@datagrok/sequence-translator 0.0.5 → 0.0.9

package/src/package.ts

@@ -5,216 +5,22 @@ import * as DG from 'datagrok-api/dg';
 import * as OCL from 'openchemlib/full.js';
 import $ from 'cash-dom';
 import {defineAxolabsPattern} from './defineAxolabsPattern';
-import {saveSenseAntiSense} from './save-sense-antisense';
-import {map, stadardPhosphateLinkSmiles, SYNTHESIZERS, TECHNOLOGIES, MODIFICATIONS} from './map';
+import {saveSenseAntiSense} from './structures-works/save-sense-antisense';
+import {sequenceToSmiles, sequenceToMolV3000} from './structures-works/from-monomers';
+import {convertSequence, undefinedInputSequence} from './structures-works/sequence-codes-tools';
+import {map, COL_NAMES, MODIFICATIONS} from './structures-works/map';
+import {SALTS_CSV} from './salts';
+import {USERS_CSV} from './users';
+import {ICDS} from './ICDs';
+import {SOURCES} from './sources';
+import {IDPS} from './IDPs';
 
 export const _package = new DG.Package();
 
 const defaultInput = 'AGGTCCTCTTGACTTAGGCC';
-const undefinedInputSequence = 'Type of input sequence is undefined';
-const noTranslationTableAvailable = 'No translation table available';
 const sequenceWasCopied = 'Copied';
 const tooltipSequence = 'Copy sequence';
 
-function getAllCodesOfSynthesizer(synthesizer: string): string[] {
-  let codes: string[] = [];
-  for (const technology of Object.keys(map[synthesizer]))
-    codes = codes.concat(Object.keys(map[synthesizer][technology]));
-  return codes.concat(Object.keys(MODIFICATIONS));
-}
-
-function getListOfPossibleSynthesizersByFirstMatchedCode(sequence: string): string[] {
-  const synthesizers: string[] = [];
-  Object.keys(map).forEach((synthesizer: string) => {
-    const codes = getAllCodesOfSynthesizer(synthesizer);
-    //TODO: get first non-dropdown code when there are two modifications
-    let start = 0;
-    for (let i = 0; i < sequence.length; i++) {
-      if (sequence[i] == ')') {
-        start = i + 1;
-        break;
-      }
-    }
-    if (codes.some((s: string) => s == sequence.slice(start, start + s.length)))
-      synthesizers.push(synthesizer);
-  });
-  return synthesizers;
-}
-
-function getListOfPossibleTechnologiesByFirstMatchedCode(sequence: string, synthesizer: string): string[] {
-  const technologies: string[] = [];
-  Object.keys(map[synthesizer]).forEach((technology: string) => {
-    const codes = Object.keys(map[synthesizer][technology]).concat(Object.keys(MODIFICATIONS));
-    if (codes.some((s) => s == sequence.slice(0, s.length)))
-      technologies.push(technology);
-  });
-  return technologies;
-}
-
-export function isValidSequence(sequence: string): {
-  indexOfFirstNotValidCharacter: number,
-  expectedSynthesizer: string | null,
-  expectedTechnology: string | null
-} {
-  const possibleSynthesizers = getListOfPossibleSynthesizersByFirstMatchedCode(sequence);
-  if (possibleSynthesizers.length == 0)
-    return {indexOfFirstNotValidCharacter: 0, expectedSynthesizer: null, expectedTechnology: null};
-
-  let outputIndices = Array(possibleSynthesizers.length).fill(0);
-
-  const firstUniqueCharacters = ['r', 'd'];
-  const nucleotides = ['A', 'U', 'T', 'C', 'G'];
-
-  possibleSynthesizers.forEach((synthesizer, synthesizerIndex) => {
-    const codes = getAllCodesOfSynthesizer(synthesizer);
-    while (outputIndices[synthesizerIndex] < sequence.length) {
-      const matchedCode = codes
-        .find((c) => c == sequence.slice(outputIndices[synthesizerIndex], outputIndices[synthesizerIndex] + c.length));
-
-      if (matchedCode == null)
-        break;
-
-      if ( // for mistake pattern 'rAA'
-        outputIndices[synthesizerIndex] > 1 &&
-        nucleotides.includes(sequence[outputIndices[synthesizerIndex]]) &&
-        firstUniqueCharacters.includes(sequence[outputIndices[synthesizerIndex] - 2])
-      ) break;
-
-      if ( // for mistake pattern 'ArA'
-        firstUniqueCharacters.includes(sequence[outputIndices[synthesizerIndex] + 1]) &&
-        nucleotides.includes(sequence[outputIndices[synthesizerIndex]])
-      ) {
-        outputIndices[synthesizerIndex]++;
-        break;
-      }
-
-      outputIndices[synthesizerIndex] += matchedCode.length;
-    }
-  });
-
-  const indexOfExpectedSythesizer = Math.max.apply(Math, outputIndices);
-  const indexOfFirstNotValidCharacter = (indexOfExpectedSythesizer == sequence.length) ? -1 : indexOfExpectedSythesizer;
-  const expectedSynthesizer = possibleSynthesizers[outputIndices.indexOf(indexOfExpectedSythesizer)];
-  if (indexOfFirstNotValidCharacter != -1)
-    return {
-      indexOfFirstNotValidCharacter: indexOfFirstNotValidCharacter,
-      expectedSynthesizer: expectedSynthesizer,
-      expectedTechnology: null
-    };
-
-  let possibleTechnologies = getListOfPossibleTechnologiesByFirstMatchedCode(sequence, expectedSynthesizer);
-  if (possibleTechnologies.length == 0)
-    return { indexOfFirstNotValidCharacter: 0, expectedSynthesizer: null, expectedTechnology: null };
-
-  outputIndices = Array(possibleTechnologies.length).fill(0);
-
-  possibleTechnologies.forEach((technology: string, technologyIndex: number) => {
-    let codes = Object.keys(map[expectedSynthesizer][technology]);
-    while (outputIndices[technologyIndex] < sequence.length) {
-
-      let matchedCode = codes
-        .find((c) => c == sequence.slice(outputIndices[technologyIndex], outputIndices[technologyIndex] + c.length));
-
-      if (matchedCode == null)
-        break;
-
-      if ( // for mistake pattern 'rAA'
-        outputIndices[technologyIndex] > 1 &&
-        nucleotides.includes(sequence[outputIndices[technologyIndex]]) &&
-        firstUniqueCharacters.includes(sequence[outputIndices[technologyIndex] - 2])
-      ) break;
-
-      if (  // for mistake pattern 'ArA'
-        firstUniqueCharacters.includes(sequence[outputIndices[technologyIndex] + 1]) &&
-        nucleotides.includes(sequence[outputIndices[technologyIndex]])
-      ) {
-        outputIndices[technologyIndex]++;
-        break;
-      }
-
-      outputIndices[technologyIndex] += matchedCode.length;
-    }
-  });
-
-  const indexOfExpectedTechnology = Math.max.apply(Math, outputIndices);
-  const expectedTechnology = possibleTechnologies[outputIndices.indexOf(indexOfExpectedTechnology)];
-
-  return {
-    indexOfFirstNotValidCharacter: indexOfFirstNotValidCharacter,
-    expectedSynthesizer: expectedSynthesizer,
-    expectedTechnology: expectedTechnology
-  };
-}
-
-function sortByStringLengthInDescendingOrder(array: string[]): string[] {
-  return array.sort(function(a: string, b: string) { return b.length - a.length; });
-}
-
-function getObjectWithCodesAndSmiles(sequence: string) {
-  const obj: { [code: string]: string } = {};
-  for (const synthesizer of Object.keys(map))
-    for (const technology of Object.keys(map[synthesizer]))
-      for (let code of Object.keys(map[synthesizer][technology]))
-        obj[code] = map[synthesizer][technology][code].SMILES;
-  // TODO: create object based from synthesizer type to avoid key(codes) duplicates
-  const output = isValidSequence(sequence);
-  if (output.expectedSynthesizer == SYNTHESIZERS.MERMADE_12)
-    obj['g'] = map[SYNTHESIZERS.MERMADE_12][TECHNOLOGIES.SI_RNA]['g'].SMILES;
-  else if (output.expectedSynthesizer == SYNTHESIZERS.AXOLABS)
-    obj['g'] = map[SYNTHESIZERS.AXOLABS][TECHNOLOGIES.SI_RNA]['g'].SMILES;
-  return obj;
-}
-
-export function sequenceToSmiles(sequence: string, inverted: boolean = false): string {
-  const obj = getObjectWithCodesAndSmiles(sequence);
-  let codes = sortByStringLengthInDescendingOrder(Object.keys(obj));
-  let i = 0;
-  let smiles = '';
-  const codesList = [];
-  const links = ['s', 'ps', '*'];
-  const includesStandardLinkAlready = ['e', 'h', /*'g',*/ 'f', 'i', 'l', 'k', 'j'];
-  const dropdowns = Object.keys(MODIFICATIONS);
-  codes = codes.concat(dropdowns);
-  while (i < sequence.length) {
-    const code = codes.find((s: string) => s == sequence.slice(i, i + s.length))!;
-    i += code.length;
-    inverted ? codesList.unshift(code) : codesList.push(code);
-  }
-  for (let i = 0; i < codesList.length; i++) {
-    if (dropdowns.includes(codesList[i])) {
-      if (i == codesList.length -1 || (i < codesList.length - 1 && links.includes(codesList[i + 1]))) {
-        smiles += (i >= codesList.length / 2) ?
-          MODIFICATIONS[codesList[i]].right:
-          MODIFICATIONS[codesList[i]].left;
-      } else if (i < codesList.length - 1) {
-        smiles += (i >= codesList.length / 2) ?
-          MODIFICATIONS[codesList[i]].right + stadardPhosphateLinkSmiles:
-          MODIFICATIONS[codesList[i]].left + stadardPhosphateLinkSmiles;
-      }
-    } else {
-      if (links.includes(codesList[i]) ||
-        includesStandardLinkAlready.includes(codesList[i]) ||
-        (i < codesList.length - 1 && links.includes(codesList[i + 1]))
-      )
-        smiles += obj[codesList[i]];
-      else
-        smiles += obj[codesList[i]] + stadardPhosphateLinkSmiles;
-    }
-  }
-  smiles = smiles.replace(/OO/g, 'O');
-  return (
-    (
-      links.includes(codesList[codesList.length - 1]) &&
-      codesList.length > 1 &&
-      !includesStandardLinkAlready.includes(codesList[codesList.length - 2])
-    ) ||
-    dropdowns.includes(codesList[codesList.length - 1]) ||
-    includesStandardLinkAlready.includes(codesList[codesList.length - 1])
-  ) ?
-    smiles :
-    smiles.slice(0, smiles.length - stadardPhosphateLinkSmiles.length + 1);
-}
-
 //name: Sequence Translator
 //tags: app
 export function sequenceTranslator(): void {
@@ -233,11 +39,11 @@ export function sequenceTranslator(): void {
       const tableRows = [];
 
