@datagrok/sequence-translator 1.0.17 → 1.1.4

package/src/view/view.ts

@@ -0,0 +1,127 @@
+/* Do not change these import lines to match external modules in webpack configuration */
+import * as grok from 'datagrok-api/grok';
+import * as ui from 'datagrok-api/ui';
+import * as DG from 'datagrok-api/dg';
+
+import {MAIN_TAB, AXOLABS_TAB, SDF_TAB} from './const/view';
+import {MainTabUI} from './tabs/main';
+import {SdfTabUI} from './tabs/sdf';
+import {AxolabsTabUI} from './tabs/axolabs';
+import {MonomerLibViewer} from './monomer-lib-viewer/viewer';
+
+export class SequenceTranslatorUI {
+  constructor() {
+    this.view = DG.View.create();
+    this.urlRouter = new URLRouter(this.view);
+    this.view.box = true;
+    this.view.name = 'Sequence Translator';
+
+    const windows = grok.shell.windows;
+    windows.showProperties = false;
+    windows.showToolbox = false;
+    windows.showHelp = false;
+
+    const viewMonomerLibIcon = ui.iconFA('book', MonomerLibViewer.view, 'View monomer library');
+    this.topPanel = [
+      viewMonomerLibIcon,
+    ];
+    this.view.setRibbonPanels([this.topPanel]);
+
+    this.tabs = new TabLayout(
+      new MainTabUI(),
+      new AxolabsTabUI(),
+      new SdfTabUI(),
+      this.urlRouter
+    );
+  }
+
+  private readonly view: DG.View;
+  public readonly tabs: TabLayout;
+  private readonly topPanel: HTMLElement[];
+  private readonly urlRouter: URLRouter;
+
+  /** Create master layout of the app  */
+  public async createLayout(): Promise<void> {
+    const tabControl = await this.tabs.getControl();
+
+    const tabName = this.urlRouter.tabName;
+    if (tabName)
+      tabControl.currentPane = tabControl.getPane(tabName);
+    this.view.append(tabControl);
+
+    grok.shell.addView(this.view);
+  }
+};
+
+class TabLayout {
+  constructor(
+    public readonly mainTab: MainTabUI,
+    public readonly axolabsTab: AxolabsTabUI,
+    public readonly sdfTab: SdfTabUI,
+    private readonly urlRouter: URLRouter
+  ) {}
+
+  private control: DG.TabControl | null = null;
+
+  async getControl(): Promise<DG.TabControl> {
+    if (this.control)
+      return this.control;
+    const control = ui.tabControl({
+      [MAIN_TAB]: await this.mainTab.getHtmlElement(),
+      [AXOLABS_TAB]: this.axolabsTab.htmlDivElement,
+      [SDF_TAB]: await this.sdfTab.getHtmlDivElement(),
+    });
+
+    const sdfPane = control.getPane(SDF_TAB);
+    ui.tooltip.bind(sdfPane.header, 'Get atomic-level structure for SS + AS/AS2 and save SDF');
+
+    const mainPane = control.getPane(MAIN_TAB);
+    ui.tooltip.bind(mainPane.header, 'Translate across formats');
+
+    const axolabsPane = control.getPane(AXOLABS_TAB);
+    ui.tooltip.bind(axolabsPane.header, 'Create modification pattern for SS and AS');
+
+    control.onTabChanged.subscribe(() => {
+      if (control.currentPane.name !== MAIN_TAB)
+        this.urlRouter.searchParams.delete('seq');
+      else {
+        this.urlRouter.searchParams.set('seq', this.mainTab.sequence);
+      }
+      this.urlRouter.updatePath(control);
+    });
+
+    this.control = control;
+
+    return this.control;
+  }
+}
+
+class URLRouter {
+  constructor(private readonly view: DG.View) {
+    this.pathParts = window.location.pathname.split('/');
+    this.searchParams = new URLSearchParams(window.location.search);
+  }
+
+  public searchParams: URLSearchParams;
+  private pathParts: string[];
+
+  get urlParamsString(): string {
+    return Object.entries(this.searchParams)
+      .map(([key, value]) => `${key}=${encodeURIComponent(value)}`).join('&');
+  }
+
+  public updatePath(control: DG.TabControl) {
+    const urlParamsTxt: string = Object.entries(this.searchParams)
+      .map(([key, value]) => `${key}=${encodeURIComponent(value)}`).join('&');
+    this.view.path = '/apps/SequenceTranslator' + `/${control.currentPane.name}`;
+    if (urlParamsTxt)
+      this.view.path += `/?${urlParamsTxt}`;
+  }
+
+  get tabName(): string {
+    const idx = this.pathParts.findIndex((el) => el === 'SequenceTranslator');
+    if (idx === -1) // todo: remove after verification of validity condition
+      return '';
+    return this.pathParts[idx + 1];
+  }
+}

