5vdApzdXBwb3J0IGB1OGAgdHlwZXMgaW4gY29udHJhY3QgaW50ZXJmYWNlIGZ1bmN0aW9ucy4AAAAAAAAAABFNZXNzYWdlTGliVmVyc2lvbgAAAAAAAAMAAAAzRW5kcG9pbnQgdmVyc2lvbiAoc2hvdWxkIG5vdCBleGNlZWQgdTg6Ok1BWCA9IDI1NSkuAAAAABBlbmRwb2ludF92ZXJzaW9uAAAABAAAABVNYWpvciB2ZXJzaW9uIG51bWJlci4AAAAAAAAFbWFqb3IAAAAAAAAGAAAAN01pbm9yIHZlcnNpb24gbnVtYmVyIChzaG91bGQgbm90IGV4Y2VlZCB1ODo6TUFYID0gMjU1KS4AAAAABW1pbm9yAAAAAAAABA==",
+        "AAAAAQAAADZUaW1lb3V0IGNvbmZpZ3VyYXRpb24gZm9yIHJlY2VpdmUgbGlicmFyeSB0cmFuc2l0aW9ucy4AAAAAAAAAAAAHVGltZW91dAAAAAACAAAAKFVuaXggdGltZXN0YW1wIHdoZW4gdGhlIHRpbWVvdXQgZXhwaXJlcy4AAAAGZXhwaXJ5AAAAAAAGAAAAKVRoZSBuZXcgbGlicmFyeSBhZGRyZXNzIHRvIHRyYW5zaXRpb24gdG8uAAAAAAAAA2xpYgAAAAAT",
+        "AAAAAQAAADVQYXJhbWV0ZXJzIGZvciBzZXR0aW5nIG1lc3NhZ2UgbGlicmFyeSBjb25maWd1cmF0aW9uLgAAAAAAAAAAAAAOU2V0Q29uZmlnUGFyYW0AAAAAAAMAAAAfWERSLWVuY29kZWQgY29uZmlndXJhdGlvbiBkYXRhLgAAAAAGY29uZmlnAAAAAAAOAAAAMFRoZSB0eXBlIG9mIGNvbmZpZ3VyYXRpb24gKGUuZy4sIGV4ZWN1dG9yLCBVTE4pLgAAAAtjb25maWdfdHlwZQAAAAAEAAAAJ1RoZSBlbmRwb2ludCBJRCB0aGlzIGNvbmZpZyBhcHBsaWVzIHRvLgAAAAADZWlkAAAAAAQ=",
+        "AAAAAQAAADFSZXNvbHZlZCBsaWJyYXJ5IGluZm9ybWF0aW9uIHdpdGggZGVmYXVsdCBzdGF0dXMuAAAAAAAAAAAAAA9SZXNvbHZlZExpYnJhcnkAAAAAAgAAAERXaGV0aGVyIHRoaXMgaXMgdGhlIGRlZmF1bHQgbGlicmFyeSAodHJ1ZSkgb3IgT0FwcC1zcGVjaWZpYyAoZmFsc2UpLgAAAAppc19kZWZhdWx0AAAAAAABAAAAHVRoZSByZXNvbHZlZCBsaWJyYXJ5IGFkZHJlc3MuAAAAAAAAA2xpYgAAAAAT",
+        "AAAAAQAAAEhPdXRib3VuZCBwYWNrZXQgY29udGFpbmluZyBhbGwgaW5mb3JtYXRpb24gZm9yIGNyb3NzLWNoYWluIHRyYW5zbWlzc2lvbi4AAAAAAAAADk91dGJvdW5kUGFja2V0AAAAAAAHAAAAGERlc3RpbmF0aW9uIGVuZHBvaW50IElELgAAAAdkc3RfZWlkAAAAAAQAAAAsR2xvYmFsbHkgdW5pcXVlIGlkZW50aWZpZXIgZm9yIHRoaXMgbWVzc2FnZS4AAAAEZ3VpZAAAA+4AAAAgAAAAFFRoZSBtZXNzYWdlIHBheWxvYWQuAAAAB21lc3NhZ2UAAAAADgAAACBPdXRib3VuZCBub25jZSBmb3IgdGhpcyBwYXRod2F5LgAAAAVub25jZQAAAAAAAAYAAAAxUmVjZWl2ZXIgYWRkcmVzcyBvbiBkZXN0aW5hdGlvbiBjaGFpbiAoMzIgYnl0ZXMpLgAAAAAAAAhyZWNlaXZlcgAAA+4AAAAgAAAAH1NlbmRlciBhZGRyZXNzIG9uIHNvdXJjZSBjaGFpbi4AAAAABnNlbmRlcgAAAAAAEwAAABNTb3VyY2UgZW5kcG9pbnQgSUQuAAAAAAdzcmNfZWlkAAAAAAQ=",
+        "AAAAAQAAACtBIGZlZSByZWNpcGllbnQgd2l0aCB0aGUgYW1vdW50IHRvIGJlIHBhaWQuAAAAAAAAAAAMRmVlUmVjaXBpZW50AAAAAgAAABtBZGRyZXNzIHRvIHJlY2VpdmUgdGhlIGZlZS4AAAAAB2FkZHJlc3MAAAAAEwAAABVBbW91bnQgb2YgZmVlIHRvIHBheS4AAAAAAAAGYW1vdW50AAAAAAAL",
+        "AAAAAQAAADxSZXN1bHQgb2Ygc2VuZCBvcGVyYXRpb24gY29udGFpbmluZyBmZWVzIGFuZCBlbmNvZGVkIHBhY2tldC4AAAAAAAAADUZlZXNBbmRQYWNrZXQAAAAAAAADAAAAKlRoZSBlbmNvZGVkIHBhY2tldCByZWFkeSBmb3IgdHJhbnNtaXNzaW9uLgAAAAAADmVuY29kZWRfcGFja2V0AAAAAAAOAAAAP0xpc3Qgb2YgbmF0aXZlIHRva2VuIGZlZSByZWNpcGllbnRzIChleGVjdXRvciwgRFZOcywgdHJlYXN1cnkpLgAAAAAVbmF0aXZlX2ZlZV9yZWNpcGllbnRzAAAAAAAD6gAAB9AAAAAMRmVlUmVjaXBpZW50AAAALExpc3Qgb2YgWlJPIHRva2VuIGZlZSByZWNpcGllbnRzICh0cmVhc3VyeSkuAAAAEnpyb19mZWVfcmVjaXBpZW50cwAAAAAD6gAAB9AAAAAMRmVlUmVjaXBpZW50",
+        "AAAAAgAAAAAAAAAAAAAAD0VuZHBvaW50U3RvcmFnZQAAAAAPAAAAAAAAAAAAAAADWlJPAAAAAAEAAAAAAAAACERlbGVnYXRlAAAAAQAAABMAAAABAAAAAAAAABBMYXp5SW5ib3VuZE5vbmNlAAAAAwAAABMAAAAEAAAD7gAAACAAAAABAAAAAAAAABJJbmJvdW5kUGF5bG9hZEhhc2gAAAAAAAQAAAATAAAABAAAA+4AAAAgAAAABgAAAAEAAAAAAAAADU91dGJvdW5kTm9uY2UAAAAAAAADAAAAEwAAAAQAAAPuAAAAIAAAAAAAAAAAAAAAFlJlZ2lzdGVyZWRMaWJyYXJ5Q291bnQAAAAAAAEAAAAAAAAADkxpYnJhcnlUb0luZGV4AAAAAAABAAAAEwAAAAEAAAAAAAAADkluZGV4VG9MaWJyYXJ5AAAAAAABAAAABAAAAAEAAAAAAAAAEkRlZmF1bHRTZW5kTGlicmFyeQAAAAAAAQAAAAQAAAABAAAAAAAAABVEZWZhdWx0UmVjZWl2ZUxpYnJhcnkAAAAAAAABAAAABAAAAAEAAAAAAAAAHERlZmF1bHRSZWNlaXZlTGlicmFyeVRpbWVvdXQAAAABAAAABAAAAAEAAAAAAAAAC1NlbmRMaWJyYXJ5AAAAAAIAAAATAAAABAAAAAEAAAAAAAAADlJlY2VpdmVMaWJyYXJ5AAAAAAACAAAAEwAAAAQAAAABAAAAAAAAABVSZWNlaXZlTGlicmFyeVRpbWVvdXQAAAAAAAACAAAAEwAAAAQAAAABAAAAAAAAAAxDb21wb3NlUXVldWUAAAAEAAAAEwAAABMAAAPuAAAAIAAAAAQ=",
