@jbrowse/plugin-config 1.4.2 → 1.5.2

package/package.json

@@ -1,6 +1,6 @@
 {
   "name": "@jbrowse/plugin-config",
-  "version": "1.4.2",
+  "version": "1.5.2",
   "description": "JBrowse 2 config utilities",
   "keywords": [
     "jbrowse",
@@ -36,7 +36,7 @@
   },
   "dependencies": {
     "@material-ui/icons": "^4.9.1",
-    "generic-filehandle": "^2.0.1",
+    "generic-filehandle": "^2.2.2",
     "pluralize": "^8.0.0",
     "react-color": "^2.19.3",
     "react-simple-code-editor": "0.9.3",
@@ -55,5 +55,5 @@
   "publishConfig": {
     "access": "public"
   },
-  "gitHead": "f1fa1d1a9cdebe9013116f0b7e737bd0cc5c966b"
+  "gitHead": "94fdfbc34787ab8f12a87e00038da74b247b42fa"
 }

package/src/ConfigurationEditorWidget/components/CallbackEditor.js

@@ -1,12 +1,14 @@
 import React, { useEffect, useState } from 'react'
 import { useDebounce } from '@jbrowse/core/util'
 import { stringToJexlExpression } from '@jbrowse/core/util/jexlStrings'
-import FormControl from '@material-ui/core/FormControl'
-import FormHelperText from '@material-ui/core/FormHelperText'
-import InputLabel from '@material-ui/core/InputLabel'
-import { makeStyles } from '@material-ui/core/styles'
-import Tooltip from '@material-ui/core/Tooltip'
-import IconButton from '@material-ui/core/IconButton'
+import {
+  FormControl,
+  FormHelperText,
+  InputLabel,
+  Tooltip,
+  IconButton,
+  makeStyles,
+} from '@material-ui/core'
 import HelpIcon from '@material-ui/icons/Help'
 import { getEnv } from 'mobx-state-tree'
 import { observer, PropTypes } from 'mobx-react'

package/src/ConfigurationEditorWidget/components/CodeEditor.js

@@ -0,0 +1,59 @@
+import React, { useEffect } from 'react'
+import Editor from 'react-simple-code-editor'
+import { Light as SyntaxHighlighter } from 'react-syntax-highlighter'
+import json from 'react-syntax-highlighter/dist/cjs/languages/hljs/json'
+import a11yDark from 'react-syntax-highlighter/dist/cjs/styles/hljs/a11y-dark'
+import a11yLight from 'react-syntax-highlighter/dist/cjs/styles/hljs/a11y-light'
+import { useTheme, makeStyles } from '@material-ui/core'
+
+// fontSize and fontFamily have to match between Editor and SyntaxHighlighter
+const fontSize = '12px'
+// Optimize by using system default fonts: https://css-tricks.com/snippets/css/font-stacks/
+const fontFamily =
+  'Consolas, "Andale Mono WT", "Andale Mono", "Lucida Console", "Lucida Sans Typewriter", "DejaVu Sans Mono", "Bitstream Vera Sans Mono", "Liberation Mono", "Nimbus Mono L", Monaco, "Courier New", Courier, monospace'
+
+const useStyles = makeStyles({
+  callbackEditor: {
+    fontFamily,
+    fontSize,
+    overflowX: 'auto',
+    marginTop: '16px',
+    borderBottom: '1px solid rgba(0,0,0,0.42)',
+  },
+  syntaxHighlighter: {
+    margin: 0,
+    fontFamily,
+    fontSize,
+  },
+})
+
+// eslint-disable-next-line react/prop-types
+export default function CodeEditor({ contents, setContents }) {
+  const classes = useStyles()
+  const theme = useTheme()
+  useEffect(() => {
+    SyntaxHighlighter.registerLanguage('json', json)
+  }, [])
+
+  return (
+    <Editor
+      className={classes.callbackEditor}
+      value={contents}
+      onValueChange={setContents}
+      highlight={newCode => (
+        <SyntaxHighlighter
+          language="json"
+          style={theme.palette.type === 'dark' ? a11yDark : a11yLight}
+          className={classes.syntaxHighlighter}
+          // override some inline style stuff that's higher specificity
+          // than className
+          customStyle={{ background: 'none', padding: 0 }}
+        >
+          {newCode}
+        </SyntaxHighlighter>
+      )}
+      padding={10}
+      style={{}}
+    />
+  )
+}

package/src/ConfigurationEditorWidget/components/ColorEditor.tsx

@@ -1,9 +1,10 @@
+import React, { lazy, useState } from 'react'
 import { observer } from 'mobx-react'
 import ReactPropTypes from 'prop-types'
 import TextField from '@material-ui/core/TextField'
-import { makeStyles } from '@material-ui/core/styles'
-import { ChromePicker, Color, ColorResult, RGBColor } from 'react-color'
-import React, { useState } from 'react'
+import { Color, RGBColor } from 'react-color'
+
+const ColorPicker = lazy(() => import('./ColorPicker'))
 