package/tsconfig.json

@@ -4,14 +4,13 @@
 
     /* Basic Options */
     // "incremental": true,                         /* Enable incremental compilation */
-    "target": "es6",
+    "target": "es2022",
     /* Specify ECMAScript target version: 'ES3' (default), 'ES5', 'ES2015', 'ES2016', 'ES2017', 'ES2018', 'ES2019', 'ES2020', or 'ESNEXT'. */
-    "module": "es2020",
+    "module": "es2022",
     /* Specify module code generation: 'none', 'commonjs', 'amd', 'system', 'umd', 'es2015', 'es2020', or 'ESNext'. */
     "lib": [
-      "es2020",
-      "dom",
-      "ES2021.String"
+      "ES2022",
+      "dom"
     ],
     /* Specify library files to be included in the compilation. */
     // "allowJs": true,                             /* Allow javascript files to be compiled. */
@@ -19,9 +18,9 @@
     // "jsx": "preserve",                           /* Specify JSX code generation: 'preserve', 'react-native', 'react', 'react-jsx' or 'react-jsxdev'. */
     // "declaration": true,                         /* Generates corresponding '.d.ts' file. */
     // "declarationMap": true,                      /* Generates a sourcemap for each corresponding '.d.ts' file. */
-    // "sourceMap": true,                           /* Generates corresponding '.map' file. */
+    "sourceMap": true,                              /* Generates corresponding '.map' file. */
     // "outFile": "./",                             /* Concatenate and emit output to single file. */
-    // "outDir": "./",                              /* Redirect output structure to the directory. */
+    "outDir": "./dist",                             /* Redirect output structure to the directory. */
     // "rootDir": "./",                             /* Specify the root directory of input files. Use to control the output directory structure with --outDir. */
     // "composite": true,                           /* Enable project compilation */
     // "tsBuildInfoFile": "./",                     /* Specify file to store incremental compilation information */
@@ -32,13 +31,12 @@
     // "isolatedModules": true,                     /* Transpile each file as a separate module (similar to 'ts.transpileModule'). */
 
     /* Strict Type-Checking Options */
-    "strict": true,
-    /* Enable all strict type-checking options. */
+    "strict": true,                                 /* Enable all strict type-checking options. */
     // "noImplicitAny": true,                       /* Raise error on expressions and declarations with an implied 'any' type. */
     // "strictNullChecks": true,                    /* Enable strict null checks. */
     // "strictFunctionTypes": true,                 /* Enable strict checking of function types. */
     // "strictBindCallApply": true,                 /* Enable strict 'bind', 'call', and 'apply' methods on functions. */
-    // "strictPropertyInitialization": true,        /* Enable strict checking of property initialization in classes. */
+    "strictPropertyInitialization": false,          /* Enable strict checking of property initialization in classes. */
     // "noImplicitThis": true,                      /* Raise error on 'this' expressions with an implied 'any' type. */
     // "alwaysStrict": true,                        /* Parse in strict mode and emit "use strict" for each source file. */
 
@@ -51,16 +49,14 @@
     // "noPropertyAccessFromIndexSignature": true,  /* Require undeclared properties from index signatures to use element accesses. */
 