+        "AAAABQAAAAAAAAAAAAAADkx6Q29tcG9zZUFsZXJ0AAAAAAABAAAADkx6Q29tcG9zZUFsZXJ0AAAAAAAKAAAAAAAAAARmcm9tAAAAEwAAAAEAAAAAAAAAAnRvAAAAAAATAAAAAQAAAAAAAAAIZXhlY3V0b3IAAAATAAAAAQAAAAAAAAAEZ3VpZAAAA+4AAAAgAAAAAQAAAAAAAAAFaW5kZXgAAAAAAAAEAAAAAQAAAAAAAAADZ2FzAAAAAAsAAAAAAAAAAAAAAAV2YWx1ZQAAAAAAAAsAAAAAAAAAAAAAAAdtZXNzYWdlAAAAAA4AAAAAAAAAAAAAAApleHRyYV9kYXRhAAAAAAAOAAAAAAAAAAAAAAAGcmVhc29uAAAAAAAOAAAAAAAAAAI=",
+        "AAAABQAAAAAAAAAAAAAAEENvbXBvc2VEZWxpdmVyZWQAAAABAAAAEENvbXBvc2VEZWxpdmVyZWQAAAAEAAAAAAAAAARmcm9tAAAAEwAAAAEAAAAAAAAAAnRvAAAAAAATAAAAAQAAAAAAAAAEZ3VpZAAAA+4AAAAgAAAAAQAAAAAAAAAFaW5kZXgAAAAAAAAEAAAAAQAAAAI=",
+        "AAAABQAAAAAAAAAAAAAAC0NvbXBvc2VTZW50AAAAAAEAAAALQ29tcG9zZVNlbnQAAAAABQAAAAAAAAAEZnJvbQAAABMAAAABAAAAAAAAAAJ0bwAAAAAAEwAAAAEAAAAAAAAABGd1aWQAAAPuAAAAIAAAAAEAAAAAAAAABWluZGV4AAAAAAAABAAAAAEAAAAAAAAAB21lc3NhZ2UAAAAADgAAAAAAAAAC",
+        "AAAABQAAAAAAAAAAAAAAGFJlY2VpdmVMaWJyYXJ5VGltZW91dFNldAAAAAEAAAAYUmVjZWl2ZUxpYnJhcnlUaW1lb3V0U2V0AAAAAwAAAAAAAAAIcmVjZWl2ZXIAAAATAAAAAQAAAAAAAAADZWlkAAAAAAQAAAABAAAAAAAAAAd0aW1lb3V0AAAAA+gAAAfQAAAAB1RpbWVvdXQAAAAAAAAAAAI=",
+        "AAAABQAAAAAAAAAAAAAAEVJlY2VpdmVMaWJyYXJ5U2V0AAAAAAAAAQAAABFSZWNlaXZlTGlicmFyeVNldAAAAAAAAAMAAAAAAAAACHJlY2VpdmVyAAAAEwAAAAEAAAAAAAAAB3NyY19laWQAAAAABAAAAAEAAAAAAAAAB25ld19saWIAAAAD6AAAABMAAAAAAAAAAg==",
+        "AAAABQAAAAAAAAAAAAAADlNlbmRMaWJyYXJ5U2V0AAAAAAABAAAADlNlbmRMaWJyYXJ5U2V0AAAAAAADAAAAAAAAAAZzZW5kZXIAAAAAABMAAAABAAAAAAAAAAdkc3RfZWlkAAAAAAQAAAABAAAAAAAAAAduZXdfbGliAAAAA+gAAAATAAAAAAAAAAI=",
+        "AAAABQAAAAAAAAAAAAAAH0RlZmF1bHRSZWNlaXZlTGlicmFyeVRpbWVvdXRTZXQAAAAAAQAAAB9EZWZhdWx0UmVjZWl2ZUxpYnJhcnlUaW1lb3V0U2V0AAAAAAIAAAAAAAAAB3NyY19laWQAAAAABAAAAAEAAAAAAAAAB3RpbWVvdXQAAAAD6AAAB9AAAAAHVGltZW91dAAAAAAAAAAAAg==",
+        "AAAABQAAAAAAAAAAAAAAGERlZmF1bHRSZWNlaXZlTGlicmFyeVNldAAAAAEAAAAYRGVmYXVsdFJlY2VpdmVMaWJyYXJ5U2V0AAAAAgAAAAAAAAAHc3JjX2VpZAAAAAAEAAAAAQAAAAAAAAAHbmV3X2xpYgAAAAATAAAAAAAAAAI=",
+        "AAAABQAAAAAAAAAAAAAAFURlZmF1bHRTZW5kTGlicmFyeVNldAAAAAAAAAEAAAAVRGVmYXVsdFNlbmRMaWJyYXJ5U2V0AAAAAAAAAgAAAAAAAAAHZHN0X2VpZAAAAAAEAAAAAQAAAAAAAAAHbmV3X2xpYgAAAAATAAAAAAAAAAI=",
+        "AAAABQAAAAAAAAAAAAAAEUxpYnJhcnlSZWdpc3RlcmVkAAAAAAAAAQAAABFMaWJyYXJ5UmVnaXN0ZXJlZAAAAAAAAAEAAAAAAAAAB25ld19saWIAAAAAEwAAAAAAAAAC",
+        "AAAABQAAAAAAAAAAAAAAC1BhY2tldEJ1cm50AAAAAAEAAAALUGFja2V0QnVybnQAAAAABQAAAAAAAAAHc3JjX2VpZAAAAAAEAAAAAQAAAAAAAAAGc2VuZGVyAAAAAAPuAAAAIAAAAAEAAAAAAAAACHJlY2VpdmVyAAAAEwAAAAEAAAAAAAAABW5vbmNlAAAAAAAABgAAAAEAAAAAAAAADHBheWxvYWRfaGFzaAAAA+4AAAAgAAAAAAAAAAI=",
+        "AAAABQAAAAAAAAAAAAAADlBhY2tldE5pbGlmaWVkAAAAAAABAAAADlBhY2tldE5pbGlmaWVkAAAAAAAFAAAAAAAAAAdzcmNfZWlkAAAAAAQAAAABAAAAAAAAAAZzZW5kZXIAAAAAA+4AAAAgAAAAAQAAAAAAAAAIcmVjZWl2ZXIAAAATAAAAAQAAAAAAAAAFbm9uY2UAAAAAAAAGAAAAAQAAAAAAAAAMcGF5bG9hZF9oYXNoAAAD6AAAA+4AAAAgAAAAAAAAAAI=",
+        "AAAABQAAAAAAAAAAAAAAE0luYm91bmROb25jZVNraXBwZWQAAAAAAQAAABNJbmJvdW5kTm9uY2VTa2lwcGVkAAAAAAQAAAAAAAAAB3NyY19laWQAAAAABAAAAAEAAAAAAAAABnNlbmRlcgAAAAAD7gAAACAAAAABAAAAAAAAAAhyZWNlaXZlcgAAABMAAAABAAAAAAAAAAVub25jZQAAAAAAAAYAAAABAAAAAg==",
+        "AAAABQAAAAAAAAAAAAAAC0RlbGVnYXRlU2V0AAAAAAEAAAALRGVsZWdhdGVTZXQAAAAAAgAAAAAAAAAEb2FwcAAAABMAAAABAAAAAAAAAAhkZWxlZ2F0ZQAAA+gAAAATAAAAAAAAAAI=",
+        "AAAABQAAAAAAAAAAAAAABlpST1NldAAAAAAAAQAAAAZaUk9TZXQAAAAAAAEAAAAAAAAAA3pybwAAAAATAAAAAAAAAAI=",