       for (const key of Object.keys(outputSequenceObj).slice(1)) {
-        let indexOfFirstNotValidCharacter = ('indexOfFirstNotValidCharacter' in outputSequenceObj) ?
+        const indexOfFirstNotValidCharacter = ('indexOfFirstNotValidCharacter' in outputSequenceObj) ?
           JSON.parse(outputSequenceObj.indexOfFirstNotValidCharacter!).indexOfFirstNotValidCharacter :
           -1;
         if ('indexOfFirstNotValidCharacter' in outputSequenceObj) {
-          let indexOfFirstNotValidCharacter = ('indexOfFirstNotValidCharacter' in outputSequenceObj) ?
+          const indexOfFirstNotValidCharacter = ('indexOfFirstNotValidCharacter' in outputSequenceObj) ?
             JSON.parse(outputSequenceObj.indexOfFirstNotValidCharacter!).indexOfFirstNotValidCharacter :
             -1;
           if (indexOfFirstNotValidCharacter != -1)
@@ -251,54 +57,54 @@ export function sequenceTranslator(): void {
               ui.divText(sequence.slice(0, indexOfFirstNotValidCharacter), {style: {color: 'grey'}}),
               ui.tooltip.bind(
                 ui.divText(sequence.slice(indexOfFirstNotValidCharacter), {style: {color: 'red'}}),
-                'Expected format: ' + JSON.parse(outputSequenceObj.indexOfFirstNotValidCharacter!).expectedSynthesizer + '. See tables with valid codes on the right'
+                'Expected format: ' + JSON.parse(outputSequenceObj.indexOfFirstNotValidCharacter!).expectedSynthesizer +
+                '. See tables with valid codes on the right',
               ),
             ]) : //@ts-ignore
-            ui.link(outputSequenceObj[key], () => navigator.clipboard.writeText(outputSequenceObj[key]).then(() => grok.shell.info(sequenceWasCopied)), tooltipSequence, '')
+            ui.link(outputSequenceObj[key], () => navigator.clipboard.writeText(outputSequenceObj[key])
+              .then(() => grok.shell.info(sequenceWasCopied)), tooltipSequence, ''),
         });
       }
 
       if (errorsExist) {
-        const expectedSynthesizer = JSON.parse(outputSequenceObj.indexOfFirstNotValidCharacter!).expectedSynthesizer.slice(0, -6);
-        asoGapmersGrid.onCellPrepare(function (gc) {
+        const expectedSynthesizer = JSON.parse(outputSequenceObj.indexOfFirstNotValidCharacter!)
+          .expectedSynthesizer.slice(0, -6);
+        asoGapmersGrid.onCellPrepare(function(gc) {
           gc.style.backColor = (gc.gridColumn.name == expectedSynthesizer) ? 0xFFF00000 : 0xFFFFFFFF;
         });
-        omeAndFluoroGrid.onCellPrepare(function (gc) {
+        omeAndFluoroGrid.onCellPrepare(function(gc) {
           gc.style.backColor = (gc.gridColumn.name == expectedSynthesizer) ? 0xFFF00000 : 0xFFFFFFFF;
         });
         switchInput.enabled = true;
       } else {
-        asoGapmersGrid.onCellPrepare(function (gc) {
-          gc.style.backColor = 0xFFFFFFFF;
-        });
-        omeAndFluoroGrid.onCellPrepare(function (gc) {
-          gc.style.backColor = 0xFFFFFFFF;
-        });
+        asoGapmersGrid.onCellPrepare(function(gc) {gc.style.backColor = 0xFFFFFFFF;});
+        omeAndFluoroGrid.onCellPrepare(function(gc) {gc.style.backColor = 0xFFFFFFFF;});
       }
 
       outputTableDiv.append(
         ui.div([
-          DG.HtmlTable.create(tableRows, (item: { key: string; value: string; }) => [item.key, item.value], ['Code', 'Sequence']).root
-        ], 'table')
+          DG.HtmlTable.create(tableRows, (item: { key: string; value: string; }) =>
+            [item.key, item.value], ['Code', 'Sequence']).root,
+        ], 'table'),
       );
       semTypeOfInputSequence.textContent = 'Detected input type: ' + outputSequenceObj.type;
 