     /* Module Resolution Options */
-    "moduleResolution": "node",
-    /* Specify module resolution strategy: 'node' (Node.js) or 'classic' (TypeScript pre-1.6). */
+    "moduleResolution": "node",                     /* Specify module resolution strategy: 'node' (Node.js) or 'classic' (TypeScript pre-1.6). */
     // "baseUrl": "./",                             /* Base directory to resolve non-absolute module names. */
     // "paths": {},                                 /* A series of entries which re-map imports to lookup locations relative to the 'baseUrl'. */
     // "rootDirs": [],                              /* List of root folders whose combined content represents the structure of the project at runtime. */
     // "typeRoots": [],                             /* List of folders to include type definitions from. */
     // "types": [],                                 /* Type declaration files to be included in compilation. */
     // "allowSyntheticDefaultImports": true,        /* Allow default imports from modules with no default export. This does not affect code emit, just typechecking. */
-    "esModuleInterop": true,
-    /* Enables emit interoperability between CommonJS and ES Modules via creation of namespace objects for all imports. Implies 'allowSyntheticDefaultImports'. */
+    "esModuleInterop": true,                        /* Enables emit interoperability between CommonJS and ES Modules via creation of namespace objects for all imports. Implies 'allowSyntheticDefaultImports'. */
     // "preserveSymlinks": true,                    /* Do not resolve the real path of symlinks. */
     // "allowUmdGlobalAccess": true,                /* Allow accessing UMD globals from modules. */
 
@@ -75,9 +71,7 @@
     // "emitDecoratorMetadata": true,               /* Enables experimental support for emitting type metadata for decorators. */
 
     /* Advanced Options */
-    "skipLibCheck": false,
-    /* Skip type checking of declaration files. */
-    "forceConsistentCasingInFileNames": true
-    /* Disallow inconsistently-cased references to the same file. */
+    "skipLibCheck": true,                           /* Skip type checking of declaration files. */
+    "forceConsistentCasingInFileNames": true        /* Disallow inconsistently-cased references to the same file. */
   }
 }

package/webpack.config.js

@@ -12,21 +12,34 @@ module.exports = {
     }
   },
   resolve: {
-    extensions: ['.wasm', '.mjs', '.js', '.json', '.ts', '.tsx'],
+    extensions: ['.ts', '.tsx', '.wasm', '.mjs', '.js', '.json'],
   },
   module: {
     rules: [
-      {test: /\.tsx?$/, loader: 'ts-loader'}
+      {
+        test: /\.ts(x?)$/,
+        use: 'ts-loader',
+        exclude: /node_modules/,
+      },
+      {
+        test: /\.css$/,
+        use: ['style-loader', 'css-loader'],
+        exclude: /node_modules/,
+      },
     ],
   },
-  devtool: 'inline-source-map',
+  devtool: 'source-map',
   externals: {
     'datagrok-api/dg': 'DG',
     'datagrok-api/grok': 'grok',
     'datagrok-api/ui': 'ui',
     // 'openchemlib/full.js': 'OCL',
     'rxjs': 'rxjs',
-    'rxjs/operators': 'rxjs.operators'
+    'rxjs/operators': 'rxjs.operators',
+    'cash-dom': '$',
+    'dayjs': 'dayjs',
+    'wu': 'wu',
+    'exceljs': 'ExcelJS',
   },
   output: {
     filename: '[name].js',