+        "AAAABQAAAAAAAAAAAAAADkx6UmVjZWl2ZUFsZXJ0AAAAAAABAAAADkx6UmVjZWl2ZUFsZXJ0AAAAAAAJAAAAAAAAAAhyZWNlaXZlcgAAABMAAAABAAAAAAAAAAhleGVjdXRvcgAAABMAAAABAAAAAAAAAAZvcmlnaW4AAAAAB9AAAAAGT3JpZ2luAAAAAAABAAAAAAAAAARndWlkAAAD7gAAACAAAAABAAAAAAAAAANnYXMAAAAACwAAAAAAAAAAAAAABXZhbHVlAAAAAAAACwAAAAAAAAAAAAAAB21lc3NhZ2UAAAAADgAAAAAAAAAAAAAACmV4dHJhX2RhdGEAAAAAAA4AAAAAAAAAAAAAAAZyZWFzb24AAAAAAA4AAAAAAAAAAg==",
+        "AAAABQAAAAAAAAAAAAAAD1BhY2tldERlbGl2ZXJlZAAAAAABAAAAD1BhY2tldERlbGl2ZXJlZAAAAAACAAAAAAAAAAZvcmlnaW4AAAAAB9AAAAAGT3JpZ2luAAAAAAABAAAAAAAAAAhyZWNlaXZlcgAAABMAAAABAAAAAg==",
+        "AAAABQAAAAAAAAAAAAAADlBhY2tldFZlcmlmaWVkAAAAAAABAAAADlBhY2tldFZlcmlmaWVkAAAAAAADAAAAAAAAAAZvcmlnaW4AAAAAB9AAAAAGT3JpZ2luAAAAAAABAAAAAAAAAAhyZWNlaXZlcgAAABMAAAABAAAAAAAAAAxwYXlsb2FkX2hhc2gAAAPuAAAAIAAAAAAAAAAC",
+        "AAAABQAAAAAAAAAAAAAAClBhY2tldFNlbnQAAAAAAAEAAAAKUGFja2V0U2VudAAAAAAAAwAAAAAAAAAOZW5jb2RlZF9wYWNrZXQAAAAAAA4AAAAAAAAAAAAAAAdvcHRpb25zAAAAAA4AAAAAAAAAAAAAAAxzZW5kX2xpYnJhcnkAAAATAAAAAAAAAAI=",
+        "AAAABAAAAAAAAAAAAAAADUVuZHBvaW50RXJyb3IAAAAAAAAYAAAAAAAAABFBbHJlYWR5UmVnaXN0ZXJlZAAAAAAAAAEAAAAAAAAADUNvbXBvc2VFeGlzdHMAAAAAAAACAAAAAAAAAA9Db21wb3NlTm90Rm91bmQAAAAAAwAAAAAAAAAcRGVmYXVsdFJlY2VpdmVMaWJVbmF2YWlsYWJsZQAAAAQAAAAAAAAAGURlZmF1bHRTZW5kTGliVW5hdmFpbGFibGUAAAAAAAAFAAAAAAAAABVJbnN1ZmZpY2llbnROYXRpdmVGZWUAAAAAAAAGAAAAAAAAABJJbnN1ZmZpY2llbnRaUk9GZWUAAAAAAAcAAAAAAAAADUludmFsaWRFeHBpcnkAAAAAAAAIAAAAAAAAAAxJbnZhbGlkSW5kZXgAAAAJAAAAAAAAAAxJbnZhbGlkTm9uY2UAAAAKAAAAAAAAABJJbnZhbGlkUGF5bG9hZEhhc2gAAAAAAAsAAAAAAAAAFUludmFsaWRSZWNlaXZlTGlicmFyeQAAAAAAAAwAAAAAAAAAEU9ubHlOb25EZWZhdWx0TGliAAAAAAAADQAAAAAAAAAOT25seVJlY2VpdmVMaWIAAAAAAA4AAAAAAAAAEU9ubHlSZWdpc3RlcmVkTGliAAAAAAAADwAAAAAAAAALT25seVNlbmRMaWIAAAAAEAAAAAAAAAAUUGF0aE5vdEluaXRpYWxpemFibGUAAAARAAAAAAAAABFQYXRoTm90VmVyaWZpYWJsZQAAAAAAABIAAAAAAAAAE1BheWxvYWRIYXNoTm90Rm91bmQAAAAAEwAAAAAAAAAJU2FtZVZhbHVlAAAAAAAAFAAAAAAAAAAMVW5hdXRob3JpemVkAAAAFQAAAAAAAAAOVW5zdXBwb3J0ZWRFaWQAAAAAABYAAAAAAAAAClplcm9aUk9GZWUAAAAAABcAAAAAAAAADlpST1VuYXZhaWxhYmxlAAAAAAAY",
+        "AAAAAAAAAOdTZW5kcyBhIGNvbXBvc2VkIG1lc3NhZ2UgZnJvbSBhbiBPQXBwIHRvIGEgY29tcG9zZXIuCgpUaGUgY29tcG9zZXIgTVVTVCBhc3NlcnQgdGhlIHNlbmRlciBiZWNhdXNlIGFueW9uZSBjYW4gc2VuZCBjb21wb3NlIG1zZyB3aXRoIHRoaXMgZnVuY3Rpb24uCldpdGggdGhlIHNhbWUgR1VJRCwgdGhlIE9BcHAgY2FuIHNlbmQgY29tcG9zZSB0byBtdWx0aXBsZSBjb21wb3NlcnMgYXQgdGhlIHNhbWUgdGltZS4AAAAADHNlbmRfY29tcG9zZQAAAAUAAAAAAAAABGZyb20AAAATAAAAAAAAAAJ0bwAAAAAAEwAAAAAAAAAEZ3VpZAAAA+4AAAAgAAAAAAAAAAVpbmRleAAAAAAAAAQAAAAAAAAAB21lc3NhZ2UAAAAADgAAAAA=",
+        "AAAAAAAAAGVDbGVhcnMgYSBjb21wb3NlZCBtZXNzYWdlIGJ5IHRoZSBjb21wb3Nlci4KClRoaXMgaXMgYSBQVUxMIG1vZGUgdmVyc3VzIHRoZSBQVVNIIG1vZGUgb2YgYGx6X2NvbXBvc2VgLgAAAAAAAA1jbGVhcl9jb21wb3NlAAAAAAAABQAAAAAAAAAIY29tcG9zZXIAAAATAAAAAAAAAARmcm9tAAAAEwAAAAAAAAAEZ3VpZAAAA+4AAAAgAAAAAAAAAAVpbmRleAAAAAAAAAQAAAAAAAAAB21lc3NhZ2UAAAAADgAAAAA=",
+        "AAAAAAAAAIlFbWl0cyBhbiBhbGVydCBldmVudCB3aGVuIGBsel9jb21wb3NlYCBleGVjdXRpb24gZmFpbHMuCgpDYWxsZWQgYnkgdGhlIGV4ZWN1dG9yIHRvIG5vdGlmeSBhYm91dCBmYWlsZWQgY29tcG9zZSBtZXNzYWdlIGRlbGl2ZXJ5IGF0dGVtcHRzLgAAAAAAABBsel9jb21wb3NlX2FsZXJ0AAAACgAAAAAAAAAIZXhlY3V0b3IAAAATAAAAAAAAAARmcm9tAAAAEwAAAAAAAAACdG8AAAAAABMAAAAAAAAABGd1aWQAAAPuAAAAIAAAAAAAAAAFaW5kZXgAAAAAAAAEAAAAAAAAAANnYXMAAAAACwAAAAAAAAAFdmFsdWUAAAAAAAALAAAAAAAAAAdtZXNzYWdlAAAAAA4AAAAAAAAACmV4dHJhX2RhdGEAAAAAAA4AAAAAAAAABnJlYXNvbgAAAAAADgAAAAA=",
+        "AAAAAAAAAEhSZXR1cm5zIHRoZSBzdG9yZWQgaGFzaCBmb3IgYSBjb21wb3NlZCBtZXNzYWdlLCBvciBgTm9uZWAgaWYgbm90IHF1ZXVlZC4AAAANY29tcG9zZV9xdWV1ZQAAAAAAAAQAAAAAAAAABGZyb20AAAATAAAAAAAAAAJ0bwAAAAAAEwAAAAAAAAAEZ3VpZAAAA+4AAAAgAAAAAAAAAAVpbmRleAAAAAAAAAQAAAABAAAD6AAAA+4AAAAg",