       if (outputSequenceObj.type != undefinedInputSequence && outputSequenceObj.Error != undefinedInputSequence) {
-        let canvas = ui.canvas(300, 170);
-        canvas.addEventListener("click", () => {
-          let canv = ui.canvas($(window).width(), $(window).height());
-          const smiles = sequenceToSmiles(inputSequenceField.value.replace(/\s/g, ''));
+        const canvas = ui.canvas(300, 170);
+        canvas.addEventListener('click', () => {
+          const canv = ui.canvas($(window).width(), $(window).height());
+          const mol = sequenceToMolV3000(inputSequenceField.value.replace(/\s/g, ''), false, true);
           // @ts-ignore
-          OCL.StructureView.drawMolecule(canv, OCL.Molecule.fromSmiles(smiles), { suppressChiralText: true });
-          ui.dialog('Molecule')
+          OCL.StructureView.drawMolecule(canv, OCL.Molecule.fromMolfile(mol), {suppressChiralText: true});
+          ui.dialog('Molecule: ' + inputSequenceField.value)
             .add(canv)
             .showModal(true);
         });
         $(canvas).on('mouseover', () => $(canvas).css('cursor', 'zoom-in'));
         $(canvas).on('mouseout', () => $(canvas).css('cursor', 'default'));
-        const smiles = sequenceToSmiles(inputSequenceField.value.replace(/\s/g, ''));
+        const mol = sequenceToMolV3000(inputSequenceField.value.replace(/\s/g, ''), false, true);
         // @ts-ignore
-        OCL.StructureView.drawMolecule(canvas, OCL.Molecule.fromSmiles(smiles), { suppressChiralText: true });
+        OCL.StructureView.drawMolecule(canvas, OCL.Molecule.fromMolfile(mol), {suppressChiralText: true});
         moleculeSvgDiv.append(canvas);
       } else
         moleculeSvgDiv.innerHTML = '';
@@ -313,69 +119,66 @@ export function sequenceTranslator(): void {
   const inputSequenceField = ui.textInput('', defaultInput, (sequence: string) => updateTableAndMolecule(sequence));
 
   const asoDf = DG.DataFrame.fromObjects([
-    { Name: "2'MOE-5Me-rU", BioSpring: "5", "Janssen GCRS": "moeT" },
-    { Name: "2'MOE-rA", BioSpring: "6", "Janssen GCRS": "moeA" },
-    { Name: "2'MOE-5Me-rC", BioSpring: "7", "Janssen GCRS": "moe5mC" },
-    { Name: "2'MOE-rG", BioSpring: "8", "Janssen GCRS": "moeG" },
-    { Name: "5-Methyl-dC", BioSpring: "9", "Janssen GCRS": "5mC" },
-    { Name: "ps linkage", BioSpring: "*", "Janssen GCRS": "ps" },
-    { Name: "dA", BioSpring: "A", "Janssen GCRS": "A, dA" },
-    { Name: "dC", BioSpring: "C", "Janssen GCRS": "C, dC" },
-    { Name: "dG", BioSpring: "G", "Janssen GCRS": "G, dG" },
-    { Name: "dT", BioSpring: "T", "Janssen GCRS": "T, dT" },
-    { Name: "rA", BioSpring: "", "Janssen GCRS": "rA" },
-    { Name: "rC", BioSpring: "", "Janssen GCRS": "rC" },
-    { Name: "rG", BioSpring: "", "Janssen GCRS": "rG" },
-    { Name: "rU", BioSpring: "", "Janssen GCRS": "rU" }
+    {'Name': '2\'MOE-5Me-rU', 'BioSpring': '5', 'Janssen GCRS': 'moeT'},
+    {'Name': '2\'MOE-rA', 'BioSpring': '6', 'Janssen GCRS': 'moeA'},
+    {'Name': '2\'MOE-5Me-rC', 'BioSpring': '7', 'Janssen GCRS': 'moe5mC'},
+    {'Name': '2\'MOE-rG', 'BioSpring': '8', 'Janssen GCRS': 'moeG'},
+    {'Name': '5-Methyl-dC', 'BioSpring': '9', 'Janssen GCRS': '5mC'},
+    {'Name': 'ps linkage', 'BioSpring': '*', 'Janssen GCRS': 'ps'},
+    {'Name': 'dA', 'BioSpring': 'A', 'Janssen GCRS': 'A, dA'},
+    {'Name': 'dC', 'BioSpring': 'C', 'Janssen GCRS': 'C, dC'},
+    {'Name': 'dG', 'BioSpring': 'G', 'Janssen GCRS': 'G, dG'},
+    {'Name': 'dT', 'BioSpring': 'T', 'Janssen GCRS': 'T, dT'},
+    {'Name': 'rA', 'BioSpring': '', 'Janssen GCRS': 'rA'},
+    {'Name': 'rC', 'BioSpring': '', 'Janssen GCRS': 'rC'},
+    {'Name': 'rG', 'BioSpring': '', 'Janssen GCRS': 'rG'},
+    {'Name': 'rU', 'BioSpring': '', 'Janssen GCRS': 'rU'},
   ])!;
-  const asoGapmersGrid = DG.Viewer.grid(
-    asoDf, { showRowHeader: false, showCellTooltip: false }
-  );
+  const asoGapmersGrid = DG.Viewer.grid(asoDf, {showRowHeader: false, showCellTooltip: false});
 
   asoDf.onCurrentCellChanged.subscribe((_) => {
-    navigator.clipboard.writeText(asoDf.currentCell.value).then(() => grok.shell.info('Copied'))
+    navigator.clipboard.writeText(asoDf.currentCell.value).then(() => grok.shell.info('Copied'));
   });
 
-  let omeAndFluoroGrid = DG.Viewer.grid(
+  const omeAndFluoroGrid = DG.Viewer.grid(
     DG.DataFrame.fromObjects([
-      { Name: "2'-fluoro-U", BioSpring: "1", Axolabs: "Uf", "Janssen GCRS": "fU" },
-      { Name: "2'-fluoro-A", BioSpring: "2", Axolabs: "Af", "Janssen GCRS": "fA" },
-      { Name: "2'-fluoro-C", BioSpring: "3", Axolabs: "Cf", "Janssen GCRS": "fC" },
-      { Name: "2'-fluoro-G", BioSpring: "4", Axolabs: "Gf", "Janssen GCRS": "fG" },
-      { Name: "2'OMe-rU", BioSpring: "5", Axolabs: "u", "Janssen GCRS": "mU" },
-      { Name: "2'OMe-rA", BioSpring: "6", Axolabs: "a", "Janssen GCRS": "mA" },
-      { Name: "2'OMe-rC", BioSpring: "7", Axolabs: "c", "Janssen GCRS": "mC" },
-      { Name: "2'OMe-rG", BioSpring: "8", Axolabs: "g", "Janssen GCRS": "mG" },
-      { Name: "ps linkage", BioSpring: "*", Axolabs: "s", "Janssen GCRS": "ps" }
-    ])!, { showRowHeader: false, showCellTooltip: false }
+      {'Name': '2\'-fluoro-U', 'BioSpring': '1', 'Axolabs': 'Uf', 'Janssen GCRS': 'fU'},
+      {'Name': '2\'-fluoro-A', 'BioSpring': '2', 'Axolabs': 'Af', 'Janssen GCRS': 'fA'},
+      {'Name': '2\'-fluoro-C', 'BioSpring': '3', 'Axolabs': 'Cf', 'Janssen GCRS': 'fC'},
+      {'Name': '2\'-fluoro-G', 'BioSpring': '4', 'Axolabs': 'Gf', 'Janssen GCRS': 'fG'},
+      {'Name': '2\'OMe-rU', 'BioSpring': '5', 'Axolabs': 'u', 'Janssen GCRS': 'mU'},
+      {'Name': '2\'OMe-rA', 'BioSpring': '6', 'Axolabs': 'a', 'Janssen GCRS': 'mA'},
+      {'Name': '2\'OMe-rC', 'BioSpring': '7', 'Axolabs': 'c', 'Janssen GCRS': 'mC'},
+      {'Name': '2\'OMe-rG', 'BioSpring': '8', 'Axolabs': 'g', 'Janssen GCRS': 'mG'},
+      {'Name': 'ps linkage', 'BioSpring': '*', 'Axolabs': 's', 'Janssen GCRS': 'ps'},
+    ])!, {showRowHeader: false, showCellTooltip: false},
   );
 