package/README.md

@@ -1,84 +0,0 @@
-# [Sequence Translator](https://public.datagrok.ai/apps/Sequencetranslator/)
-
-![Sequence Translator](img/Sequence%20Translator%20Axolabs.png)
-
-SequenceTranslator is a [package](https://datagrok.ai/help/develop/develop#packages) for
-the [Datagrok](https://datagrok.ai) platform, used to
-translate [oligonucleotide](https://en.wikipedia.org/wiki/Oligonucleotide)
-sequences
-between [different representations](https://github.com/datagrok-ai/public/tree/master/packages/SequenceTranslator#sequence-representations)
-.
-
-Presentation: https://www.youtube.com/watch?v=2xuxJjpjXi4&t=3783s
-
-Oligonucleotides are characterized by the sequence
-of [nucleotide modifications](https://github.com/datagrok-ai/public/tree/master/packages/SequenceTranslator#axolabs-nucleotide-modifications)
-that make up the entire molecule. The length of the oligonucleotide is usually 13-25 nucleotides long (denoted by "
--mer").
-
-Oligonucleotides are chemically synthesized. Chain assembly proceeds in the 3' to 5' direction by following a routine
-procedure referred to as a "synthetic cycle". Completion of a single synthetic cycle results in the addition of one
-nucleotide residue to the growing chain.
-
-# Use cases
-
-| Name |  Steps  |
-|---|---|
-| Translate one sequence of types list | Paste sequence into the text field in `MAIN` tab of App |
-| Translate many sequences of types list | 1. Open [SequenceTranslator](https://public.datagrok.ai/apps/Sequencetranslator/) <br/>2. Drag & drop an Excel or CSV file with sequences into Datagrok. The platform will detect columns with sequences if they match corresponding RegExp rules <br/>3. Right-click on the column header, then see the `Convert` menu <br/>4. Choose translation function <br/>This will add the result column to the right of the table|
-| Translate sequences using new Axolabs pattern | 1. Go to `AXOLABS` tab <br/>2. Drag & drop an Excel or CSV file with sequences into Datagrok <br/>3. Choose your table in the `Table` field <br/>4. Choose `SS Column`, and, if needed, `AS Column` and `ID Column`(needed to add column with concatenated ID and pattern name) <br/>5. Press `Convert Sequences` button  <br/>This will add the result column(s) to the right of the table. Save pattern, if needed|
-| Translate sequences using existing Axolabs pattern | 1. Go to `AXOLABS` tab <br/>2. Select your pattern in `Load Pattern` field <br/>3. Do steps #2-5 from previous use case |
-
-# Sequence representations
-
-In the modification section on the right side of the screen you can select modification for each base in your input
-sequence and check if PTO after the base is required.
-
-Representations are splitted into categories by synthesizer's sequence format(BioSpring/Axolabs/MerMade) and type of
-molecule (Gapmers / siRNA).
-
-| Name | Example | Regular expression |
-|---|---|---|
-| DNA nucleotides | `AGGTCTTCATGACTTCGGCC` | `^[ATGC]{10,}$` |
-| RNA nucleotides | `UUCAACUGCUUACGUCUUU` | `^[AUGC]{10,}$` |
-| BioSpring / Gapmers | `6*8*8*5*7*T*T*9*A*T*G*A*9*T*T*7*8*8*7*7` | `^[*56789ATGC]{30,}$` |
-| GCRS / Gapmers | `moeAnpsmoeGnpsmoeGnpsmoeUnpsmoe5mCnpsTpsTpsCpsApsTpsGpsApsCpsTpsTpsmoe5mCnpsmoeGnpsmoeGnpsmoe5mCnpsmoe5mC` | `^(?=.*moe)(?=.*5mC)(?=.*ps){30,}` |
-| BioSpring / siRNA | `5*1*766354715274575*5*5` | `^[*1-8]{30,}$` |
-| Axolabs / siRNA | `usUfscaaCfuGfcUfuAfcGfucususu` | `^[fsACGUacgu]{20,}$` |
-| GCRS | `mUpsfUpsmCmAmAfCmUfGmCfUmUfAmCfGmUmCmUpsmUpsmU` | `^[fmpsACGU]{30,}$` |
-| OP100 | `ug*aa*uu*ag*ag*ga*ga*cg*ga*cac` | `^[acgu*]{10,}$` |
-| MerMade (MM) | `kgKHKGLHIELGJFHKiehK` | `^[IiJjKkLlEeFfGgHhQq]{10,}$` |
-| Applied Biosystems Inc. (ABI) | `58877TTTACCACGT56788` | `^[5678ATGC]{10,}$` |
-
-# Axolabs nucleotide modifications
-
-| Name | Description | Symbols |
-|---|---|---|
-| `RNA` | RNA nucleotides | `A, C, G, U` |
-| `DNA` | DNA nucleotides | `dA, dC, dG, dT` |
-| `2'-Fluoro` | 2'-Fluoro nucleotides | `Af, Cf, Gf, Uf` |
-| `2'-O-Methyl` | 2'-O-Methyl nucleotides | `a, c, g, u` |
-| `2'-O-MOE` | 2'-O-MOE nucleotides (including 5-Methyl C) | `Am, Cm, Gm, Tm` |
-| `GNA` | Glycol nucleic acid | `(GNA-A), (GNA-C), (GNA-G), (GNA-T)` |
-| `LNA` | Locked nucleic acid (including 5-Methyl C) | `Ab, Cb, Gb, Tb` |
-| `UNA` | Unlocked nucleotides | `Ao, Co, Go, Uo` |
-| `A` | Adenine | `a` |
-| `C` | Cytosine | `c` |
-| `G` | Guanine | `g` |
-| `U` | Uracil | `u` |
-| `X-New` | | `X` |
-| `Y-New` | | `Y` |
-| `Z-New` | | `Z` |
-| `InvAbasic` | Inverted abasic capped | `(invabasic)` |
-| `5'-vinylps` | 5'-vinylphosphonate-2'-OMe-uridine | `(vinu)` |
-| `InvAbasic(o)` | Inverted abasic capped (overhang) | `(invabasic)` |
-| `2'-OMe-U(o)` | Nucleotide Uridine with 2’O-Methyl protection (overhang) | `mU` |
-
-# App glossary
-
-| Term |  Definition  |
-|---|---|
-| Pattern | Defines translation rules. Contains: pattern name, modifications and PTO linkages for both strands, and comment, displayed on image |
-| PTO linkage | Indicates whether oligonucleotide has phosphorothioated bond (ps linkage) after the base |
-| Sense strand (SS) | Contains the exact nucleotide sequence to the mRNA which encodes for a functional protein. Has the information that would be readable on the RNA, and that's called the coding side.|
-| Antisense strand (AS) | Non-coding DNA strand of a gene. A cell uses antisense DNA strand as a template for producing messenger RNA (mRNA) that directs the synthesis of a protein. |