+        "AAAAAAAAAGxTa2lwcyB0aGUgbmV4dCBleHBlY3RlZCBpbmJvdW5kIG5vbmNlIHdpdGhvdXQgdmVyaWZ5aW5nLgoKVGhlIG5vbmNlIHRvIHNraXAgbXVzdCBiZSB0aGUgbmV4dCBleHBlY3RlZCBub25jZS4AAAAEc2tpcAAAAAUAAAAAAAAABmNhbGxlcgAAAAAAEwAAAAAAAAAIcmVjZWl2ZXIAAAATAAAAAAAAAAdzcmNfZWlkAAAAAAQAAAAAAAAABnNlbmRlcgAAAAAD7gAAACAAAAAAAAAABW5vbmNlAAAAAAAABgAAAAA=",
+        "AAAAAAAAAHpNYXJrcyBhIHBhY2tldCBhcyB2ZXJpZmllZCwgYnV0IGRpc2FsbG93cyBleGVjdXRpb24gdW50aWwgaXQgaXMgcmUtdmVyaWZpZWQuCgpSZXF1aXJlcyB0aGUgcGF5bG9hZCBoYXNoIG5vdCBiZWVuIGV4ZWN1dGVkLgAAAAAABm5pbGlmeQAAAAAABgAAAAAAAAAGY2FsbGVyAAAAAAATAAAAAAAAAAhyZWNlaXZlcgAAABMAAAAAAAAAB3NyY19laWQAAAAABAAAAAAAAAAGc2VuZGVyAAAAAAPuAAAAIAAAAAAAAAAFbm9uY2UAAAAAAAAGAAAAAAAAAAxwYXlsb2FkX2hhc2gAAAPoAAAD7gAAACAAAAAA",
+        "AAAAAAAAAGBNYXJrcyBhIG5vbmNlIGFzIHVuZXhlY3V0YWJsZSBhbmQgdW4tdmVyaWZpYWJsZS4gVGhlIG5vbmNlIGNhbiBuZXZlciBiZSByZS12ZXJpZmllZCBvciBleGVjdXRlZC4AAAAEYnVybgAAAAYAAAAAAAAABmNhbGxlcgAAAAAAEwAAAAAAAAAIcmVjZWl2ZXIAAAATAAAAAAAAAAdzcmNfZWlkAAAAAAQAAAAAAAAABnNlbmRlcgAAAAAD7gAAACAAAAAAAAAABW5vbmNlAAAAAAAABgAAAAAAAAAMcGF5bG9hZF9oYXNoAAAD7gAAACAAAAAA",
+        "AAAAAAAAAC9HZW5lcmF0ZXMgdGhlIG5leHQgR1VJRCBmb3IgYW4gb3V0Ym91bmQgcGFja2V0LgAAAAAJbmV4dF9ndWlkAAAAAAAAAwAAAAAAAAAGc2VuZGVyAAAAAAATAAAAAAAAAAdkc3RfZWlkAAAAAAQAAAAAAAAACHJlY2VpdmVyAAAD7gAAACAAAAABAAAD7gAAACA=",
+        "AAAAAAAAAD5SZXR1cm5zIHRoZSBjdXJyZW50IG91dGJvdW5kIG5vbmNlIGZvciBhIHNwZWNpZmljIGRlc3RpbmF0aW9uLgAAAAAADm91dGJvdW5kX25vbmNlAAAAAAADAAAAAAAAAAZzZW5kZXIAAAAAABMAAAAAAAAAB2RzdF9laWQAAAAABAAAAAAAAAAIcmVjZWl2ZXIAAAPuAAAAIAAAAAEAAAAG",
+        "AAAAAAAAAZpSZXR1cm5zIHRoZSBtYXggaW5kZXggb2YgdGhlIGxvbmdlc3QgZ2FwbGVzcyBzZXF1ZW5jZSBvZiB2ZXJpZmllZCBtZXNzYWdlIG5vbmNlcy4KClRoZSB1bmluaXRpYWxpemVkIHZhbHVlIGlzIDAuIFRoZSBmaXJzdCBub25jZSBpcyBhbHdheXMgMS4KSXQgc3RhcnRzIGZyb20gdGhlIGBsYXp5X2luYm91bmRfbm9uY2VgIChsYXN0IGNoZWNrcG9pbnQpIGFuZCBpdGVyYXRpdmVseSBjaGVja3MKaWYgdGhlIG5leHQgbm9uY2UgaGFzIGJlZW4gdmVyaWZpZWQuCgpOb3RlOiBPQXBwIGV4cGxpY2l0bHkgc2tpcHBlZCBub25jZXMgY291bnQgYXMgInZlcmlmaWVkIiBmb3IgdGhlc2UgcHVycG9zZXMuCgpFeGFtcGxlczogYFsxLDIsMyw0LDYsN10gPT4gNGAsIGBbMSwyLDYsOCwxMF0gPT4gMmAsIGBbMSwzLDQsNSw2XSA9PiAxYAAAAAAADWluYm91bmRfbm9uY2UAAAAAAAADAAAAAAAAAAhyZWNlaXZlcgAAABMAAAAAAAAAB3NyY19laWQAAAAABAAAAAAAAAAGc2VuZGVyAAAAAAPuAAAAIAAAAAEAAAAG",
+        "AAAAAAAAAEVSZXR1cm5zIHRoZSBsYXp5IGluYm91bmQgbm9uY2UgKGxhc3QgY2hlY2twb2ludCkgZm9yIGEgc3BlY2lmaWMgcGF0aC4AAAAAAAASbGF6eV9pbmJvdW5kX25vbmNlAAAAAAADAAAAAAAAAAhyZWNlaXZlcgAAABMAAAAAAAAAB3NyY19laWQAAAAABAAAAAAAAAAGc2VuZGVyAAAAAAPuAAAAIAAAAAEAAAAG",
+        "AAAAAAAAADZSZXR1cm5zIHRoZSBwYXlsb2FkIGhhc2ggZm9yIGEgc3BlY2lmaWMgaW5ib3VuZCBub25jZS4AAAAAABRpbmJvdW5kX3BheWxvYWRfaGFzaAAAAAQAAAAAAAAACHJlY2VpdmVyAAAAEwAAAAAAAAAHc3JjX2VpZAAAAAAEAAAAAAAAAAZzZW5kZXIAAAAAA+4AAAAgAAAAAAAAAAVub25jZQAAAAAAAAYAAAABAAAD6AAAA+4AAAAg",
+        "AAAAAAAAADJSZWdpc3RlcnMgYSBuZXcgbWVzc2FnZSBsaWJyYXJ5IHdpdGggdGhlIGVuZHBvaW50LgAAAAAAEHJlZ2lzdGVyX2xpYnJhcnkAAAABAAAAAAAAAAduZXdfbGliAAAAABMAAAAA",
+        "AAAAAAAAADlTZXRzIHRoZSBkZWZhdWx0IHNlbmQgbGlicmFyeSBmb3IgYSBkZXN0aW5hdGlvbiBlbmRwb2ludC4AAAAAAAAYc2V0X2RlZmF1bHRfc2VuZF9saWJyYXJ5AAAAAgAAAAAAAAAHZHN0X2VpZAAAAAAEAAAAAAAAAAduZXdfbGliAAAAABMAAAAA",
+        "AAAAAAAAALZTZXRzIHRoZSBkZWZhdWx0IHJlY2VpdmUgbGlicmFyeSBmb3IgYSBzb3VyY2UgZW5kcG9pbnQuCgpJZiBhIGdyYWNlIHBlcmlvZCBpcyBwcm92aWRlZCBhbmQgdGhlcmUgd2FzIGEgcHJldmlvdXMgbGlicmFyeSwgdGhlIG9sZCBsaWJyYXJ5CnJlbWFpbnMgdmFsaWQgdW50aWwgdGhlIGdyYWNlIHBlcmlvZCBleHBpcmVzLgAAAAAAG3NldF9kZWZhdWx0X3JlY2VpdmVfbGlicmFyeQAAAAADAAAAAAAAAAdzcmNfZWlkAAAAAAQAAAAAAAAAB25ld19saWIAAAAAEwAAAAAAAAAMZ3JhY2VfcGVyaW9kAAAABgAAAAA=",