   const overhangModificationsGrid = DG.Viewer.grid(
     DG.DataFrame.fromObjects([
-      { Name: "(invabasic)" },
-      { Name: "(GalNAc-2-JNJ)" }
-    ])!, { showRowHeader: false, showCellTooltip: false }
+      {'Name': '(invabasic)'},
+      {'Name': '(GalNAc-2-JNJ)'},
+    ])!, {showRowHeader: false, showCellTooltip: false},
   );
   updateTableAndMolecule(defaultInput);
 
   const appMainDescription = ui.info([
-      ui.divText('How to convert one sequence:',{style:{'font-weight':'bolder'}}),
-      ui.divText('Paste sequence into the text field below'),
-      ui.divText('\n How to convert many sequences:',{style:{'font-weight':'bolder'}}),
-      ui.divText('1. Drag & drop an Excel or CSV file with sequences into Datagrok. The platform will automatically detect columns with sequences'),
-      ui.divText('2. Right-click on the column header, then see the \'Convert\' menu'),
-      ui.divText('This will add the result column to the right of the table'),
-    ], 'Convert oligonucleotide sequences between Nucleotides, BioSpring, Axolabs, Mermade 12 and GCRS representations.'
-  );
+    ui.divText('How to convert one sequence:', {style: {'font-weight': 'bolder'}}),
+    ui.divText('Paste sequence into the text field below'),
+    ui.divText('\n How to convert many sequences:', {style: {'font-weight': 'bolder'}}),
+    ui.divText('1. Drag & drop an Excel or CSV file with sequences into Datagrok'),
+    ui.divText('2. Right-click on the column header, then see the \'Convert\' menu'),
+    ui.divText('This will add the result column to the right of the table'),
+  ], 'Convert oligonucleotide sequences between Nucleotides, BioSpring, Axolabs, Mermade 12 and GCRS representations.');
 
   const codesTablesDiv = ui.splitV([
-    ui.box(ui.h2('ASO Gapmers'), { style: {maxHeight: '40px'} }),
+    ui.box(ui.h2('ASO Gapmers'), {style: {maxHeight: '40px'}}),
     asoGapmersGrid.root,
-    ui.box(ui.h2("2'-OMe and 2'-F siRNA"), { style: {maxHeight: '40px'} }),
+    ui.box(ui.h2('2\'-OMe and 2\'-F siRNA'), {style: {maxHeight: '40px'}}),
     omeAndFluoroGrid.root,
-    ui.box(ui.h2('Overhang modifications'), { style: {maxHeight: '40px'} }),
-    overhangModificationsGrid.root
-  ], { style: { maxWidth: '350px' } });
+    ui.box(ui.h2('Overhang modifications'), {style: {maxHeight: '40px'}}),
+    overhangModificationsGrid.root,
+  ], {style: {maxWidth: '350px'}});
 
   const tabControl = ui.tabControl({
     'MAIN': ui.box(
@@ -404,18 +207,17 @@ export function sequenceTranslator(): void {
     'SDF': saveSenseAntiSense(),
   });
 
-  let v = grok.shell.newView('Sequence Translator', [tabControl]);
+  const v = grok.shell.newView('Sequence Translator', [tabControl]);
   v.box = true;
 
   const switchInput = ui.switchInput('Codes', true, (v: boolean) => (v) ?
     $(codesTablesDiv).show() :
-    $(codesTablesDiv).hide()
+    $(codesTablesDiv).hide(),
   );
 
   const topPanel = [
     ui.iconFA('download', () => {
-      const smiles = sequenceToSmiles(inputSequenceField.value.replace(/\s/g, ''));
-      const result = `${OCL.Molecule.fromSmiles(smiles).toMolfile()}\n`;
+      const result = sequenceToMolV3000(inputSequenceField.value.replace(/\s/g, ''));
       const element = document.createElement('a');
       element.setAttribute('href', 'data:text/plain;charset=utf-8,' + encodeURIComponent(result));
       element.setAttribute('download', inputSequenceField.value.replace(/\s/g, '') + '.mol');
@@ -433,464 +235,153 @@ export function sequenceTranslator(): void {
   v.setRibbonPanels([topPanel]);
 
