wrnap 0.0.1
This diff represents the content of publicly available package versions that have been released to one of the supported registries. The information contained in this diff is provided for informational purposes only and reflects changes between package versions as they appear in their respective public registries.
- checksums.yaml +7 -0
- data/.gitignore +22 -0
- data/Gemfile +4 -0
- data/LICENSE.md +21 -0
- data/README.md +47 -0
- data/Rakefile +2 -0
- data/lib/wrnap/global/chain_extensions.rb +29 -0
- data/lib/wrnap/global/parser.rb +24 -0
- data/lib/wrnap/global/rna.rb +148 -0
- data/lib/wrnap/global/rna_extensions.rb +99 -0
- data/lib/wrnap/global/run_extensions.rb +98 -0
- data/lib/wrnap/graphing/r.rb +229 -0
- data/lib/wrnap/package/base.rb +73 -0
- data/lib/wrnap/package/energy_grid_2d.rb +81 -0
- data/lib/wrnap/package/eval.rb +13 -0
- data/lib/wrnap/package/fft_mfpt.rb +24 -0
- data/lib/wrnap/package/fftbor.rb +19 -0
- data/lib/wrnap/package/fftbor2d.rb +22 -0
- data/lib/wrnap/package/ffthairpin.rb +7 -0
- data/lib/wrnap/package/fftmultiloop.rb +7 -0
- data/lib/wrnap/package/fold.rb +25 -0
- data/lib/wrnap/package/heat.rb +15 -0
- data/lib/wrnap/package/kinwalker.rb +24 -0
- data/lib/wrnap/package/mfpt.rb +40 -0
- data/lib/wrnap/package/plot.rb +19 -0
- data/lib/wrnap/package/population.rb +84 -0
- data/lib/wrnap/package/rna2dfold.rb +27 -0
- data/lib/wrnap/package/rnabor.rb +32 -0
- data/lib/wrnap/package/spectral.rb +24 -0
- data/lib/wrnap/package/subopt.rb +26 -0
- data/lib/wrnap/package/tabu_path.rb +50 -0
- data/lib/wrnap/package/xbor.rb +63 -0
- data/lib/wrnap/version.rb +3 -0
- data/lib/wrnap.rb +80 -0
- data/wrnap.gemspec +28 -0
- metadata +162 -0
checksums.yaml
ADDED
|
@@ -0,0 +1,7 @@
|
|
|
1
|
+
---
|
|
2
|
+
SHA1:
|
|
3
|
+
metadata.gz: 78511600a0ab8cc9fc08c3a64c677794744fee4d
|
|
4
|
+
data.tar.gz: 2b940a1ccf7159bb14d5d53d22c7c58c1466a1b1
|
|
5
|
+
SHA512:
|
|
6
|
+
metadata.gz: e6e3f134d8b2724af60d26fc07b62077489844c2d74a0258fb82a3753e0c6196ec7f029f88186985bf52bc075acdea55427b7d514133c8073aa645918d73d90e
|
|
7
|
+
data.tar.gz: 5da6d3dfe4888a5c1b7092ab1e1e93fa0cfd8504f9153cf2fc4cc62c9a65a823f3c3eff5194a17e3481a711fbead3abdba7d28b97c34fd1e5936d4d6b49982d9
|
data/.gitignore
ADDED
|
@@ -0,0 +1,22 @@
|
|
|
1
|
+
*.gem
|
|
2
|
+
*.rbc
|
|
3
|
+
.bundle
|
|
4
|
+
.config
|
|
5
|
+
.yardoc
|
|
6
|
+
Gemfile.lock
|
|
7
|
+
InstalledFiles
|
|
8
|
+
_yardoc
|
|
9
|
+
coverage
|
|
10
|
+
doc/
|
|
11
|
+
lib/bundler/man
|
|
12
|
+
pkg
|
|
13
|
+
rdoc
|
|
14
|
+
spec/reports
|
|
15
|
+
test/tmp
|
|
16
|
+
test/version_tmp
|
|
17
|
+
tmp
|
|
18
|
+
*.bundle
|
|
19
|
+
*.so
|
|
20
|
+
*.o
|
|
21
|
+
*.a
|
|
22
|
+
mkmf.log
|
data/Gemfile
ADDED
data/LICENSE.md
ADDED
|
@@ -0,0 +1,21 @@
|
|
|
1
|
+
The MIT License (MIT)
|
|
2
|
+
|
|
3
|
+
Copyright (c) {{{year}}} {{{fullname}}}
|
|
4
|
+
|
|
5
|
+
Permission is hereby granted, free of charge, to any person obtaining a copy
|
|
6
|
+
of this software and associated documentation files (the "Software"), to deal
|
|
7
|
+
in the Software without restriction, including without limitation the rights
|
|
8
|
+
to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
|
|
9
|
+
copies of the Software, and to permit persons to whom the Software is
|
|
10
|
+
furnished to do so, subject to the following conditions:
|
|
11
|
+
|
|
12
|
+
The above copyright notice and this permission notice shall be included in all
|
|
13
|
+
copies or substantial portions of the Software.