 // this is needed because passing a entire color object into the react-color
 // for alpha, can't pass in an rgba string for example
@@ -14,51 +15,6 @@ function serializeColor(color: Color) {
   }
   return color
 }
-const useStyles = makeStyles({
-  popover: {
-    position: 'absolute',
-    zIndex: 2,
-  },
-  cover: {
-    position: 'fixed',
-    top: 0,
-    right: 0,
-    bottom: 0,
-    left: 0,
-  },
-})
-
-export function ColorPicker(props: {
-  color: Color
-  onChange: (color: ColorResult) => void
-}) {
-  const { color, onChange } = props
-  const classes = useStyles()
-  const [displayColorPicker, setDisplayColorPicker] = useState(true)
-
-  const handleClose = () => {
-    setDisplayColorPicker(false)
-  }
-  return (
-    <div>
-      {displayColorPicker ? (
-        <div className={classes.popover}>
-          <div
-            role="presentation"
-            className={classes.cover}
-            onClick={handleClose}
-          />
-          <ChromePicker color={color} onChange={onChange} />
-        </div>
-      ) : null}
-    </div>
-  )
-}
-
-ColorPicker.propTypes = {
-  color: ReactPropTypes.string.isRequired,
-  onChange: ReactPropTypes.func.isRequired,
-}
 
 export const ColorSlot = (props: {
   value: string
@@ -92,12 +48,14 @@ export const ColorSlot = (props: {
         {...TextFieldProps}
       />
       {displayed ? (
-        <ColorPicker
-          color={value}
-          onChange={(event: ColorResult) => {
-            onChange(serializeColor(event.rgb))
-          }}
-        />
+        <React.Suspense fallback={<div />}>
+          <ColorPicker
+            color={value}
+            onChange={event => {
+              onChange(serializeColor(event.rgb))
+            }}
+          />
+        </React.Suspense>
       ) : null}
     </>
   )

package/src/ConfigurationEditorWidget/components/ColorPicker.tsx

@@ -0,0 +1,52 @@
+import React, { useState } from 'react'
+import { makeStyles } from '@material-ui/core/styles'
+import ReactPropTypes from 'prop-types'
+import { ChromePicker, Color, ColorResult } from 'react-color'
+
+const useStyles = makeStyles({
+  popover: {
+    position: 'absolute',
+    zIndex: 2,
+  },
+  cover: {
+    position: 'fixed',
+    top: 0,
+    right: 0,
+    bottom: 0,
+    left: 0,
+  },
+})
+
+export function ColorPicker(props: {
+  color: Color
+  onChange: (color: ColorResult) => void
+}) {
+  const { color, onChange } = props
+  const classes = useStyles()
+  const [displayColorPicker, setDisplayColorPicker] = useState(true)
+
+  const handleClose = () => {
+    setDisplayColorPicker(false)
+  }
+  return (
+    <div>
+      {displayColorPicker ? (
+        <div className={classes.popover}>
+          <div
+            role="presentation"
+            className={classes.cover}
+            onClick={handleClose}
+          />
+          <ChromePicker color={color} onChange={onChange} />
+        </div>
+      ) : null}
+    </div>
+  )
+}
+
+ColorPicker.propTypes = {
+  color: ReactPropTypes.string.isRequired,
+  onChange: ReactPropTypes.func.isRequired,
+}
+
+export default ColorPicker