package/css/style.css

@@ -1,18 +0,0 @@
-.inputSequence textarea {
-  resize: none;
-  min-height: 70px;
-  width: 100%;
-  font-family: monospace;
-}
-
-.inputSequence .input-base {
-  margin: '0';
-}
-
-.inputSequence select {
-  width: 100%;
-}
-
-.sequence .children {
-  padding: '5px 0';
-}

package/jest.config.js

@@ -1,33 +0,0 @@
-module.exports = {
-  "roots": [
-    "<rootDir>/src"
-  ],
-  "testMatch": [
-    "**/__jest__/**/*.test.+(ts|tsx)"
-  ],
-  moduleFileExtensions: [
-    'ts',
-    'js',
-  ],
-  "transform": {
-    "^.+\\.(ts|tsx)$": "ts-jest"
-  },
-  transformIgnorePatterns: ['^.+\\.js$'],
-  globals: {
-    'ts-jest': {
-      'tsconfig': {
-          "target": "es6",
-          "module": "es2020",
-      }
-    }
-  },
-  reporters: [
-    "default",
-    [
-      "./node_modules/jest-html-reporter",
-      {
-        "includeConsoleLog": true
-      }
-    ]
-  ]
-}

package/setup-unlink-clean.cmd

@@ -1,14 +0,0 @@
-set package_dir=%cd%
-
-set dirs=^
-\..\..\js-api\ ^
-\..\..\libraries\utils\ ^
-\..\..\libraries\bio\ ^
-\
-
-call npm uninstall -g datagrok-api @datagrok-libraries/utils @datagrok-libraries/bio
-
-for %%p in (%dirs%) do cd %package_dir%\%%p & rmdir /s /q node_modules
-for %%p in (%dirs%) do cd %package_dir%\%%p & rmdir /s /q dist
-
-rem for %%p in (%dirs%) do cd %package_dir%\%%p & del "package-lock.json"

package/setup-unlink-clean.sh

@@ -1,21 +0,0 @@
-#!/bin/bash
-package_dir=$(pwd)
-
-GREEN='\e[0;32m'
-NO_COLOR='\e[0m'
-
-dirs=(
-  "../../js-api/"
-  "../../libraries/utils/"
-  "../../libraries/bio/"
-)
-
-npm uninstall --location=global datagrok-api @datagrok-libraries/utils @datagrok-libraries/ml @datagrok-libraries/bio
-
-for dir in ${dirs[@]}; do
-  cd $package_dir
-  cd $dir 
-  echo -e $GREEN Removing node_modules and dist in $(pwd) $NO_COLOR
-  rm -rf node_modules dist
-  # rm package-lock.json
-done