|
|
14
|
+
|
|
15
|
+
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
|
|
16
|
+
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
|
|
17
|
+
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
|
|
18
|
+
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
|
|
19
|
+
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
|
|
20
|
+
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
|
21
|
+
SOFTWARE.
|
data/README.md
ADDED
|
@@ -0,0 +1,47 @@
|
|
|
1
|
+
# Wrnap
|
|
2
|
+
|
|
3
|
+
[](http://badge.fury.io/rb/wrnap)
|
|
4
|
+
|
|
5
|
+
A simple gem for facilitating bindings to various RNA CLI packages (namely http://www.tbi.univie.ac.at/~ivo/RNA/). Note that this gem makes no effort to build and install any wrapped packages at install-time, and instead relies on its presence on the host machine. Also includes a lot of utilities surrounding RNA sequence / structure parsing, graphing using R (via RinRuby) and other analysis tools. Used privately as the foundation for much of the research I do at http://bioinformatics.bc.edu/clotelab/
|
|
6
|
+
|
|
7
|
+
## Installation
|
|
8
|
+
|
|
9
|
+
Add this line to your application's Gemfile:
|
|
10
|
+
|
|
11
|
+
gem 'wrnap'
|
|
12
|
+
|
|
13
|
+
And then execute:
|
|
14
|
+
|
|
15
|
+
$ bundle
|
|
16
|
+
|
|
17
|
+
Or install it yourself as:
|
|
18
|
+
|
|
19
|
+
$ gem install wrnap
|
|
20
|
+
|
|
21
|
+
## Usage
|
|
22
|
+
|
|
23
|
+
Simple use case:
|
|
24
|
+
|
|
25
|
+
> require "wrnap"
|
|
26
|
+
#=> true
|
|
27
|
+
> rna = Wrnap::Package::Fold.run(seq: "CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG")
|
|
28
|
+
#=> #<Wrnap::Fold:0x007f9c48839dc0>
|
|
29
|
+
> rna.structure
|
|
30
|
+
#=> "((((..(((...(((....))).)))..))))"
|
|
31
|
+
> rna.mfe
|
|
32
|
+
#=> -19.7
|
|
33
|
+
|
|
34
|
+
... now an even easier way ...
|
|
35
|
+
|
|
36
|
+
> mfe_rna = RNA("CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG").run(:fold).mfe_rna
|
|
37
|
+
#=> echo CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG | rnafold --noPS
|
|
38
|
+
#=> Total runtime: 0.013 sec.