package/src/ConfigurationEditorWidget/components/ConfigurationEditor.test.js

@@ -35,7 +35,7 @@ describe('ConfigurationEditor widget', () => {
         name: 'fileLocationTest',
         description: 'fileLocationTest',
         type: 'fileLocation',
-        defaultValue: { uri: '/path/to/my.file' },
+        defaultValue: { uri: '/path/to/my.file', locationType: 'UriLocation' },
       },
       stringArrayTest: {
         name: 'stringArrayTest',
@@ -86,9 +86,8 @@ describe('ConfigurationEditor widget', () => {
     const pluginManager = new PluginManager([new Alignments(), new SVG()])
     pluginManager.createPluggableElements()
     pluginManager.configure()
-    const PileupDisplaySchema = linearBasicDisplayConfigSchemaFactory(
-      pluginManager,
-    )
+    const PileupDisplaySchema =
+      linearBasicDisplayConfigSchemaFactory(pluginManager)
     const { container } = render(
       <ConfigurationEditor model={{ target: PileupDisplaySchema.create() }} />,
     )

package/src/ConfigurationEditorWidget/components/JsonEditor.js

@@ -1,46 +1,23 @@
+import React, { lazy, useEffect, useState } from 'react'
 import { useDebounce } from '@jbrowse/core/util'
-import FormControl from '@material-ui/core/FormControl'
-import FormHelperText from '@material-ui/core/FormHelperText'
-import InputLabel from '@material-ui/core/InputLabel'
-import { makeStyles, useTheme } from '@material-ui/core/styles'
+import {
+  FormControl,
+  FormHelperText,
+  InputLabel,
+  makeStyles,
+} from '@material-ui/core'
 import { observer, PropTypes } from 'mobx-react'
-import React, { useEffect, useState } from 'react'
-import Editor from 'react-simple-code-editor'
-import { Light as SyntaxHighlighter } from 'react-syntax-highlighter'
-import json from 'react-syntax-highlighter/dist/cjs/languages/hljs/json'
-import a11yDark from 'react-syntax-highlighter/dist/cjs/styles/hljs/a11y-dark'
-import a11yLight from 'react-syntax-highlighter/dist/cjs/styles/hljs/a11y-light'
-
-SyntaxHighlighter.registerLanguage('json', json)
-
-// fontSize and fontFamily have to match between Editor and SyntaxHighlighter
-const fontSize = '12px'
-// Optimize by using system default fonts: https://css-tricks.com/snippets/css/font-stacks/
-const fontFamily =
-  'Consolas, "Andale Mono WT", "Andale Mono", "Lucida Console", "Lucida Sans Typewriter", "DejaVu Sans Mono", "Bitstream Vera Sans Mono", "Liberation Mono", "Nimbus Mono L", Monaco, "Courier New", Courier, monospace'
-
 const useStyles = makeStyles({
-  callbackEditor: {
-    fontFamily,
-    fontSize,
-    overflowX: 'auto',
-    marginTop: '16px',
-    borderBottom: '1px solid rgba(0,0,0,0.42)',
-  },
-  syntaxHighlighter: {
-    margin: 0,
-    fontFamily,
-    fontSize,
-  },
   error: {
     color: 'red',
     fontSize: '0.8em',
   },
 })
 
+const CodeEditor = lazy(() => import('./CodeEditor'))
+
 function JsonEditor({ slot }) {
   const classes = useStyles()
-  const theme = useTheme()
   const [contents, setContents] = useState(
     JSON.stringify(slot.value, null, '  '),
   )
@@ -64,25 +41,9 @@ function JsonEditor({ slot }) {
         <InputLabel shrink htmlFor="callback-editor">
           {slot.name}
         </InputLabel>
-        <Editor
-          className={classes.callbackEditor}
-          value={contents}
-          onValueChange={setContents}
-          highlight={newCode => (
-            <SyntaxHighlighter
-              language="json"
-              style={theme.palette.type === 'dark' ? a11yDark : a11yLight}
-              className={classes.syntaxHighlighter}
-              // override some inline style stuff that's higher specificity
-              // than className
-              customStyle={{ background: 'none', padding: 0 }}
-            >
-              {newCode}
-            </SyntaxHighlighter>
-          )}
-          padding={10}
-          style={{}}
-        />
+        <React.Suspense fallback={<div />}>
+          <CodeEditor contents={contents} setContents={setContents} />
+        </React.Suspense>
         <FormHelperText>{slot.description}</FormHelperText>
       </FormControl>
     </>

package/src/ConfigurationEditorWidget/components/SlotEditor.js

@@ -1,3 +1,6 @@
+import React, { useEffect, useState } from 'react'
+import { observer } from 'mobx-react'
+import { getPropertyMembers, getEnv } from 'mobx-state-tree'
 import { FileSelector } from '@jbrowse/core/ui'
 import {
   getPropertyType,
@@ -24,12 +27,12 @@ import {
   makeStyles,
 } from '@material-ui/core'
 