   $('.sequence')
-    .children().css('padding','5px 0');
+    .children().css('padding', '5px 0');
   $('.sequenceInput .input-base')
-    .css('margin','0');
+    .css('margin', '0');
   $('.sequenceInput textarea')
-    .css('resize','none')
-    .css('min-height','50px')
-    .css('width','100%')
+    .css('resize', 'none')
+    .css('min-height', '50px')
+    .css('width', '100%')
     .attr('spellcheck', 'false');
   $('.sequenceInput select')
-    .css('width','100%');
-}
-
-function convertSequence(text: string) {
-  text = text.replace(/\s/g, '');
-  let seq = text;
-  let output = isValidSequence(seq);
-  if (output.indexOfFirstNotValidCharacter != -1)
-    return {
-      // type: '',
-      indexOfFirstNotValidCharacter: JSON.stringify(output),
-      Error: undefinedInputSequence
-    };
-  if (output.expectedSynthesizer == SYNTHESIZERS.RAW_NUCLEOTIDES && output.expectedTechnology == TECHNOLOGIES.DNA)
-    return {
-      type: SYNTHESIZERS.RAW_NUCLEOTIDES + ' ' +  TECHNOLOGIES.DNA,
-      Nucleotides: seq,
-      BioSpring: asoGapmersNucleotidesToBioSpring(seq),
-      GCRS: asoGapmersNucleotidesToGcrs(seq)
-    };
-  if (output.expectedSynthesizer == SYNTHESIZERS.BIOSPRING && output.expectedTechnology == TECHNOLOGIES.ASO_GAPMERS)
-    return {
-      type: SYNTHESIZERS.BIOSPRING + ' ' +  TECHNOLOGIES.ASO_GAPMERS,
-      Nucleotides: asoGapmersBioSpringToNucleotides(seq),
-      BioSpring: seq,
-      GCRS: asoGapmersBioSpringToGcrs(seq)
-    };
-  if (output.expectedSynthesizer == SYNTHESIZERS.GCRS && output.expectedTechnology == TECHNOLOGIES.ASO_GAPMERS)
-    return {
-      type: SYNTHESIZERS.GCRS + ' ' +  TECHNOLOGIES.ASO_GAPMERS,
-      Nucleotides: asoGapmersGcrsToNucleotides(seq),
-      BioSpring: asoGapmersGcrsToBioSpring(seq),
-      Mermade12: gcrsToMermade12(seq),
-      GCRS: seq
-    };
-  if (output.expectedSynthesizer == SYNTHESIZERS.RAW_NUCLEOTIDES && output.expectedTechnology == TECHNOLOGIES.RNA)
-    return {
-      type: SYNTHESIZERS.RAW_NUCLEOTIDES + ' ' +  TECHNOLOGIES.RNA,
-      Nucleotides: seq,
-      BioSpring: siRnaNucleotideToBioSpringSenseStrand(seq),
-      Axolabs: siRnaNucleotideToAxolabsSenseStrand(seq),
-      GCRS: siRnaNucleotidesToGcrs(seq)
-    };
-  if (output.expectedSynthesizer == SYNTHESIZERS.BIOSPRING && output.expectedTechnology == TECHNOLOGIES.SI_RNA)
-    return {
-      type: SYNTHESIZERS.BIOSPRING + ' ' + TECHNOLOGIES.SI_RNA,
-      Nucleotides: siRnaBioSpringToNucleotides(seq),
-      BioSpring: seq,
-      Axolabs: siRnaBioSpringToAxolabs(seq),
-      GCRS: siRnaBioSpringToGcrs(seq)
-    };
-  if (output.expectedSynthesizer == SYNTHESIZERS.AXOLABS && output.expectedTechnology == TECHNOLOGIES.SI_RNA)
-    return {
-      type: SYNTHESIZERS.AXOLABS + ' ' + TECHNOLOGIES.SI_RNA,
-      Nucleotides: siRnaAxolabsToNucleotides(seq),
-      BioSpring: siRnaAxolabsToBioSpring(seq),
-      Axolabs: seq,
-      GCRS: siRnaAxolabsToGcrs(seq)
-    };
-  if (output.expectedSynthesizer == SYNTHESIZERS.GCRS && output.expectedTechnology == TECHNOLOGIES.SI_RNA)
-    return {
-      type: SYNTHESIZERS.GCRS + ' ' + TECHNOLOGIES.SI_RNA,
-      Nucleotides: siRnaGcrsToNucleotides(seq),
-      BioSpring: siRnaGcrsToBioSpring(seq),
-      Axolabs: siRnaGcrsToAxolabs(seq),
-      MM12: gcrsToMermade12(seq),
-      GCRS: seq
-    };
-  if (output.expectedSynthesizer == SYNTHESIZERS.GCRS)
-    return {
-      type: SYNTHESIZERS.GCRS,
-      Nucleotides: gcrsToNucleotides(seq),
-      GCRS: seq,
-      Mermade12: gcrsToMermade12(seq)
-    }
-  if (output.expectedSynthesizer == SYNTHESIZERS.MERMADE_12)
-    return {
-      type: SYNTHESIZERS.MERMADE_12,
-      Nucleotides: noTranslationTableAvailable,
-      GCRS: noTranslationTableAvailable,
-      Mermade12: seq
-    };
-  return {
-    type: undefinedInputSequence,
-    Nucleotides: undefinedInputSequence
-  };
-}
-
-//name: asoGapmersNucleotidesToBioSpring
-//input: string nucleotides {semType: DNA nucleotides}
-//output: string result {semType: BioSpring / Gapmers}
-export function asoGapmersNucleotidesToBioSpring(nucleotides: string): string {
-  let count: number = -1;
-  const objForEdges: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'T': '5*', 'A': '6*', 'C': '7*', 'G': '8*'};
-  const objForCenter: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'T': 'T*', 'A': 'A*', 'C': '9*', 'G': 'G*'};
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|A|T|C|G)/g, function (x: string) {
-    count++;
-    return (count > 4 && count < 15) ? objForCenter[x] : objForEdges[x];
-  }).slice(0, (nucleotides.endsWith('(invabasic)') || nucleotides.endsWith('(GalNAc-2-JNJ)')) ? nucleotides.length : 2 * count + 1);
-}
-
-//name: asoGapmersNucleotidesToGcrs
-//input: string nucleotides {semType: DNA nucleotides}
-//output: string result {semType: GCRS / Gapmers}
-export function asoGapmersNucleotidesToGcrs(nucleotides: string): string {
-  let count: number = -1;
-  const objForEdges: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'T': 'moeUnps', 'A': 'moeAnps', 'C': 'moe5mCnps', 'G': 'moeGnps'};
-  const objForCenter: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'C': '5mCps', 'A': 'Aps', 'T': 'Tps', 'G': 'Gps'};
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|A|T|C|G)/g, function (x: string) {
-    count++;
-    if (count < 5) return (count == 4) ? objForEdges[x].slice(0, -3) + 'ps' : objForEdges[x];
-    if (count < 15) return (count == 14) ? objForCenter[x].slice(0, -2) + 'nps' : objForCenter[x];
-    return objForEdges[x];
-  }).slice(0, (nucleotides.endsWith('(invabasic)') || nucleotides.endsWith('(GalNAc-2-JNJ)')) ? nucleotides.length : -3);
-}
-
-//name: asoGapmersBioSpringToNucleotides
-//input: string nucleotides {semType: BioSpring / Gapmers}
-//output: string result {semType: DNA nucleotides}
-export function asoGapmersBioSpringToNucleotides(nucleotides: string): string {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', '*': '', '5': 'T', '6': 'A', '7': 'C', '8': 'G', '9': 'C'};
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|\*|5|6|7|8|9)/g, function (x: string) {return obj[x];});
-}
-
-//name: asoGapmersBioSpringToGcrs
-//input: string nucleotides {semType: BioSpring / Gapmers}
-//output: string result {semType: GCRS / Gapmers}
-export function asoGapmersBioSpringToGcrs(nucleotides: string): string {
-  let count: number = -1;
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)',
-    '5*': 'moeUnps', '6*': 'moeAnps', '7*': 'moe5mCnps', '8*': 'moeGnps', '9*': '5mCps', 'A*': 'Aps', 'T*': 'Tps',
-    'G*': 'Gps', 'C*': 'Cps', '5': 'moeU', '6': 'moeA', '7': 'moe5mC', '8': 'moeG'
-  };
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|5\*|6\*|7\*|8\*|9\*|A\*|T\*|G\*|C\*|5|6|7|8)/g, function (x: string) {
-    count++;
-    return (count == 4) ? obj[x].slice(0, -3) + 'ps' : (count == 14) ? obj[x].slice(0, -2) + 'nps' : obj[x];
-  });
-}
-
-//name: asoGapmersGcrsToBioSpring
-//input: string nucleotides {semType: GCRS / Gapmers}
-//output: string result {semType: BioSpring / Gapmers}
-export function asoGapmersGcrsToBioSpring(nucleotides: string): string {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)',
-    'moeT': '5', 'moeA': '6', 'moe5mC': '7', 'moeG': '8', 'moeU': '5', '5mC': '9', 'nps': '*', 'ps': '*', 'U': 'T'
-  };
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|moeT|moeA|moe5mC|moeG|moeU|5mC|nps|ps|U)/g, function (x: string) {return obj[x];});
-}
-
-//name: asoGapmersGcrsToNucleotides
-//input: string nucleotides {semType: GCRS / Gapmers}
-//output: string result {semType: DNA nucleotides}
-export function asoGapmersGcrsToNucleotides(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'moe': '', '5m': '', 'n': '', 'ps': '', 'U': 'T'};
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|moe|5m|n|ps|U)/g, function (x: string) {return obj[x];});
-}
-
-//name: siRnaBioSpringToNucleotides
-//input: string nucleotides {semType: BioSpring / siRNA}
-//output: string result {semType: RNA nucleotides}
-export function siRnaBioSpringToNucleotides(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', '1': 'U', '2': 'A', '3': 'C', '4': 'G', '5': 'U', '6': 'A', '7': 'C', '8': 'G', '*': ''};
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|1|2|3|4|5|6|7|8|\*)/g, function (x: string) {return obj[x];});
-}
-
-//name: siRnaBioSpringToAxolabs
-//input: string nucleotides {semType: BioSpring / siRNA}
-//output: string result {semType: Axolabs / siRNA}
-export function siRnaBioSpringToAxolabs(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', '1': 'Uf', '2': 'Af', '3': 'Cf', '4': 'Gf', '5': 'u', '6': 'a', '7': 'c', '8': 'g', '*': 's'};
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|1|2|3|4|5|6|7|8|\*)/g, function (x: string) {return obj[x];});
-}
-
-//name: siRnaBioSpringToGcrs
-//input: string nucleotides {semType: BioSpring / siRNA}
-//output: string result {semType: GCRS}
-export function siRnaBioSpringToGcrs(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', '1': 'fU', '2': 'fA', '3': 'fC', '4': 'fG', '5': 'mU', '6': 'mA', '7': 'mC', '8': 'mG', '*': 'ps'};
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|1|2|3|4|5|6|7|8|\*)/g, function (x: string) {return obj[x];});
-}
-
-//name: siRnaAxolabsToGcrs
-//input: string nucleotides {semType: Axolabs / siRNA}
-//output: string result {semType: GCRS}
-export function siRnaAxolabsToGcrs(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)',
-    'Uf': 'fU', 'Af': 'fA', 'Cf': 'fC', 'Gf': 'fG', 'u': 'mU', 'a': 'mA', 'c': 'mC', 'g': 'mG', 's': 'ps'
-  };
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|Uf|Af|Cf|Gf|u|a|c|g|s)/g, function (x: string) {return obj[x];});
-}
-
-//name: siRnaAxolabsToBioSpring
-//input: string nucleotides {semType: Axolabs / siRNA}
-//output: string result {semType: BioSpring / siRNA}
-export function siRnaAxolabsToBioSpring(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)',
-    'Uf': '1', 'Af': '2', 'Cf': '3', 'Gf': '4', 'u': '5', 'a': '6', 'c': '7', 'g': '8', 's': '*'
-  };
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|Uf|Af|Cf|Gf|u|a|c|g|s)/g, function (x: string) {return obj[x];});
-}
-
-//name: siRnaAxolabsToNucleotides
-//input: string nucleotides {semType: Axolabs / siRNA}
-//output: string result {semType: RNA nucleotides}
-export function siRnaAxolabsToNucleotides(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)',
-    'Uf': 'U', 'Af': 'A', 'Cf': 'C', 'Gf': 'G', 'u': 'U', 'a': 'A', 'c': 'C', 'g': 'G', 's': ''
-  };
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|Uf|Af|Cf|Gf|u|a|c|g|s)/g, function (x: string) {return obj[x];});
-}
-
-//name: siRnaGcrsToNucleotides
-//input: string nucleotides {semType: GCRS}
-//output: string result {semType: RNA nucleotides}
-export function siRnaGcrsToNucleotides(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)',
-    'fU': 'U', 'fA': 'A', 'fC': 'C', 'fG': 'G', 'mU': 'U', 'mA': 'A', 'mC': 'C', 'mG': 'G', 'ps': ''
-  };
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|fU|fA|fC|fG|mU|mA|mC|mG|ps)/g, function (x: string) {return obj[x];});
-}
-
-//name: siRnaGcrsToBioSpring
-//input: string nucleotides {semType: GCRS}
-//output: string result {semType: BioSpring / siRNA}
-export function siRnaGcrsToBioSpring(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)',
-    'fU': '1', 'fA': '2', 'fC': '3', 'fG': '4', 'mU': '5', 'mA': '6', 'mC': '7', 'mG': '8', 'ps': '*'
-  };
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|fU|fA|fC|fG|mU|mA|mC|mG|ps)/g, function (x: string) {return obj[x];});
-}
-
-//name: siRnaGcrsToAxolabs
-//input: string nucleotides {semType: GCRS}
-//output: string result {semType: Axolabs / siRNA}
-export function siRnaGcrsToAxolabs(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)',
-    'fU': 'Uf', 'fA': 'Af', 'fC': 'Cf', 'fG': 'Gf', 'mU': 'u', 'mA': 'a', 'mC': 'c', 'mG': 'g', 'ps': 's'
-  };
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|fU|fA|fC|fG|mU|mA|mC|mG|ps)/g, function (x: string) {return obj[x];});
-}
-
-//name: siRnaNucleotideToBioSpringSenseStrand
-//input: string nucleotides {semType: RNA nucleotides}
-//output: string result {semType: BioSpring / siRNA}
-export function siRnaNucleotideToBioSpringSenseStrand(nucleotides: string) {
-  let count: number = -1;
-  const objForLeftEdge: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': '6*', 'U': '5*', 'G': '8*', 'C': '7*'};
-  const objForRightEdge: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': '*6', 'U': '*5', 'G': '*8', 'C': '*7'};
-  const objForOddIndices: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': '6', 'U': '5', 'G': '8', 'C': '7'};
-  const objForEvenIndices: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': '2', 'U': '1', 'G': '4', 'C': '3'};
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|A|U|G|C)/g, function (x: string) {
-    count++;
-    if (count < 2) return objForLeftEdge[x];
-    if (count > nucleotides.length - 3) return objForRightEdge[x];
-    return (count % 2 == 0) ? objForEvenIndices[x] : objForOddIndices[x];
-  });
-}
-
-//name: siRnaNucleotidesToGcrs
-//input: string nucleotides {semType: RNA nucleotides}
-//output: string result {semType: GCRS}
-export function siRnaNucleotidesToGcrs(nucleotides: string) {
-  let count: number = -1;
-  const objForLeftEdge: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': 'mAps', 'U': 'mUps', 'G': 'mGps', 'C': 'mCps'};
-  const objForRightEdge: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': 'psmA', 'U': 'psmU', 'G': 'psmG', 'C': 'psmC'};
-  const objForEvenIndices: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': 'fA', 'U': 'fU', 'G': 'fG', 'C': 'fC'};
-  const objForOddIndices: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': 'mA', 'U': 'mU', 'G': 'mG', 'C': 'mC'};
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|A|U|G|C)/g, function (x: string) {
-    count++;
-    if (count < 2) return objForLeftEdge[x];
-    if (count > nucleotides.length - 3) return objForRightEdge[x];
-    return (count % 2 == 0) ? objForEvenIndices[x] : objForOddIndices[x];
-  });
-}
-
-//name: siRnaNucleotideToAxolabsSenseStrand
-//input: string nucleotides {semType: RNA nucleotides}
-//output: string result {semType: Axolabs}
-export function siRnaNucleotideToAxolabsSenseStrand(nucleotides: string) {
-  let count: number = -1;
-  const objForLeftEdge: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': 'as', 'U': 'us', 'G': 'gs', 'C': 'cs'};
-  const objForSomeIndices: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': 'Af', 'U': 'Uf', 'G': 'Gf', 'C': 'Cf'};
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': 'a', 'U': 'u', 'G': 'g', 'C': 'c'};
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|A|U|G|C)/g, function (x: string) {
-    count++;
-    if (count < 2) return objForLeftEdge[x];
-    if (count == 6 || (count > 7 && count < 11)) return objForSomeIndices[x]
-    if (count == nucleotides.length - 1) return 'a';
-    return obj[x];
-  });
-}
-
-//name: siRnaNucleotideToAxolabsAntisenseStrand
-//input: string nucleotides {semType: RNA nucleotides}
-//output: string result {semType: Axolabs}
-export function siRnaNucleotideToAxolabsAntisenseStrand(nucleotides: string) {
-  let count: number = -1;
-  const objForSmallLinkages: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': 'as', 'U': 'us', 'G': 'gs', 'C': 'cs'};
-  const objForBigLinkages: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': 'Afs', 'U': 'Ufs', 'G': 'Gfs', 'C': 'Cfs'};
-  const objForSomeIndices: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': 'Af', 'U': 'Uf', 'G': 'Gf', 'C': 'Cf'};
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)', 'A': 'a', 'U': 'u', 'G': 'g', 'C': 'c'};
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|A|U|G|C)/g, function (x: string) {
-    count++;
-    if (count > 19 && count < 22) return objForSmallLinkages[x];
-    if (count == 0) return 'us';
-    if (count == 1) return objForBigLinkages[x];
-    return (count == 5 || count == 7 || count == 8 || count == 13 || count == 15) ? objForSomeIndices[x] : obj[x];
-  });
-}
-
-//name: gcrsToNucleotides
-//input: string nucleotides {semType: GCRS}
-//output: string result {semType: RNA nucleotides}
-export function gcrsToNucleotides(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)',
-    'mAps': 'A', 'mUps': 'U', 'mGps': 'G', 'mCps': 'C', 'fAps': 'A', 'fUps': 'U', 'fGps': 'G', 'fCps': 'C',
-    'fU': 'U', 'fA': 'A', 'fC': 'C', 'fG': 'G', 'mU': 'U', 'mA': 'A', 'mC': 'C', 'mG': 'G'
-  };
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|mAps|mUps|mGps|mCps|fAps|fUps|fGps|fCps|fU|fA|fC|fG|mU|mA|mC|mG)/g, function (x: string) {return obj[x];});
-}
-
-//name: gcrsToMermade12
-//input: string nucleotides {semType: GCRS}
-//output: string result {semType: Mermade 12 / siRNA}
-export function gcrsToMermade12(nucleotides: string) {
-  const obj: {[index: string]: string} = {'(invabasic)': '(invabasic)', '(GalNAc-2-JNJ)': '(GalNAc-2-JNJ)',
-    'mAps': 'e', 'mUps': 'h', 'mGps': 'g', 'mCps': 'f', 'fAps': 'i', 'fUps': 'l', 'fGps': 'k', 'fCps': 'j', 'fU': 'L',
-    'fA': 'I', 'fC': 'J', 'fG': 'K', 'mU': 'H', 'mA': 'E', 'mC': 'F', 'mG': 'G'
-  };
-  return nucleotides.replace(/(\(invabasic\)|\(GalNAc-2-JNJ\)|mAps|mUps|mGps|mCps|fAps|fUps|fGps|fCps|fU|fA|fC|fG|mU|mA|mC|mG)/g, function (x: string) {return obj[x]});
+    .css('width', '100%');
 }
 