|
|
39
|
+
#=> #<Wrnap::Rna CCUCGAGGGGAACCCGAAAG... ((((..(((...(((....) [truncated]>
|
|
40
|
+
|
|
41
|
+
## Contributing
|
|
42
|
+
|
|
43
|
+
1. Fork it ( https://github.com/[my-github-username]/wrnap/fork )
|
|
44
|
+
2. Create your feature branch (`git checkout -b my-new-feature`)
|
|
45
|
+
3. Commit your changes (`git commit -am 'Add some feature'`)
|
|
46
|
+
4. Push to the branch (`git push origin my-new-feature`)
|
|
47
|
+
5. Create a new Pull Request
|
data/Rakefile
ADDED
|
@@ -0,0 +1,29 @@
|
|
|
1
|
+
module Wrnap
|
|
2
|
+
module Global
|
|
3
|
+
module ChainExtensions
|
|
4
|
+
def self.included(base)
|
|
5
|
+
base.send(:include, InstanceMethods)
|
|
6
|
+
end
|
|
7
|
+
|
|
8
|
+
module InstanceMethods
|
|
9
|
+
def chain(package, flags = {})
|
|
10
|
+
class_chaining_to = Wrnap::Package.lookup(package)
|
|
11
|
+
|
|
12
|
+
unless instance_variable_defined?(:@response)
|
|
13
|
+
raise ArgumentError.new("Can only chain a package that is not the first to be called")
|
|
14
|
+
end
|
|
15
|
+
|
|
16
|
+
unless class_chaining_to.instance_methods.include?(:transform_for_chaining)
|
|
17
|
+
raise ArgumentError.new("#{class_chaining_to.name} doesn't support chaining because it doesn't define transform_for_chaining")
|
|
18
|
+
end
|
|
19
|
+
|
|
20
|
+
unless [chains_from].flatten.any?(&method(:kind_of?))
|
|
21
|
+
raise ArgumentError.new("#{class_chaining_to.name} doesn't support chaining from #{self.class.name} because it isn't in the chains_from list")
|
|
22
|
+
end
|
|
23
|
+
|
|
24
|
+
class_chaining_to.new(self, chaining: true).run(flags)
|
|
25
|
+
end
|
|
26
|
+
end
|
|
27
|
+
end
|
|
28
|
+
end
|
|
29
|
+
end
|
|
@@ -0,0 +1,24 @@
|
|
|
1
|
+
module Wrnap
|
|
2
|
+
module Global
|
|
3
|
+
module Parser
|
|
4
|
+
REGEXP = {
|
|
5
|
+
number: /-?\d*\.\d*/,
|
|
6
|
+
mfe: / \(\s*(-?\d*\.\d*)\)$/
|
|
7
|
+
}
|
|
8
|
+
|
|
9
|
+
class << self
|
|
10
|
+
def rnafold_mfe_structure(response)
|
|
11
|
+
response.split(/\n/)[1].split(/\s+/).first
|
|
12
|
+
end
|
|
13
|
+
|
|
14
|
+
def rnafold_mfe(response)
|
|
15
|
+
response.split(/\n/)[1].match(REGEXP[:mfe])[1].to_f
|
|
16
|
+
end
|
|
17
|
+
|
|
18
|
+
def rnafold_ensemble_energy(response)
|
|
19
|
+
response.split(/\n/)[2].split(/\s/).last.match(REGEXP[:number])[0].to_f
|
|
20
|
+
end
|
|
21
|
+
end
|
|
22
|
+
end
|
|
23
|
+
end
|
|
24
|
+
end
|
|
@@ -0,0 +1,148 @@
|
|
|
1
|
+
module Wrnap
|
|
2
|
+
module Global
|
|
3
|
+
class Rna
|
|
4
|
+
include RnaExtensions
|
|
5
|
+
|
|
6
|
+
attr_accessor :comment
|
|
7
|
+
attr_reader :sequence, :structure, :second_structure
|
|
8
|
+
|
|
9
|
+
class << self
|
|
10
|
+
def init_from_string(sequence, structure = nil, second_structure = nil, comment = nil)
|
|
11
|
+
new(
|
|
12
|
+
sequence: sequence,
|
|
13
|
+
structure: structure,
|
|
14
|
+
second_structure: second_structure,
|
|
15
|
+
comment: comment
|
|
16
|
+
)
|
|
17
|
+
end
|
|
18
|
+
|
|
19
|
+
def init_from_hash(hash)
|
|
20
|
+
new(
|
|
21
|
+
sequence: hash[:sequence] || hash[:seq],
|
|
22
|
+
structure: hash[:structure] || hash[:str_1] || hash[:str],
|
|
23
|
+
second_structure: hash[:second_structure] || hash[:str_2],
|
|
24
|
+
comment: hash[:comment] || hash[:name]
|
|
25
|
+
)
|
|
26
|
+
end
|
|
27
|
+
|
|
28
|
+
def init_from_array(array)
|
|
29
|
+
init_from_string(*array)
|
|
30
|
+
end
|
|
31
|
+
|
|
32
|
+
def init_from_fasta(string)
|
|
33
|
+
if File.exist?(string)
|
|
34
|
+
comment = File.basename(string, string.include?(?.) ? ".%s" % string.split(?.)[-1] : "")
|
|
35
|
+
string = File.read(string).chomp
|
|
36
|
+
end
|
|
37
|
+
|
|
38
|
+
init_from_string(*string.split(/\n/).reject { |line| line.start_with?(">") }[0, 3]).tap do |rna|
|
|
39
|
+
if (line = string.split(/\n/).first).start_with?(">") && !(file_comment = line.gsub(/^>\s*/, "")).empty?