package/setup.cmd

@@ -1,14 +0,0 @@
-call setup-unlink-clean.cmd
-
-set package_dir=%cd%
-
-set dirs=^
-\..\..\js-api\ ^
-\..\..\libraries\utils\ ^
-\..\..\libraries\bio\ ^
-\
-
-for %%p in (%dirs%) do cd %package_dir%\%%p & call npm install
-for %%p in (%dirs%) do cd %package_dir%\%%p & call npm link
-for %%p in (%dirs%) do cd %package_dir%\%%p & call npm run link-all
-for %%p in (%dirs%) do cd %package_dir%\%%p & call npm run build

package/setup.sh

@@ -1,37 +0,0 @@
-#!/bin/bash
-
-./setup-unlink-clean.sh
-
-GREEN='\e[0;32m'
-NO_COLOR='\e[0m'
-
-package_dir=$(pwd)
-
-dirs=(
-  "../../js-api/"
-  "../../libraries/utils/"
-  "../../libraries/bio/"
-)
-
-for dir in ${dirs[@]}; do
-  cd $package_dir
-  cd $dir 
-  echo -e $GREEN npm install in $(pwd) $NO_COLOR
-  npm install 
-  echo -e $GREEN npm link in $(pwd) $NO_COLOR
-  npm link
-done
-
-for dir in ${dirs[@]}; do
-  cd $package_dir
-  cd $dir 
-  if [ $dir != "../../js-api/" ]; then
-    echo -e $GREEN npm link-all in $(pwd) $NO_COLOR
-    npm run link-all
-  fi
-  echo -e $GREEN npm run build in$(pwd) $NO_COLOR
-  npm run build || exit
-done
-
-cd $package_dir
-npm run link-all

package/src/__jest__/remote.test.ts

@@ -1,77 +0,0 @@
-/**
- * @jest-environment jsdom
- */
-
-import * as utils from './test-node';
-import puppeteer from 'puppeteer';
-
-const P_START_TIMEOUT: number = 3600000;
-let browser: puppeteer.Browser;
-let page: puppeteer.Page;
-
-beforeAll(async () => {
-  let out = await utils.getBrowserPage(puppeteer);
-  browser = out.browser;
-  page = out.page;
-}, P_START_TIMEOUT);
-
-afterAll(async () => {
-  await browser?.close();
-});
-
-expect.extend({
-  checkOutput(received, expected, context) {
-    if (received === expected) {
-      return {
-        message: () => context,
-        pass: true
-      };
-    } else {
-      return {
-        message: () => context,
-        pass: false
-      };
-    }
-  }
-});
-
-it('TEST', async () => {
-  const targetPackage:string = process.env.TARGET_PACKAGE ?? 'SequenceTranslator';
-  console.log(`Testing ${targetPackage} package`);
-
-  let r = await page.evaluate((targetPackage):Promise<object> => {
-    return new Promise<object>((resolve, reject) => {
-      (<any>window).grok.functions.eval(targetPackage + ':test()').then((df: any) => {
-        const cStatus = df.columns.byName('success');
-        const cSkipped = df.columns.byName('skipped');
-        const cMessage = df.columns.byName('result');
-        const cCat = df.columns.byName('category');
-        const cName = df.columns.byName('name');
-        const cTime = df.columns.byName('ms');
-        let failed = false;
-        let skipReport = '';
-        let passReport = '';
-        let failReport = '';
-        for (let i = 0; i < df.rowCount; i++) {
-          if (cStatus.get(i)) {
-            if (cSkipped.get(i)) {
-              skipReport += `Test result : Skipped : ${cTime.get(i)} : ${targetPackage}.${cCat.get(i)}.${cName.get(i)} : ${cMessage.get(i)}\n`;
-            } else {
-              passReport += `Test result : Success : ${cTime.get(i)} : ${targetPackage}.${cCat.get(i)}.${cName.get(i)} : ${cMessage.get(i)}\n`;
-            }
-          } else {
-            failed = true;
-            failReport += `Test result : Failed : ${cTime.get(i)} : ${targetPackage}.${cCat.get(i)}.${cName.get(i)} : ${cMessage.get(i)}\n`;
-          }
-        }
-        resolve({failReport, skipReport, passReport, failed});
-      }).catch((e: any) => reject(e));
-    });
-  }, targetPackage);
-  // @ts-ignore
-  console.log(r.passReport);
-  // @ts-ignore
-  console.log(r.skipReport);
-  // @ts-ignore
-  expect(r.failed).checkOutput(false, r.failReport);
-}, 7200000);