 async function saveTableAsSdFile(table: DG.DataFrame) {
-  if (!table.columns.contains('Compound Name'))
-    grok.shell.warning("File was saved without columns 'Compound Name', 'Compound Components', 'Cpd MW', 'Salt mass', 'Batch MW'!");
-  let structureColumn = table.columns.byName('Sequence');
+  if (!table.columns.contains('Compound Name')) {
+    grok.shell.warning(
+      'File saved without columns \'' +
+      [COL_NAMES.COMPOUND_NAME, COL_NAMES.COMPOUND_COMMENTS, COL_NAMES.CPD_MW,
+        COL_NAMES.SALT_MASS, COL_NAMES.BATCH_MW].join('\', \''),
+    );
+  }
+  const structureColumn = table.col(COL_NAMES.SEQUENCE)!;
+  const typeColumn = table.col(COL_NAMES.TYPE)!;
   let result = '';
   for (let i = 0; i < table.rowCount; i++) {
-    try {
-      let smiles = sequenceToSmiles(structureColumn.get(i));
-      //@ts-ignore
-      let mol = new OCL.Molecule.fromSmiles(smiles);
-      result += `\n${mol.toMolfile()}\n`;
-      for (let col of table.columns)
+    result += (typeColumn.get(i) == 'SS') ?
+      sequenceToMolV3000(structureColumn.get(i), false, true) + '\n' + `>  <Sequence>\nSense Strand\n\n` :
+      sequenceToMolV3000(structureColumn.get(i), true, true) + '\n' + `>  <Sequence>\nAnti Sense\n\n`;
+    for (const col of table.columns) {
+      if (col.name != COL_NAMES.SEQUENCE)
         result += `>  <${col.name}>\n${col.get(i)}\n\n`;
-      result += '$$$$';
-    }
-    catch (error) {
-      console.error(error);
     }
+    result += '$$$$\n\n';
   }
-  let element = document.createElement('a');
+  const element = document.createElement('a');
   element.setAttribute('href', 'data:text/plain;charset=utf-8,' + encodeURIComponent(result));
   element.setAttribute('download', table.name + '.sdf');
   element.click();
 }
 