|
|
40
|
+
rna.comment = file_comment
|
|
41
|
+
elsif comment
|
|
42
|
+
rna.comment = comment
|
|
43
|
+
end
|
|
44
|
+
end
|
|
45
|
+
end
|
|
46
|
+
|
|
47
|
+
def init_from_self(rna)
|
|
48
|
+
# This happens when you call a Wrnap library function with the output of something like Wrnap::Fold.run(...).mfe
|
|
49
|
+
new(
|
|
50
|
+
sequence: rna.sequence,
|
|
51
|
+
strucutre: rna.structure,
|
|
52
|
+
second_strucutre: rna.second_structure,
|
|
53
|
+
comment: rna.comment
|
|
54
|
+
)
|
|
55
|
+
end
|
|
56
|
+
|
|
57
|
+
alias_method :placeholder, :new
|
|
58
|
+
end
|
|
59
|
+
|
|
60
|
+
def initialize(sequence: "", structure: "", second_structure: "", comment: "")
|
|
61
|
+
@sequence, @comment = sequence.kind_of?(Rna) ? sequence.seq : sequence, comment
|
|
62
|
+
|
|
63
|
+
[:structure, :second_structure].each do |structure_symbol|
|
|
64
|
+
instance_variable_set(
|
|
65
|
+
:"@#{structure_symbol}",
|
|
66
|
+
case structure_value = eval("#{structure_symbol}")
|
|
67
|
+
when :empty then empty_structure
|
|
68
|
+
when :mfe then RNA(sequence).run(:fold).mfe_rna.structure
|
|
69
|
+
when String then structure_value
|
|
70
|
+
when Hash then
|
|
71
|
+
if structure_value.keys.count > 1
|
|
72
|
+
Wrnap.debugger { "The following options hash has more than one key. This will probably produce unpredictable results: %s" % structure_value.inspect }
|
|
73
|
+
end
|
|
74
|
+
|
|
75
|
+
RNA(sequence).run(*structure_value.keys, *structure_value.values).mfe_rna.structure
|
|
76
|
+
end
|
|
77
|
+
)
|
|
78
|
+
end
|
|
79
|
+
|
|
80
|
+
if str && seq.length != str.length
|
|
81
|
+
Wrnap.debugger { "The sequence length (%d) doesn't match the structure length (%d)" % [seq, str].map(&:length) }
|
|
82
|
+
end
|
|
83
|
+
|
|
84
|
+
if str_2 && str_1.length != str_2.length
|
|
85
|
+
Wrnap.debugger { "The first structure length (%d) doesn't match the second structure length (%d)" % [str_1, str_2].map(&:length) }
|
|
86
|
+
end
|
|
87
|
+
end
|
|
88
|
+
|
|
89
|
+
alias :seq :sequence
|
|
90
|
+
alias :str :structure
|
|
91
|
+
alias :str_1 :structure
|
|
92
|
+
alias :str_2 :second_structure
|
|
93
|
+
alias :name :comment
|
|
94
|
+
|
|
95
|
+
def empty_structure
|
|
96
|
+
"." * seq.length
|
|
97
|
+
end
|
|
98
|
+
|
|
99
|
+
alias :empty_str :empty_structure
|
|
100
|
+
|
|
101
|
+
def one_structure(structure_1)
|
|
102
|
+
self.class.init_from_string(seq, structure_1.is_a?(Symbol) ? send(structure_1) : structure_1, nil, name)
|
|
103
|
+
end
|
|
104
|
+
|
|
105
|
+
def two_structures(structure_1, structure_2)
|
|
106
|
+
self.class.init_from_string(
|
|
107
|
+
seq,
|
|
108
|
+
*[structure_1, structure_2].map { |argument| argument.is_a?(Symbol) ? send(argument) : argument },
|
|
109
|
+
name
|
|
110
|
+
)
|
|
111
|
+
end
|
|
112
|
+
|
|
113
|
+
def write_fa!(filename)
|
|
114
|
+
filename.tap do |filename|
|
|
115
|
+
File.open(filename, ?w) do |file|
|
|
116
|
+
file.write("> %s\n" % name) if name
|
|
117
|
+
file.write("%s\n" % seq) if seq
|
|
118
|
+
file.write("%s\n" % str_1) if str_1
|
|
119
|
+
file.write("%s\n" % str_2) if str_2
|
|
120
|
+
end
|
|
121
|
+
end
|
|
122
|
+
end
|
|
123
|
+
|
|
124
|
+
def temp_fa_file!