+        "AAAAAAAAANJTZXRzIG9yIHJlbW92ZXMgdGhlIGRlZmF1bHQgcmVjZWl2ZSBsaWJyYXJ5IHRpbWVvdXQgZm9yIGEgc291cmNlIGVuZHBvaW50LgoKSWYgYSB0aW1lb3V0IGlzIHByb3ZpZGVkLCBpdCBtdXN0IGJlIHZhbGlkIGFuZCBub3QgZXhwaXJlZC4gSWYgbm8gdGltZW91dCBpcyBwcm92aWRlZCwKdGhlIGRlZmF1bHQgcmVjZWl2ZSBsaWJyYXJ5IHRpbWVvdXQgaXMgcmVtb3ZlZC4AAAAAAB9zZXRfZGVmYXVsdF9yZWNlaXZlX2xpYl90aW1lb3V0AAAAAAIAAAAAAAAAB3NyY19laWQAAAAABAAAAAAAAAAHdGltZW91dAAAAAPoAAAH0AAAAAdUaW1lb3V0AAAAAAA=",
+        "AAAAAAAAAFVTZXRzIG9yIHJlbW92ZXMgYSBjdXN0b20gc2VuZCBsaWJyYXJ5IGZvciBhbiBPQXBwIHRvIGEgc3BlY2lmaWMgZGVzdGluYXRpb24gZW5kcG9pbnQuAAAAAAAAEHNldF9zZW5kX2xpYnJhcnkAAAAEAAAAAAAAAAZjYWxsZXIAAAAAABMAAAAAAAAABnNlbmRlcgAAAAAAEwAAAAAAAAAHZHN0X2VpZAAAAAAEAAAAAAAAAAduZXdfbGliAAAAA+gAAAATAAAAAA==",
+        "AAAAAAAAANJTZXRzIG9yIHJlbW92ZXMgYSBjdXN0b20gcmVjZWl2ZSBsaWJyYXJ5IGZvciBhbiBPQXBwIHRvIGEgc3BlY2lmaWMgc291cmNlIGVuZHBvaW50LgoKSWYgYSBncmFjZSBwZXJpb2QgaXMgcHJvdmlkZWQgYW5kIHRoZXJlIHdhcyBhIHByZXZpb3VzIGxpYnJhcnksIHRoZSBvbGQgbGlicmFyeQpyZW1haW5zIHZhbGlkIHVudGlsIHRoZSBncmFjZSBwZXJpb2QgZXhwaXJlcy4AAAAAABNzZXRfcmVjZWl2ZV9saWJyYXJ5AAAAAAUAAAAAAAAABmNhbGxlcgAAAAAAEwAAAAAAAAAIcmVjZWl2ZXIAAAATAAAAAAAAAAdzcmNfZWlkAAAAAAQAAAAAAAAAB25ld19saWIAAAAD6AAAABMAAAAAAAAADGdyYWNlX3BlcmlvZAAAAAYAAAAA",
+        "AAAAAAAAALFTZXRzIG9yIHJlbW92ZXMgdGhlIGN1c3RvbSByZWNlaXZlIGxpYnJhcnkgdGltZW91dCBmb3IgYW4gT0FwcC4KCkFsbG93cyBhbiBPQXBwIHRvIGV4dGVuZCBvciByZW1vdmUgdGhlIHZhbGlkaXR5IHBlcmlvZCBvZiBhIHByZXZpb3VzbHkgc2V0IGxpYnJhcnkKYWZ0ZXIgc3dpdGNoaW5nIHRvIGEgbmV3IG9uZS4AAAAAAAAbc2V0X3JlY2VpdmVfbGlicmFyeV90aW1lb3V0AAAAAAQAAAAAAAAABmNhbGxlcgAAAAAAEwAAAAAAAAAIcmVjZWl2ZXIAAAATAAAAAAAAAAdzcmNfZWlkAAAAAAQAAAAAAAAAB3RpbWVvdXQAAAAD6AAAB9AAAAAHVGltZW91dAAAAAAA",
+        "AAAAAAAAAINTZXRzIHRoZSBjb25maWd1cmF0aW9uIGZvciBhIG1lc3NhZ2UgbGlicmFyeS4KClJlcXVpcmVzIHRoZSBjYWxsZXIgdG8gYmUgdGhlIE9BcHAgb3IgaXRzIGRlbGVnYXRlIGFuZCB0aGUgbGlicmFyeSB0byBiZSByZWdpc3RlcmVkLgAAAAAKc2V0X2NvbmZpZwAAAAAABAAAAAAAAAAGY2FsbGVyAAAAAAATAAAAAAAAAARvYXBwAAAAEwAAAAAAAAADbGliAAAAABMAAAAAAAAABnBhcmFtcwAAAAAD6gAAB9AAAAAOU2V0Q29uZmlnUGFyYW0AAAAAAAA=",
+        "AAAAAAAAACpDaGVja3MgaWYgYSBtZXNzYWdlIGxpYnJhcnkgaXMgcmVnaXN0ZXJlZC4AAAAAABVpc19yZWdpc3RlcmVkX2xpYnJhcnkAAAAAAAABAAAAAAAAAANsaWIAAAAAEwAAAAEAAAAB",
+        "AAAAAAAAACdSZXR1cm5zIHRoZSBpbmRleCBvZiBhIG1lc3NhZ2UgbGlicmFyeS4AAAAAEWdldF9saWJyYXJ5X2luZGV4AAAAAAAAAQAAAAAAAAADbGliAAAAABMAAAABAAAD6AAAAAQ=",
+        "AAAAAAAAADNSZXR1cm5zIHRoZSBudW1iZXIgb2YgcmVnaXN0ZXJlZCBtZXNzYWdlIGxpYnJhcmllcy4AAAAAGnJlZ2lzdGVyZWRfbGlicmFyaWVzX2NvdW50AAAAAAAAAAAAAQAAAAQ=",
+        "AAAAAAAAAEpSZXR1cm5zIGEgbGlzdCBvZiByZWdpc3RlcmVkIG1lc3NhZ2UgbGlicmFyaWVzIHdpdGhpbiB0aGUgc3BlY2lmaWVkIHJhbmdlLgAAAAAAGGdldF9yZWdpc3RlcmVkX2xpYnJhcmllcwAAAAIAAAAAAAAABXN0YXJ0AAAAAAAABAAAAAAAAAAJbWF4X2NvdW50AAAAAAAABAAAAAEAAAPqAAAAEw==",
+        "AAAAAAAAAH1DaGVja3MgaWYgYW4gZW5kcG9pbnQgSUQgaXMgc3VwcG9ydGVkLgpSZXR1cm5zIHRydWUgb25seSBpZiBib3RoIHRoZSBkZWZhdWx0IHNlbmQvcmVjZWl2ZSBsaWJyYXJpZXMgYXJlIHNldCBmb3IgdGhlIGdpdmVuIGVpZAAAAAAAABBpc19zdXBwb3J0ZWRfZWlkAAAAAQAAAAAAAAADZWlkAAAAAAQAAAABAAAAAQ==",
+        "AAAAAAAAADxSZXR1cm5zIHRoZSBkZWZhdWx0IHNlbmQgbGlicmFyeSBmb3IgYSBkZXN0aW5hdGlvbiBlbmRwb2ludC4AAAAUZGVmYXVsdF9zZW5kX2xpYnJhcnkAAAABAAAAAAAAAAdkc3RfZWlkAAAAAAQAAAABAAAD6AAAABM=",
+        "AAAAAAAAADpSZXR1cm5zIHRoZSBkZWZhdWx0IHJlY2VpdmUgbGlicmFyeSBmb3IgYSBzb3VyY2UgZW5kcG9pbnQuAAAAAAAXZGVmYXVsdF9yZWNlaXZlX2xpYnJhcnkAAAAAAQAAAAAAAAAHc3JjX2VpZAAAAAAEAAAAAQAAA+gAAAAT",