+// icons
 import DeleteIcon from '@material-ui/icons/Delete'
 import AddIcon from '@material-ui/icons/Add'
 import RadioButtonUncheckedIcon from '@material-ui/icons/RadioButtonUnchecked'
-import { observer } from 'mobx-react'
-import { getPropertyMembers } from 'mobx-state-tree'
-import React, { useEffect, useState } from 'react'
+
+// locals
 import CallbackEditor from './CallbackEditor'
 import ColorEditor from './ColorEditor'
 import JsonEditor from './JsonEditor'
@@ -341,6 +344,7 @@ const FileSelectorWrapper = observer(({ slot }) => {
       setLocation={location => slot.set(location)}
       name={slot.name}
       description={slot.description}
+      rootModel={getEnv(slot).pluginManager?.rootModel}
     />
   )
 })

package/src/ConfigurationEditorWidget/components/__snapshots__/ConfigurationEditor.test.js.snap

@@ -47,21 +47,24 @@ exports[`ConfigurationEditor widget renders all the different types of built-in
     <div
       class="makeStyles-paperContent"
     >
-      <label
-        class="MuiFormLabel-root MuiInputLabel-root MuiInputLabel-animated MuiInputLabel-shrink"
-        data-shrink="true"
-        for="callback-editor"
+      <div
+        class="MuiBox-root MuiBox-root"
       >
-        fileLocationTest
-      </label>
+        <label
+          class="MuiFormLabel-root MuiInputLabel-root MuiInputLabel-animated MuiInputLabel-shrink"
+          data-shrink="true"
+        >
+          fileLocationTest
+        </label>
+      </div>
       <div
-        class="MuiGrid-root MuiGrid-container MuiGrid-spacing-xs-1 MuiGrid-align-items-xs-center"
+        class="MuiBox-root MuiBox-root"
       >
         <div
-          class="MuiGrid-root MuiGrid-item"
+          class="MuiBox-root MuiBox-root"
         >
           <div
-            aria-label="file or url picker"
+            aria-label="file, url, or account picker"
             class="MuiToggleButtonGroup-root"
             role="group"
           >
@@ -101,24 +104,38 @@ exports[`ConfigurationEditor widget renders all the different types of built-in
             </button>
           </div>
         </div>
+      </div>
+      <div
+        class="MuiFormControl-root MuiTextField-root MuiFormControl-fullWidth"
+      >
+        <label
+          class="MuiFormLabel-root MuiInputLabel-root MuiInputLabel-formControl MuiInputLabel-animated MuiInputLabel-shrink MuiInputLabel-outlined MuiFormLabel-filled"
+          data-shrink="true"
+        >
+          Enter URL
+        </label>
         <div
-          class="MuiGrid-root MuiGrid-item"
+          class="MuiInputBase-root MuiOutlinedInput-root MuiInputBase-fullWidth MuiInputBase-formControl"
         >
-          <div
-            class="MuiFormControl-root MuiTextField-root MuiFormControl-fullWidth"
+          <input
+            aria-invalid="false"
+            class="MuiInputBase-input MuiOutlinedInput-input"
+            data-testid="urlInput"
+            type="text"
+            value="/path/to/my.file"
+          />
+          <fieldset
+            aria-hidden="true"
+            class="PrivateNotchedOutline-root MuiOutlinedInput-notchedOutline"
           >
-            <div
-              class="MuiInputBase-root MuiInput-root MuiInput-underline MuiInputBase-fullWidth MuiInput-fullWidth MuiInputBase-formControl MuiInput-formControl"
+            <legend
+              class="PrivateNotchedOutline-legendLabelled PrivateNotchedOutline-legendNotched"
             >
-              <input
-                aria-invalid="false"
-                class="MuiInputBase-input MuiInput-input"
-                data-testid="urlInput"
-                type="text"
-                value="/path/to/my.file"
-              />
-            </div>
-          </div>
+              <span>
+                Enter URL
+              </span>
+            </legend>
+          </fieldset>
         </div>
       </div>
       <p
@@ -975,13 +992,13 @@ exports[`ConfigurationEditor widget renders with defaults of the PileupTrack sch
             </label>
             <div
               class="MuiInputBase-root MuiInput-root MuiInput-underline MuiInputBase-fullWidth MuiInput-fullWidth MuiInputBase-formControl MuiInput-formControl"
-              style="color: rgb(200, 200, 200); border-right-width: 25px; border-right-style: solid; border-right-color: #c8c8c8;"
+              style="color: rgb(255, 0, 255); border-right-width: 25px; border-right-style: solid; border-right-color: #f0f;"
             >
               <input
                 aria-invalid="false"
                 class="MuiInputBase-input MuiInput-input"
                 type="text"
-                value="#c8c8c8"
+                value="#f0f"
               />
             </div>
             <p