package/src/__jest__/test-node.ts

@@ -1,97 +0,0 @@
-import * as path from "path";
-import * as os from "os";
-import * as fs from "fs";
-// @ts-ignore
-import * as yaml from 'js-yaml';
-const fetch = require('node-fetch');
-
-export async function getToken(url: string, key: string) {
-  let response = await fetch(`${url}/users/login/dev/${key}`, {method: 'POST'});
-  let json = await response.json();
-  if (json.isSuccess == true)
-    return json.token;
-  else
-    throw 'Unable to login to server. Check your dev key';
-}
-
-export async function getWebUrl(url: string, token: string) {
-  let response = await fetch(`${url}/admin/plugins/admin/settings`, {headers: {Authorization: token}});
-  let json = await response.json();
-  return json.settings.webRoot;
-}
-
-const grokDir = path.join(os.homedir(), '.grok');
-const confPath = path.join(grokDir, 'config.yaml');
-
-function mapURL(conf: Config): Indexable {
-  let urls: Indexable = {};
-  for (let server in conf.servers) {
-    urls[conf['servers'][server]['url']] = conf['servers'][server];
-  }
-  return urls;
-}
-
-export function getDevKey(hostKey: string): {url: string, key: string} {
-  let config = yaml.load(fs.readFileSync(confPath, 'utf8')) as any;
-  let host = hostKey == '' ? config.default : hostKey;
-  host = host.trim();
-  let urls = mapURL(config);
-  let key = '';
-  let url = '';
-  try {
-    let url = new URL(host).href;
-    if (url.endsWith('/')) url = url.slice(0, -1);
-    if (url in urls) key = config['servers'][urls[url]]['key'];
-  } catch (error) {
-    if (config['servers'][host] == null)
-      throw `Unknown server alias. Please add it to ${confPath}`;
-    url = config['servers'][host]['url'];
-    key = config['servers'][host]['key'];
-  }
-  return {url, key};
-}
-
-export async function getBrowserPage(puppeteer: any): Promise<{browser: any, page: any}> {
-  let url:string = process.env.HOST ?? '';
-  let cfg = getDevKey(url);
-  url = cfg.url;
-
-  let key = cfg.key;
-  let token = await getToken(url, key);
-  url = await getWebUrl(url, token);
-  console.log(`Using web root: ${url}`);
-
-  let browser = await puppeteer.launch({
-    args: ['--disable-dev-shm-usage', '--disable-features=site-per-process'],
-    ignoreHTTPSErrors: true,
-  });
-
-  let page = await browser.newPage();
-  await page.setDefaultNavigationTimeout(0);
-  await page.goto(`${url}/oauth/`);
-  await page.setCookie({name: 'auth', value: token});
-  await page.evaluate((token: any) => {
-    window.localStorage.setItem('auth', token);
-  }, token);
-  await page.goto(url);
-  try {
-//    await page.waitForSelector('.grok-preloader', { timeout: 1800000 });
-    await page.waitForFunction(() => document.querySelector('.grok-preloader') == null, {timeout: 3600000});
-  } catch (error) {
-    throw error;
-  }
-  return {browser, page};
-}
-
-
-interface Config {
-  servers: {
-    [alias: string]: {
-      url: string,
-      key: string
-    }
-  },
-  default: string,
-}
-
-interface Indexable { [key: string]: any }