-function parseNumber(saltName: string) {
-  let i = saltName.length;
-  while (saltName.length > -1 && saltName[i] != '(')
-    i--;
-  return parseInt(saltName.slice(i + 2));
+const weightsObj: {[code: string]: number} = {};
+for (const synthesizer of Object.keys(map)) {
+  for (const technology of Object.keys(map[synthesizer])) {
+    for (const code of Object.keys(map[synthesizer][technology]))
+      weightsObj[code] = map[synthesizer][technology][code].weight;
+  }
 }
+for (const [key, value] of Object.entries(MODIFICATIONS))
+  weightsObj[key] = value.molecularWeight;
 
-//tags: autostart
-export function autostartOligoSdFileSubscription() {
-  grok.events.onViewAdded.subscribe((v: any) => {
-    if (v.type == 'TableView' && v.dataFrame.columns.contains('Type'))
-      oligoSdFile(v.dataFrame);
-  });
+function sortByStringLengthInDescendingOrder(array: string[]): string[] {
+  return array.sort(function(a, b) {return b.length - a.length;});
 }
 
-let weightsObj: {[code: string]: number} = {};
-for (let synthesizer of Object.keys(map))
-  for (let technology of Object.keys(map[synthesizer]))
-    for (let code of Object.keys(map[synthesizer][technology]))
-      weightsObj[code] = map[synthesizer][technology][code].weight;
+function stringifyItems(items: string[]): string {
+  return '["' + items.join('", "') + '"]';
+}
 
-function molecularWeight(sequence: string): number {
-  const codes = sortByStringLengthInDescendingOrder(Object.keys(weightsObj));
-  let weight = 0, i = 0;
+function molecularWeight(sequence: string, weightsObj: {[index: string]: number}): number {
+  const codes = sortByStringLengthInDescendingOrder(Object.keys(weightsObj)).concat(Object.keys(MODIFICATIONS));
+  let weight = 0;
+  let i = 0;
   while (i < sequence.length) {
-    let matchedCode = codes.find((s) => s == sequence.slice(i, i + s.length))!;
+    const matchedCode = codes.find((s) => s == sequence.slice(i, i + s.length))!;
     weight += weightsObj[sequence.slice(i, i + matchedCode.length)];
     i += matchedCode!.length;
   }
   return weight - 61.97;
 }
 
-export function oligoSdFile(table: DG.DataFrame) {
+//tags: autostart
+export function autostartOligoSdFileSubscription() {
+  grok.events.onViewAdded.subscribe((v: any) => {
+    if (v.type == 'TableView' && v.dataFrame.columns.contains(COL_NAMES.TYPE))
+      oligoSdFile(v.dataFrame);
+  });
+}
 