package/src/FromConfigAdapter/FromConfigAdapter.ts

@@ -7,6 +7,8 @@ import { ObservableCreate } from '@jbrowse/core/util/rxjs'
 import { NoAssemblyRegion } from '@jbrowse/core/util/types'
 import { AnyConfigurationModel } from '@jbrowse/core/configuration/configurationSchema'
 import { readConfObject } from '@jbrowse/core/configuration'
+import PluginManager from '@jbrowse/core/PluginManager'
+import { getSubAdapterType } from '@jbrowse/core/data_adapters/dataAdapterCache'
 
 /**
  * Adapter that just returns the features defined in its `features` configuration
@@ -17,8 +19,12 @@ import { readConfObject } from '@jbrowse/core/configuration'
 export default class FromConfigAdapter extends BaseFeatureDataAdapter {
   protected features: Map<string, Feature[]>
 
-  constructor(conf: AnyConfigurationModel) {
-    super(conf)
+  constructor(
+    conf: AnyConfigurationModel,
+    getSubAdapter?: getSubAdapterType,
+    pluginManager?: PluginManager,
+  ) {
+    super(conf, getSubAdapter, pluginManager)
     const feats = readConfObject(conf, 'features') as SimpleFeatureSerialized[]
     this.features = FromConfigAdapter.makeFeatures(feats || [])
   }

package/src/FromConfigAdapter/FromConfigRegionsAdapter.ts

@@ -10,6 +10,8 @@ import { readConfObject } from '@jbrowse/core/configuration'
 import { ConfigurationModel } from '@jbrowse/core/configuration/configurationSchema'
 import { configSchema as FromConfigAdapterConfigSchema } from './configSchema'
 import FromConfigAdapter from './FromConfigAdapter'
+import PluginManager from '@jbrowse/core/PluginManager'
+import { getSubAdapterType } from '@jbrowse/core/data_adapters/dataAdapterCache'
 
 /**
  * Adapter that just returns the features defined in its `features` configuration
@@ -18,13 +20,16 @@ import FromConfigAdapter from './FromConfigAdapter'
  */
 export default class FromConfigRegionsAdapter
   extends BaseAdapter
-  implements RegionsAdapter {
+  implements RegionsAdapter
+{
   private features: Map<string, Feature[]>
 
   constructor(
     config: ConfigurationModel<typeof FromConfigAdapterConfigSchema>,
+    getSubAdapter?: getSubAdapterType,
+    pluginManager?: PluginManager,
   ) {
-    super(config)
+    super(config, getSubAdapter, pluginManager)
     const features = readConfObject(
       config,
       'features',

package/src/FromConfigAdapter/FromConfigSequenceAdapter.test.ts

@@ -1,7 +1,6 @@
 import { toArray } from 'rxjs/operators'
 import Adapter from './FromConfigSequenceAdapter'
 import { sequenceConfigSchema } from './configSchema'
-
 test('adapter can fetch sequences when there is just one feature representing whole refseq', async () => {
   const features = [
     {
@@ -9,8 +8,7 @@ test('adapter can fetch sequences when there is just one feature representing wh
       refName: 'ctgA',
       start: 0,
       end: 150,
-      seq:
-        'ccaaaccgtcaattaaccggtatcttctcggaaacggcggttctctcctagatagcgatctgtggtctcaccatgcaatttaaacaggtgagtaaagattgctacaaatacgagactagctgtcaccagatgctgttcatctgttggctc',
+      seq: 'ccaaaccgtcaattaaccggtatcttctcggaaacggcggttctctcctagatagcgatctgtggtctcaccatgcaatttaaacaggtgagtaaagattgctacaaatacgagactagctgtcaccagatgctgttcatctgttggctc',
     },
   ]
   const adapter = new Adapter(sequenceConfigSchema.create({ features }))
@@ -40,8 +38,7 @@ test("adapter can fetch sequences when the config's sequence doesn't start at 0"
       refName: 'ctgA',
       start: 5000,
       end: 5150,
-      seq:
-        'ccaaaccgtcaattaaccggtatcttctcggaaacggcggttctctcctagatagcgatctgtggtctcaccatgcaatttaaacaggtgagtaaagattgctacaaatacgagactagctgtcaccagatgctgttcatctgttggctc',
+      seq: 'ccaaaccgtcaattaaccggtatcttctcggaaacggcggttctctcctagatagcgatctgtggtctcaccatgcaatttaaacaggtgagtaaagattgctacaaatacgagactagctgtcaccagatgctgttcatctgttggctc',
     },
   ]
   const adapter = new Adapter(sequenceConfigSchema.create({ features }))