+        "AAAAAAAAAEJSZXR1cm5zIHRoZSBkZWZhdWx0IHJlY2VpdmUgbGlicmFyeSB0aW1lb3V0IGZvciBhIHNvdXJjZSBlbmRwb2ludC4AAAAAAB9kZWZhdWx0X3JlY2VpdmVfbGlicmFyeV90aW1lb3V0AAAAAAEAAAAAAAAAB3NyY19laWQAAAAABAAAAAEAAAPoAAAH0AAAAAdUaW1lb3V0AA==",
+        "AAAAAAAAAEhSZXR1cm5zIHRoZSBlZmZlY3RpdmUgc2VuZCBsaWJyYXJ5IGZvciBhbiBPQXBwIGFuZCBkZXN0aW5hdGlvbiBlbmRwb2ludC4AAAAQZ2V0X3NlbmRfbGlicmFyeQAAAAIAAAAAAAAABnNlbmRlcgAAAAAAEwAAAAAAAAAHZHN0X2VpZAAAAAAEAAAAAQAAB9AAAAAPUmVzb2x2ZWRMaWJyYXJ5AA==",
+        "AAAAAAAAAEZSZXR1cm5zIHRoZSBlZmZlY3RpdmUgcmVjZWl2ZSBsaWJyYXJ5IGZvciBhbiBPQXBwIGFuZCBzb3VyY2UgZW5kcG9pbnQuAAAAAAATZ2V0X3JlY2VpdmVfbGlicmFyeQAAAAACAAAAAAAAAAhyZWNlaXZlcgAAABMAAAAAAAAAB3NyY19laWQAAAAABAAAAAEAAAfQAAAAD1Jlc29sdmVkTGlicmFyeQA=",
+        "AAAAAAAAAERSZXR1cm5zIHRoZSByZWNlaXZlIGxpYnJhcnkgdGltZW91dCBmb3IgYW4gT0FwcCBhbmQgc291cmNlIGVuZHBvaW50LgAAABdyZWNlaXZlX2xpYnJhcnlfdGltZW91dAAAAAACAAAAAAAAAAhyZWNlaXZlcgAAABMAAAAAAAAAB3NyY19laWQAAAAABAAAAAEAAAPoAAAH0AAAAAdUaW1lb3V0AA==",
+        "AAAAAAAAAEVDaGVja3MgaWYgYSByZWNlaXZlIGxpYnJhcnkgaXMgdmFsaWQgZm9yIGFuIE9BcHAgYW5kIHNvdXJjZSBlbmRwb2ludC4AAAAAAAAYaXNfdmFsaWRfcmVjZWl2ZV9saWJyYXJ5AAAAAwAAAAAAAAAIcmVjZWl2ZXIAAAATAAAAAAAAAAdzcmNfZWlkAAAAAAQAAAAAAAAACmFjdHVhbF9saWIAAAAAABMAAAABAAAAAQ==",
+        "AAAAAAAAAGJSZXR1cm5zIHRoZSBjb25maWd1cmF0aW9uIGZvciBhIG1lc3NhZ2UgbGlicmFyeSBmb3IgYSBzcGVjaWZpYyBlbmRwb2ludCBJRCBhbmQgY29uZmlndXJhdGlvbiB0eXBlLgAAAAAACmdldF9jb25maWcAAAAAAAQAAAAAAAAABG9hcHAAAAATAAAAAAAAAANsaWIAAAAAEwAAAAAAAAADZWlkAAAAAAQAAAAAAAAAC2NvbmZpZ190eXBlAAAAAAQAAAABAAAADg==",
+        "AAAAAAAAADtRdW90ZXMgdGhlIG1lc3NhZ2luZyBmZWUgZm9yIHNlbmRpbmcgYSBjcm9zcy1jaGFpbiBtZXNzYWdlLgAAAAAFcXVvdGUAAAAAAAACAAAAAAAAAAZzZW5kZXIAAAAAABMAAAAAAAAABnBhcmFtcwAAAAAH0AAAAA9NZXNzYWdpbmdQYXJhbXMAAAAAAQAAB9AAAAAMTWVzc2FnaW5nRmVl",
+        "AAAAAAAAAIlTZW5kcyBhIGNyb3NzLWNoYWluIG1lc3NhZ2UgdG8gYSBkZXN0aW5hdGlvbiBlbmRwb2ludC4KCk9BcHAgc2VuZGVyIG5lZWRzIHRvIHRyYW5zZmVyIHRoZSBmZWVzIHRvIHRoZSBlbmRwb2ludCBiZWZvcmUgc2VuZGluZyB0aGUgbWVzc2FnZQAAAAAAAARzZW5kAAAAAwAAAAAAAAAGc2VuZGVyAAAAAAATAAAAAAAAAAZwYXJhbXMAAAAAB9AAAAAPTWVzc2FnaW5nUGFyYW1zAAAAAAAAAAAOcmVmdW5kX2FkZHJlc3MAAAAAABMAAAABAAAH0AAAABBNZXNzYWdpbmdSZWNlaXB0",
+        "AAAAAAAAAEpWZXJpZmllcyBhbiBpbmJvdW5kIGNyb3NzLWNoYWluIG1lc3NhZ2UgZnJvbSBhIGNvbmZpZ3VyZWQgcmVjZWl2ZSBsaWJyYXJ5LgAAAAAABnZlcmlmeQAAAAAABAAAAAAAAAALcmVjZWl2ZV9saWIAAAAAEwAAAAAAAAAGb3JpZ2luAAAAAAfQAAAABk9yaWdpbgAAAAAAAAAAAAhyZWNlaXZlcgAAABMAAAAAAAAADHBheWxvYWRfaGFzaAAAA+4AAAAgAAAAAA==",
+        "AAAAAAAAAGdDbGVhcnMgYSB2ZXJpZmllZCBtZXNzYWdlIGZyb20gdGhlIGVuZHBvaW50LgoKVGhpcyBpcyBhIFBVTEwgbW9kZSB2ZXJzdXMgdGhlIFBVU0ggbW9kZSBvZiBgbHpfcmVjZWl2ZWAuAAAAAAVjbGVhcgAAAAAAAAUAAAAAAAAABmNhbGxlcgAAAAAAEwAAAAAAAAAGb3JpZ2luAAAAAAfQAAAABk9yaWdpbgAAAAAAAAAAAAhyZWNlaXZlcgAAABMAAAAAAAAABGd1aWQAAAPuAAAAIAAAAAAAAAAHbWVzc2FnZQAAAAAOAAAAAA==",
+        "AAAAAAAAAIFFbWl0cyBhbiBhbGVydCBldmVudCB3aGVuIGBsel9yZWNlaXZlYCBleGVjdXRpb24gZmFpbHMuCgpDYWxsZWQgYnkgdGhlIGV4ZWN1dG9yIHRvIG5vdGlmeSBhYm91dCBmYWlsZWQgbWVzc2FnZSBkZWxpdmVyeSBhdHRlbXB0cy4AAAAAAAAQbHpfcmVjZWl2ZV9hbGVydAAAAAkAAAAAAAAACGV4ZWN1dG9yAAAAEwAAAAAAAAAGb3JpZ2luAAAAAAfQAAAABk9yaWdpbgAAAAAAAAAAAAhyZWNlaXZlcgAAABMAAAAAAAAABGd1aWQAAAPuAAAAIAAAAAAAAAADZ2FzAAAAAAsAAAAAAAAABXZhbHVlAAAAAAAACwAAAAAAAAAHbWVzc2FnZQAAAAAOAAAAAAAAAApleHRyYV9kYXRhAAAAAAAOAAAAAAAAAAZyZWFzb24AAAAAAA4AAAAA",
+        "AAAAAAAAACxTZXRzIHRoZSBaUk8gdG9rZW4gYWRkcmVzcyBmb3IgZmVlIHBheW1lbnRzLgAAAAdzZXRfenJvAAAAAAEAAAAAAAAAA3pybwAAAAATAAAAAA==",
+        "AAAAAAAAAEZTZXRzIG9yIHJlbW92ZXMgYSBkZWxlZ2F0ZSBhZGRyZXNzIHRoYXQgY2FuIGFjdCBvbiBiZWhhbGYgb2YgdGhlIE9BcHAuAAAAAAAMc2V0X2RlbGVnYXRlAAAAAgAAAAAAAAAEb2FwcAAAABMAAAAAAAAADG5ld19kZWxlZ2F0ZQAAA+gAAAATAAAAAA==",