-  function addColumns(t: DG.DataFrame) {
-    if (t.columns.contains('Compound Name'))
+export function oligoSdFile(table: DG.DataFrame) {
+  const saltsDf = DG.DataFrame.fromCsv(SALTS_CSV);
+  const usersDf = DG.DataFrame.fromCsv(USERS_CSV);
+  const sourcesDf = DG.DataFrame.fromCsv(SOURCES);
+  const icdsDf = DG.DataFrame.fromCsv(ICDS);
+  const idpsDf = DG.DataFrame.fromCsv(IDPS);
+
+  function addColumns(t: DG.DataFrame, saltsDf: DG.DataFrame) {
+    if (t.columns.contains(COL_NAMES.COMPOUND_NAME))
       return grok.shell.error('Columns already exist!');
 
-    table.col('Source')?.init('Johnson and Johnson Pharma');
-    table.col('ICD')?.init('No Contract');
+    const sequence = t.col(COL_NAMES.SEQUENCE)!;
+    const equivalents = t.col(COL_NAMES.EQUIVALENTS)!;
 
-    let sequence = t.col('Sequence')!;
-    let salt = t.col('Salt')!;
-    let equivalents = t.col('Equivalents')!;
-
-    t.columns.addNewString('Compound Name').init((i: number) => sequence.get(i));
-    t.columns.addNewString('Compound Comments').init((i: number) => (i > 0 && i % 2 == 0) ?
+    t.columns.addNewString(COL_NAMES.COMPOUND_NAME).init((i: number) => sequence.get(i));
+    t.columns.addNewString(COL_NAMES.COMPOUND_COMMENTS).init((i: number) => (i > 0 && i % 2 == 0) ?
       sequence.getString(i) + '; duplex of SS: ' + sequence.getString(i - 2) + ' and AS: ' + sequence.getString(i - 1) :
-      sequence.getString(i)
+      sequence.getString(i),
+    );
+    t.columns.addNewFloat(COL_NAMES.CPD_MW)
+      .init((i: number) => molecularWeight(sequence.get(i), weightsObj));
+    const mwCol = t.col(COL_NAMES.CPD_MW)!;
+    t.columns.addNewFloat(COL_NAMES.SALT_MASS).init((i: number) => {
+      const mw = mwCol.get(i);
+      return mw * equivalents.get(i);
+    });
+    t.columns.addNewCalculated(COL_NAMES.BATCH_MW,
+      '${' + COL_NAMES.CPD_MW + '} + ${' + COL_NAMES.SALT_MASS + '}', DG.COLUMN_TYPE.FLOAT, false,
     );
-    t.columns.addNewFloat('Cpd MW').init((i: number) => ((i + 1) % 3 == 0) ? DG.FLOAT_NULL : molecularWeight(sequence.get(i)));
-    t.columns.addNewFloat('Salt mass').init((i: number) => parseNumber(salt.get(i)) * equivalents.get(i));
-    t.columns.addNewCalculated('Batch MW', '${Cpd MW} + ${Salt mass}', DG.COLUMN_TYPE.FLOAT, false);
 
     addColumnsPressed = true;
     return newDf = t;
   }
 
-  const columnsOrder = ["Chemistry", "Number", "Type", "Chemistry Name", "Internal compound ID", "IDP", "Sequence", "Compound Name",
-    "Compound Comments", "Salt", "Equivalents", "Purity", "Cpd MW", "Salt mass", "Batch MW", "Source", "ICD", "Owner"];
   let newDf: DG.DataFrame;
   let addColumnsPressed = false;
 
-  let d = ui.div([
+  const d = ui.div([
     ui.icons.edit(() => {
       d.innerHTML = '';
+      if (table.col(COL_NAMES.IDP)!.type != DG.COLUMN_TYPE.STRING)
+        table.changeColumnType(COL_NAMES.IDP, DG.COLUMN_TYPE.STRING);
       d.append(
-        ui.link('Add Columns', async () => {
-          await addColumns(table);
-          grok.shell.tableView(table.name).grid.columns.setOrder(columnsOrder);
-        }, 'Add columns: Compound Name, Compound Components, Cpd MW, Salt mass, Batch MW', ''),
-        ui.button('Save SD file', () => saveTableAsSdFile(addColumnsPressed ? newDf : table))
+        ui.link('Add Columns', () => {
+          addColumns(table, saltsDf);
+          grok.shell.tableView(table.name).grid.columns.setOrder(Object.values(COL_NAMES));
+        }, 'Add columns: \'' + [COL_NAMES.COMPOUND_NAME, COL_NAMES.COMPOUND_COMMENTS, COL_NAMES.CPD_MW,
+          COL_NAMES.SALT_MASS, COL_NAMES.BATCH_MW].join('\', \''), ''),
+        ui.button('Save SD file', () => saveTableAsSdFile(addColumnsPressed ? newDf : table)),
       );
-      let view = grok.shell.getTableView(table.name);
-      let typeCol = view.grid.col('Type')!;
-      let saltCol = view.grid.col('Salt')!;
-      saltCol.cellType = 'html';
-      typeCol.cellType = 'html';
-      view.grid.onCellPrepare(function (gc: DG.GridCell) {
-        if (gc.isTableCell) {
-          if (gc.gridColumn.name == 'Type')
-            gc.style.element = ui.choiceInput('', gc.cell.value, ['AS', 'SS', 'Duplex']).root;
-          else if (gc.gridColumn.name == 'Salt')
-            gc.style.element = ui.choiceInput('', gc.cell.value, ['Sodium (+1)', 'Sodium (+2)']).root;
-        }
-      });
 
-      table.onDataChanged.subscribe((_) => {
-        if (table.currentCol.name == 'IDP' && typeof table.currentCell.value != 'number')
-          grok.shell.error('Value should be numeric');
+      const view = grok.shell.getTableView(table.name)!;
+
+      view.table!.col(COL_NAMES.TYPE)!.setTag(DG.TAGS.CHOICES, '["AS", "SS", "Duplex"]');
+      view.table!.col(COL_NAMES.OWNER)!.setTag(DG.TAGS.CHOICES, stringifyItems(usersDf.columns.byIndex(0).toList()));
+      view.table!.col(COL_NAMES.SALT)!.setTag(DG.TAGS.CHOICES, stringifyItems(saltsDf.columns.byIndex(1).toList()));
+      view.table!.col(COL_NAMES.SOURCE)!.setTag(DG.TAGS.CHOICES, stringifyItems(sourcesDf.columns.byIndex(0).toList()));
+      view.table!.col(COL_NAMES.ICD)!.setTag(DG.TAGS.CHOICES, stringifyItems(icdsDf.columns.byIndex(0).toList()));
+      view.table!.col(COL_NAMES.IDP)!.setTag(DG.TAGS.CHOICES, stringifyItems(idpsDf.columns.byIndex(0).toList()));
+
+      grok.events.onContextMenu.subscribe((args) => {
+        if ([COL_NAMES.TYPE, COL_NAMES.OWNER, COL_NAMES.SALT, COL_NAMES.SOURCE, COL_NAMES.ICD, COL_NAMES.IDP]
+          .includes(args.args.context.table.currentCol.name)) {
+          args.args.menu.item('Fill Column With Value', () => {
+            const v = args.args.context.table.currentCell.value;
+            args.args.context.table.currentCell.column.init(v);
+          });
+        }
       });
-    })
+    }),
   ]);
   grok.shell.v.setRibbonPanels([[d]]);
 }