package/src/FromConfigAdapter/FromConfigSequenceAdapter.ts

@@ -4,7 +4,7 @@ import { NoAssemblyRegion } from '@jbrowse/core/util/types'
 import { toArray } from 'rxjs/operators'
 import FromConfigAdapter from './FromConfigAdapter'
 
-export default class FromSequenceConfigAdapter extends FromConfigAdapter {
+export default class FromConfigSequenceAdapter extends FromConfigAdapter {
   /**
    * Fetch features for a certain region
    * @param region - Region
@@ -73,9 +73,6 @@ export default class FromSequenceConfigAdapter extends FromConfigAdapter {
       }
     }
 
-    // sort the regions by refName
-    regions.sort((a, b) => a.refName.localeCompare(b.refName))
-
     return regions
   }
 

package/src/RefNameAliasAdapter/RefNameAliasAdapter.test.ts

@@ -4,7 +4,10 @@ import configSchema from './configSchema'
 test('adapter can fetch a simple alias file', async () => {
   const adapter = new Adapter(
     configSchema.create({
-      location: { localPath: require.resolve('./test_data/simple_alias.txt') },
+      location: {
+        localPath: require.resolve('./test_data/simple_alias.txt'),
+        locationType: 'LocalPathLocation',
+      },
     }),
   )
   const result = await adapter.getRefNameAliases()

package/src/RefNameAliasAdapter/RefNameAliasAdapter.ts

@@ -1,30 +1,20 @@
 import {
   BaseRefNameAliasAdapter,
-  Alias,
   BaseAdapter,
 } from '@jbrowse/core/data_adapters/BaseAdapter'
 import { openLocation } from '@jbrowse/core/util/io'
-import { GenericFilehandle } from 'generic-filehandle'
 import { readConfObject } from '@jbrowse/core/configuration'
 
-import { ConfigurationModel } from '@jbrowse/core/configuration/configurationSchema'
-import MyConfigAdapterSchema from './configSchema'
-
 export default class RefNameAliasAdapter
   extends BaseAdapter
-  implements BaseRefNameAliasAdapter {
-  private location: GenericFilehandle
-
-  private promise: Promise<Alias[]>
-
-  constructor(config: ConfigurationModel<typeof MyConfigAdapterSchema>) {
-    super(config)
-    this.location = openLocation(readConfObject(config, 'location'))
-    this.promise = this.downloadResults()
-  }
-
-  private async downloadResults() {
-    const results = (await this.location.readFile('utf8')) as string
+  implements BaseRefNameAliasAdapter
+{
+  async getRefNameAliases() {
+    const loc = readConfObject(this.config, 'location')
+    if (loc.uri === '' || loc.uri === '/path/to/my/aliases.txt') {
+      return []
+    }
+    const results = (await openLocation(loc).readFile('utf8')) as string
     return results
       .trim()
       .split('\n')
@@ -34,9 +24,5 @@ export default class RefNameAliasAdapter
       })
   }
 
-  getRefNameAliases() {
-    return this.promise
-  }
-
   async freeResources() {}
 }

package/src/RefNameAliasAdapter/configSchema.ts

@@ -5,7 +5,10 @@ export default ConfigurationSchema(
   {
     location: {
       type: 'fileLocation',
-      defaultValue: { uri: '/path/to/my/aliases.txt' },
+      defaultValue: {
+        uri: '/path/to/my/aliases.txt',
+        locationType: 'UriLocation',
+      },
     },
   },
   { explicitlyTyped: true },