|
|
125
|
+
write_fa!(Tempfile.new("rna")).path
|
|
126
|
+
end
|
|
127
|
+
|
|
128
|
+
def run(package_name, options = {})
|
|
129
|
+
Wrnap::Package.lookup(package_name).run(self, options)
|
|
130
|
+
end
|
|
131
|
+
|
|
132
|
+
def method_missing(name, *args, &block)
|
|
133
|
+
if (name_str = "#{name}") =~ /^run_\w+$/
|
|
134
|
+
run(name_str.gsub(/^run_/, ""), *args)
|
|
135
|
+
else super end
|
|
136
|
+
end
|
|
137
|
+
|
|
138
|
+
def inspect
|
|
139
|
+
"#<RNA: %s>" % [
|
|
140
|
+
("#{seq[0, 20] + (seq.length > 20 ? '... [%d]' % seq.length : '')}" if seq && !seq.empty?),
|
|
141
|
+
("#{str_1[0, 20] + (str_1.length > 20 ? ' [%d]' % seq.length : '')}" if str_1 && !str_1.empty?),
|
|
142
|
+
("#{str_2[0, 20] + (str_2.length > 20 ? ' [%d]' % seq.length : '')}" if str_2 && !str_1.empty?),
|
|
143
|
+
(name ? name : "#{self.class.name}")
|
|
144
|
+
].compact.join(", ")
|
|
145
|
+
end
|
|
146
|
+
end
|
|
147
|
+
end
|
|
148
|
+
end
|
|
@@ -0,0 +1,99 @@
|
|
|
1
|
+
module Wrnap
|
|
2
|
+
module Global
|
|
3
|
+
module RnaExtensions
|
|
4
|
+
def self.included(base)
|
|
5
|
+
base.send(:include, InstanceMethods)
|
|
6
|
+
base.extend(ClassMethods)
|
|
7
|
+
base.extend(OneStructureBasedMethods)
|
|
8
|
+
base.extend(TwoStructureBasedMethods)
|
|
9
|
+
|
|
10
|
+
base.class_eval do
|
|
11
|
+
OneStructureBasedMethods.public_instance_methods.each do |class_method|
|
|
12
|
+
define_method(class_method) do |*args|
|
|
13
|
+
self.class.send(class_method, *[structure].concat(args))
|
|
14
|
+
end
|
|
15
|
+
end
|
|
16
|
+
|
|
17
|
+
TwoStructureBasedMethods.public_instance_methods.each do |class_method|
|
|
18
|
+
define_method(class_method) do |*args|
|
|
19
|
+
self.class.send(class_method, *[str_1, str_2].concat(args))
|
|
20
|
+
end
|
|
21
|
+
end
|
|
22
|
+
end
|
|
23
|
+
|
|
24
|
+
base.send(:include, InstanceMethods)
|
|
25
|
+
end
|
|
26
|
+
|
|
27
|
+
module ClassMethods
|
|
28
|
+
def generate_sequence(sequence_length)
|
|
29
|
+
# 0th order Markov chain w/ uniform probability distribution
|
|
30
|
+
Rna.init_from_string(sequence_length.times.inject("") { |string, _| string + %w[A U C G][rand(4)] })
|
|
31
|
+
end
|
|
32
|
+
|
|
33
|
+
def shuffle(sequence, token_length = 2)
|
|
34
|
+
Shuffle.new(sequence).shuffle(token_length)
|
|
35
|
+
end
|
|
36
|
+
end
|
|
37
|
+
|
|
38
|
+
module InstanceMethods
|
|
39
|
+
def dishuffle
|
|
40
|
+
self.class.shuffle(sequence, 2)
|
|
41
|
+