+        "AAAAAAAAABhSZXR1cm5zIHRoZSBlbmRwb2ludCBJRC4AAAADZWlkAAAAAAAAAAABAAAABA==",
+        "AAAAAAAAAFlDaGVja3MgaWYgYSBtZXNzYWdpbmcgcGF0aCBjYW4gYmUvaGFzIGJlZW4gaW5pdGlhbGl6ZWQgZm9yIHRoZSBnaXZlbiBvcmlnaW4gYW5kIHJlY2VpdmVyLgAAAAAAAA1pbml0aWFsaXphYmxlAAAAAAAAAgAAAAAAAAAGb3JpZ2luAAAAAAfQAAAABk9yaWdpbgAAAAAAAAAAAAhyZWNlaXZlcgAAABMAAAABAAAAAQ==",
+        "AAAAAAAAAEZDaGVja3MgaWYgYSBtZXNzYWdlIGNhbiBiZSB2ZXJpZmllZCBmb3IgdGhlIGdpdmVuIG9yaWdpbiBhbmQgcmVjZWl2ZXIuAAAAAAAKdmVyaWZpYWJsZQAAAAAAAgAAAAAAAAAGb3JpZ2luAAAAAAfQAAAABk9yaWdpbgAAAAAAAAAAAAhyZWNlaXZlcgAAABMAAAABAAAAAQ==",
+        "AAAAAAAAADdSZXR1cm5zIHRoZSBuYXRpdmUgdG9rZW4gYWRkcmVzcyB1c2VkIGZvciBmZWUgcGF5bWVudHMuAAAAAAxuYXRpdmVfdG9rZW4AAAAAAAAAAQAAABM=",
+        "AAAAAAAAACVSZXR1cm5zIHRoZSBaUk8gdG9rZW4gYWRkcmVzcyBpZiBzZXQuAAAAAAAAA3pybwAAAAAAAAAAAQAAA+gAAAAT",
+        "AAAAAAAAADBSZXR1cm5zIHRoZSBkZWxlZ2F0ZSBhZGRyZXNzIGZvciBhbiBPQXBwIGlmIHNldC4AAAAIZGVsZWdhdGUAAAABAAAAAAAAAARvYXBwAAAAEwAAAAEAAAPoAAAAEw==",
+        "AAAAAAAAAAAAAAANX19jb25zdHJ1Y3RvcgAAAAAAAAEAAAAAAAAABW93bmVyAAAAAAAAEwAAAAA=",
+        "AAAAAAAAALFSZWNvdmVycyB0b2tlbnMgc2VudCB0byB0aGlzIGNvbnRyYWN0IGJ5IG1pc3Rha2UuCgojIEFyZ3VtZW50cwoqIGB0b2tlbmAgLSBUaGUgdG9rZW4gYWRkcmVzcyB0byByZWNvdmVyCiogYHRvYCAtIFRoZSBhZGRyZXNzIHRvIHNlbmQgdGhlIHRva2VuIHRvCiogYGFtb3VudGAgLSBUaGUgYW1vdW50IHRvIHNlbmQAAAAAAAANcmVjb3Zlcl90b2tlbgAAAAAAAAMAAAAAAAAABXRva2VuAAAAAAAAEwAAAAAAAAACdG8AAAAAABMAAAAAAAAABmFtb3VudAAAAAAACwAAAAA=",
+        "AAAAAAAAAAAAAAAFb3duZXIAAAAAAAAAAAAAAQAAA+gAAAAT",
+        "AAAAAAAAAAAAAAASdHJhbnNmZXJfb3duZXJzaGlwAAAAAAABAAAAAAAAAAluZXdfb3duZXIAAAAAAAATAAAAAA==",
+        "AAAAAAAAAAAAAAAScmVub3VuY2Vfb3duZXJzaGlwAAAAAAAAAAAAAA==",
+        "AAAAAAAAAAAAAAAOc2V0X3R0bF9jb25maWcAAAAAAAMAAAAAAAAACGluc3RhbmNlAAAD6AAAB9AAAAAJVHRsQ29uZmlnAAAAAAAAAAAAAApwZXJzaXN0ZW50AAAAAAPoAAAH0AAAAAlUdGxDb25maWcAAAAAAAAAAAAACXRlbXBvcmFyeQAAAAAAA+gAAAfQAAAACVR0bENvbmZpZwAAAAAAAAA=",
+        "AAAAAAAAAAAAAAAKdHRsX2NvbmZpZwAAAAAAAAAAAAEAAAPtAAAAAwAAA+gAAAfQAAAACVR0bENvbmZpZwAAAAAAA+gAAAfQAAAACVR0bENvbmZpZwAAAAAAA+gAAAfQAAAACVR0bENvbmZpZwAAAA==",
+        "AAAAAAAAAAAAAAARZnJlZXplX3R0bF9jb25maWcAAAAAAAAAAAAAAA==",
+        "AAAAAAAAAAAAAAAUaXNfdHRsX2NvbmZpZ19mcm96ZW4AAAAAAAAAAQAAAAE=",
+        "AAAABAAAAAAAAAAAAAAAEUJ1ZmZlclJlYWRlckVycm9yAAAAAAAAAgAAAAAAAAANSW52YWxpZExlbmd0aAAAAAAAJxAAAAAAAAAAFUludmFsaWRBZGRyZXNzUGF5bG9hZAAAAAAAJxE=",
+        "AAAABAAAAAAAAAAAAAAAEUJ1ZmZlcldyaXRlckVycm9yAAAAAAAAAQAAAAAAAAAVSW52YWxpZEFkZHJlc3NQYXlsb2FkAAAAAAAndA==",
+        "AAAABAAAAAAAAAAAAAAACFR0bEVycm9yAAAAAwAAAAAAAAAQSW52YWxpZFR0bENvbmZpZwAAJ9gAAAAAAAAAD1R0bENvbmZpZ0Zyb3plbgAAACfZAAAAAAAAABZUdGxDb25maWdBbHJlYWR5RnJvemVuAAAAACfa",
+        "AAAABAAAAAAAAAAAAAAADE93bmFibGVFcnJvcgAAAAIAAAAAAAAAD093bmVyQWxyZWFkeVNldAAAACg8AAAAAAAAAAtPd25lck5vdFNldAAAACg9",
+        "AAAABAAAAAAAAAAAAAAADUJ5dGVzRXh0RXJyb3IAAAAAAAABAAAAAAAAAA5MZW5ndGhNaXNtYXRjaAAAAAAooA==",
+        "AAAABQAAACxFdmVudCBlbWl0dGVkIHdoZW4gb3duZXJzaGlwIGlzIHRyYW5zZmVycmVkLgAAAAAAAAAUT3duZXJzaGlwVHJhbnNmZXJyZWQAAAABAAAAFE93bmVyc2hpcFRyYW5zZmVycmVkAAAAAgAAAAAAAAAJb2xkX293bmVyAAAAAAAAEwAAAAAAAAAAAAAACW5ld19vd25lcgAAAAAAABMAAAAAAAAAAg==",
+        "AAAABQAAACpFdmVudCBlbWl0dGVkIHdoZW4gb3duZXJzaGlwIGlzIHJlbm91bmNlZC4AAAAAAAAAAAAST3duZXJzaGlwUmVub3VuY2VkAAAAAAABAAAAEk93bmVyc2hpcFJlbm91bmNlZAAAAAAAAQAAAAAAAAAJb2xkX293bmVyAAAAAAAAEwAAAAAAAAAC",
+        "AAAAAgAAAAAAAAAAAAAAFURlZmF1bHRPd25hYmxlU3RvcmFnZQAAAAAAAAEAAAAAAAAAAAAAAAVPd25lcgAAAA==",
+        "AAAAAQAAAFdBIHBhaXIgb2YgVFRMIHZhbHVlczogdGhyZXNob2xkICh3aGVuIHRvIHRyaWdnZXIgZXh0ZW5zaW9uKSBhbmQgZXh0ZW5kX3RvICh0YXJnZXQgVFRMKS4AAAAAAAAAAAlUdGxDb25maWcAAAAAAAACAAAAKFRhcmdldCBUVEwgYWZ0ZXIgZXh0ZW5zaW9uIChpbiBsZWRnZXJzKS4AAAAJZXh0ZW5kX3RvAAAAAAAABAAAADNUVEwgdGhyZXNob2xkIHRoYXQgdHJpZ2dlcnMgZXh0ZW5zaW9uIChpbiBsZWRnZXJzKS4AAAAACXRocmVzaG9sZAAAAAAAAAQ=",
+        "AAAAAgAAAAAAAAAAAAAADVR0bENvbmZpZ0RhdGEAAAAAAAAEAAAAAAAAAAAAAAAGRnJvemVuAAAAAAAAAAAAAAAAAAhJbnN0YW5jZQAAAAAAAAAAAAAAClBlcnNpc3RlbnQAAAAAAAAAAAAAAAAACVRlbXBvcmFyeQAAAA==" ]),
+      options
+    )
+  }
+  public readonly fromJSON = {
+    send_compose: this.txFromJSON<null>,
+        clear_compose: this.txFromJSON<null>,
+        lz_compose_alert: this.txFromJSON<null>,
+        compose_queue: this.txFromJSON<Option<Buffer>>,
+        skip: this.txFromJSON<null>,
+        nilify: this.txFromJSON<null>,
+        burn: this.txFromJSON<null>,
+        next_guid: this.txFromJSON<Buffer>,
+        outbound_nonce: this.txFromJSON<u64>,
+        inbound_nonce: this.txFromJSON<u64>,
+        lazy_inbound_nonce: this.txFromJSON<u64>,
+        inbound_payload_hash: this.txFromJSON<Option<Buffer>>,
+        register_library: this.txFromJSON<null>,
+        set_default_send_library: this.txFromJSON<null>,
+        set_default_receive_library: this.txFromJSON<null>,
+        set_default_receive_lib_timeout: this.txFromJSON<null>,
+        set_send_library: this.txFromJSON<null>,
+        set_receive_library: this.txFromJSON<null>,
+        set_receive_library_timeout: this.txFromJSON<null>,
+        set_config: this.txFromJSON<null>,
+        is_registered_library: this.txFromJSON<boolean>,
+        get_library_index: this.txFromJSON<Option<u32>>,
+        registered_libraries_count: this.txFromJSON<u32>,
+        get_registered_libraries: this.txFromJSON<Array<string>>,
+        is_supported_eid: this.txFromJSON<boolean>,
+        default_send_library: this.txFromJSON<Option<string>>,
+        default_receive_library: this.txFromJSON<Option<string>>,
+        default_receive_library_timeout: this.txFromJSON<Option<Timeout>>,
+        get_send_library: this.txFromJSON<ResolvedLibrary>,
+        get_receive_library: this.txFromJSON<ResolvedLibrary>,
+        receive_library_timeout: this.txFromJSON<Option<Timeout>>,
+        is_valid_receive_library: this.txFromJSON<boolean>,
+        get_config: this.txFromJSON<Buffer>,
+        quote: this.txFromJSON<MessagingFee>,
+        send: this.txFromJSON<MessagingReceipt>,
+        verify: this.txFromJSON<null>,
+        clear: this.txFromJSON<null>,
+        lz_receive_alert: this.txFromJSON<null>,
+        set_zro: this.txFromJSON<null>,
+        set_delegate: this.txFromJSON<null>,
+        eid: this.txFromJSON<u32>,
+        initializable: this.txFromJSON<boolean>,
+        verifiable: this.txFromJSON<boolean>,
+        native_token: this.txFromJSON<string>,
+        zro: this.txFromJSON<Option<string>>,
+        delegate: this.txFromJSON<Option<string>>,
+        recover_token: this.txFromJSON<null>,
+        owner: this.txFromJSON<Option<string>>,
+        transfer_ownership: this.txFromJSON<null>,
+        renounce_ownership: this.txFromJSON<null>,
+        set_ttl_config: this.txFromJSON<null>,
+        ttl_config: this.txFromJSON<readonly [Option<TtlConfig>, Option<TtlConfig>, Option<TtlConfig>]>,
+        freeze_ttl_config: this.txFromJSON<null>,
+        is_ttl_config_frozen: this.txFromJSON<boolean>
+  }
+}