end
|
|
42
|
+
|
|
43
|
+
def gc_content
|
|
44
|
+
seq.split(//).select { |i| i =~ /[GC]/i }.size.to_f / seq.size
|
|
45
|
+
end
|
|
46
|
+
|
|
47
|
+
def boltzmann_probability(dangle: 2)
|
|
48
|
+
Math.exp(-run(:eval, d: dangle).mfe / Wrnap::RT) / Math.exp(-run(:fold, d: dangle, p: 0).ensemble_energy / Wrnap::RT)
|
|
49
|
+
end
|
|
50
|
+
end
|
|
51
|
+
|
|
52
|
+
module OneStructureBasedMethods
|
|
53
|
+
def max_bp_distance(structure)
|
|
54
|
+
base_pairs(structure).count + ((structure.length - 3) / 2.0).floor
|
|
55
|
+
end
|
|
56
|
+
|
|
57
|
+
def base_pairs(structure)
|
|
58
|
+
get_pairings(structure).each_with_index.inject(Set.new) do |set, (j, i)|
|
|
59
|
+
j >= 0 ? set << Set[i, j] : set
|
|
60
|
+
end
|
|
61
|
+
end
|
|
62
|
+
|
|
63
|
+
def get_pairings(structure)
|
|
64
|
+
stack = []
|
|
65
|
+
|
|
66
|
+
structure.each_char.each_with_index.inject(Array.new(structure.length, -1)) do |array, (symbol, index)|
|
|
67
|
+
array.tap do
|
|
68
|
+
case symbol
|
|
69
|
+
when "(" then stack.push(index)
|
|
70
|
+
when ")" then
|
|
71
|
+
if stack.empty?
|
|
72
|
+
raise "Too many ')' in '#{structure}'"
|
|
73
|
+
else
|
|
74
|
+
stack.pop.tap do |opening|
|
|
75
|
+
array[opening] = index
|
|
76
|
+
array[index] = opening
|
|
77
|
+
end
|
|
78
|
+
end
|
|
79
|
+
end
|
|
80
|
+
end
|
|
81
|
+
end.tap do
|
|
82
|
+
raise "Too many '(' in '#{structure}'" unless stack.empty?
|
|
83
|
+
end
|
|
84
|
+
end
|
|
85
|
+
end
|
|
86
|
+
|
|
87
|
+
module TwoStructureBasedMethods
|
|
88
|
+
def bp_distance(structure_1, structure_2)
|
|
89
|
+
# Takes two structures and calculates the distance between them by |symmetric difference(bp_in_a, bp_in_b)|
|
|
90
|
+
raise "The two structures are not the same length" unless structure_1.length == structure_2.length
|
|
91
|
+
|
|
92
|
+
bp_set_1, bp_set_2 = base_pairs(structure_1), base_pairs(structure_2)
|
|
93
|
+
|
|
94
|
+
((bp_set_1 - bp_set_2) + (bp_set_2 - bp_set_1)).count
|
|
95
|
+
end
|
|
96
|
+
end
|
|
97
|
+
end
|
|
98
|
+
end
|
|
99
|
+
end
|
|
@@ -0,0 +1,98 @@
|
|
|
1
|
+
module Wrnap
|
|
2
|
+
module Global
|
|
3
|
+
module RunExtensions
|
|
4
|
+
def self.included(base)
|
|
5
|
+
base.send(:include, InstanceMethods)
|
|
6
|
+
base.extend(ClassMethods)
|
|
7
|
+
end
|
|
8
|
+
|
|
9
|
+
module ClassMethods
|
|
10
|
+
def exec_exists?(name)
|
|
11
|
+
!%x[which RNA#{name.to_s.downcase}].empty? || !%x[which #{name.to_s.downcase}].empty?
|
|
12
|
+
end
|
|
13
|
+
|
|
14
|
+
def run(*data)
|
|
15
|
+
flags = data.length > 1 && data.last.is_a?(Hash) ? data.pop : {}
|
|
16
|
+
new(data).run(flags)
|
|
17
|
+
end
|
|
18
|
+
end
|
|
19
|
+
|
|
20
|
+
module InstanceMethods
|
|
21
|
+
def run(flags = {})
|
|
22
|
+
unless response
|
|
23
|
+
tap do
|
|
24
|
+
@runtime = Benchmark.measure do
|
|
25
|
+
pre_run_check
|
|
26
|
+
merged_flags = recursively_merge_flags(flags)
|
|
27
|
+
runnable_command = run_command(merged_flags)
|
|
28
|
+
|
|
29
|
+
Wrnap.debugger { runnable_command }
|
|
30
|
+
|
|
31
|
+
@response = %x[#{runnable_command}]
|
|
32
|
+
post_process if respond_to?(:post_process)
|
|
33
|
+
end
|
|
34
|
+
|
|
35
|
+
Wrnap.debugger { "Total runtime: %.3f sec." % runtime.real }
|
|
36
|
+
end
|
|
37
|
+
else
|
|
38
|
+
self
|
|
39
|
+
end
|
|
40
|
+
end
|
|
41
|
+
|
|
42
|
+
def pre_run_check
|
|
43
|
+
if %x[which #{exec_name}].empty?
|
|
44
|
+
raise RuntimeError.new("#{exec_name} is not defined on this machine")
|
|
45
|
+
end
|
|
46
|
+
end
|
|
47
|
+
|
|
48
|
+
def exec_name
|
|
49
|
+
executable_name.respond_to?(:call) ? executable_name[self] : executable_name
|
|
50
|
+
end
|
|
51
|
+
|
|
52
|
+
def recursively_merge_flags(flags)
|
|
53
|
+
rmerge = ->(old_hash, new_hash) do
|
|
54
|
+
inner_hash = {}
|
|
55
|
+
|
|
56
|
+
old_hash.merge(new_hash) do |key, old_value, new_value|
|
|
57
|
+
inner_hash[key] = [old_value, new_value].map(&:class).uniq == [Hash] ? rmerge[old_value, new_value] : new_value
|
|
58
|
+
end
|
|
59
|
+
end
|
|
60
|
+
|
|
61
|
+
rmerge[base_flags(flags), flags].tap do |merged_flags|
|
|
62
|
+
Wrnap.debugger { "%s: %s" % [self.class.name, merged_flags.inspect] }
|
|
63
|
+
end
|
|
64
|
+
end
|
|
65
|
+
|
|
66
|
+
def base_flags(flags)
|
|
67
|
+
default_flags.respond_to?(:call) ? default_flags[self, flags] : default_flags
|
|
68
|
+
end
|
|
69
|
+
|
|
70
|
+
def run_command(flags)
|
|
71
|
+
"echo %s | %s %s" % [
|
|
72
|
+
"'%s'" % call_with.map { |datum| data.send(datum) }.join(?\n),
|
|
73
|
+
exec_name,
|
|
74
|
+
stringify_flags(flags)
|
|
75
|
+
]
|
|
76
|
+
end
|
|
77
|
+
|
|
78
|
+
def stringify_flags(flags)
|
|
79
|
+
flags.inject("") do |string, (flag, value)|
|
|
80
|
+
parameter = if value == :empty || value.class == TrueClass
|
|
81
|
+
" -%s" % flag
|
|
82
|
+
else
|
|
83
|
+
if quote_flag_params.include?(flag)
|
|
84
|
+
" -%s '%s'" % [flag, value.to_s.gsub(/'/) { %|\'| }]
|
|
85
|
+
else
|
|
86
|
+
" -%s %s" % [flag, value]
|
|
87
|
+
end
|
|
88
|
+
end
|
|
89
|
+
|
|
90
|
+
(string + parameter).strip
|
|
91
|
+
end.tap do
|
|
92
|
+
@flags = flags
|
|
93
|
+
end
|
|
94
|
+
end
|
|
95
|
+
end
|
|
96
|
+
end
|
|
97
|
+
end
|
|
98
|
+
end
|