viral_seq 0.3.0

data/lib/viral_seq/sdrm_core.rb

@@ -0,0 +1,652 @@
+# viral_seq/sdrm_core.rb
+# core functions for HIV SDRM analysis using MPID-DR protocol.
+# More details for HIV Surveillance Drug Resistance Mutation (SDRM) can be found at
+# https://hivdb.stanford.edu/pages/surveillance.html
+
+# Including methods as:
+#   ViralSeq::sdrm_nrti
+#   ViralSeq::sdrm_nnrti
+#   ViralSeq::hiv_protease
+#   ViralSeq::sdrm_int
+#   ViralSeq::sdrm_pr_bulk
+#   ViralSeq::sdrm_rt_bulk
+#   ViralSeq::sdrm_in_bulk
+
+# ViralSeq.sdrm_nrti(aa_arry, start_aa)
+# ViralSeq.sdrm_nnrti(aa_arry, start_aa)
+# ViralSeq.hiv_protease(aa_arry, start_aa)
+# ViralSeq.sdrm_int(aa_arry, start_aa)
+#   # funtions to identify SDRMs from a given sequence in an Array object
+#   # function names indicate which HIV drug resistance mutations it can identify
+#   # input an Array object for amino acid sequence ['A', 'M', 'L', ...]
+#   # start_aa is an Integer to indicate codon number of the 1st amino acid sequence in the input aa_array
+#   # return a Hash object for SDRMs identified. {:posiiton =>[:wildtype_codon, :mutation_codon]}
+
+# ViralSeq.sdrm_pr_bulk(sequence_hash, minority_cut_off)
+# ViralSeq.sdrm_rt_bulk(sequence_hash, minority_cut_off)
+# ViralSeq.sdrm_in_bulk(sequence_hash, minority_cut_off)
+#   # functions to identify SDRMs from a sequence hash object.
+#   # name of the functions indicate which region it works on
+#   # works for MPID-DR protocol (dx.doi.org/10.17504/protocols.io.useewbe)
+#   # PR codon 1-99
+#   # RT codon 34-122, 152-236, two regions are linked
+#   # IN codon 53-174
+#   # sequence_hash is a Hash object of sequences {:name => :sequence, ...}
+#   # sequences usually need to be QCed (remove sequences with stop codon and a3g hypermutations) first
+#   # minority_cut_off is the Integer cut-off for minimal abundance of a mutation to be called as valid mutation
+#   # minority_cut_off can be obtained using ViralSeq::poisson_minority_cutoff function
+#   # return [point_mutation_list, linkage_list, report_list]
+# =USAGE
+#   # example (example files from ID:VS053118-0566)
+#   sequence = ViralSeq.fasta_to_hash('spec/sample_files/sample_dr_sequences/pr.fasta')
+#   p_cut_off = ViralSeq.poisson_minority_cutoff(sequences)
+#   pr_sdrm = ViralSeq.sdrm_pr_bulk(sequence, p_cut_off)
+#   puts "region,tcs_number,position,wildtype,mutation,count,%,CI_low,CI_high,label"
+#   pr_sdrm[0].each {|n| puts n.join(',')}
+#   => region,tcs_number,position,wildtype,mutation,count,%,CI_low,CI_high,label
+#   => PR,396,30,D,N,247,0.62374,0.57398,0.67163,
+#   => PR,396,50,I,V,1,0.00253,6.0e-05,0.01399,*
+#   => PR,396,88,N,D,246,0.62121,0.57141,0.66919,
+#
+#   puts "region,tcs_number,linkage,count,%,CI_low,CI_high,label"
+#   pr_sdrm[1].each {|n| puts n.join(',')}
+#   => region,tcs_number,linkage,count,%,CI_low,CI_high,label
+#   => PR,396,D30N+N88D,245,0.61869,0.56884,0.66674,
+#   => PR,396,WT,149,0.37626,0.32837,0.42602,
+#   => PR,396,D30N,1,0.00253,6.0e-05,0.01399,*
+#   => PR,396,D30N+I50V+N88D,1,0.00253,6.0e-05,0.01399,*
+#
+#   puts "position,codon,tcs_number," + ViralSeq::AMINO_ACID_LIST.join(",")
+#   pr_sdrm[2].each {|n|puts n.join(",")}
+#   => position,codon,tcs_number,A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y,*
+#   => PR,1,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,2,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,3,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,4,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+#   => PR,5,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,6,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0
+#   => PR,7,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,8,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,9,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,10,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,11,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0
+#   => PR,12,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,37.8788,62.1212,0.0,0.0,0.0,0.0
+#   => PR,13,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,38.1313,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,61.8687,0.0,0.0,0.0
+#   => PR,14,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,15,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,62.3737,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,37.6263,0.0,0.0,0.0
+#   => PR,16,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,17,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,18,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.4949,0.5051,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,19,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,20,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,21,396,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,22,396,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,23,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,24,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,25,396,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,26,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+#   => PR,27,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,28,396,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,29,396,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,30,396,0.0,0.0,37.6263,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,62.3737,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,31,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+#   => PR,32,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0
+#   => PR,33,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.0
+#   => PR,34,396,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,35,396,0.0,0.0,62.1212,37.6263,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,36,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.0
+#   => PR,37,396,0.0,0.0,37.8788,61.8687,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,38,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,39,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.4949,0.0,0.0,0.5051,0.0,0.0,0.0,0.0,0.0
+#   => PR,40,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,41,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,37.8788,0.0,0.0,0.0,0.0,0.0,62.1212,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,42,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0
+#   => PR,43,396,0.0,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,44,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,45,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,46,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,47,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,48,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,49,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,50,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.0
+#   => PR,51,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,52,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,53,396,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,54,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,55,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,56,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0
+#   => PR,57,396,0.0,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,0.0,99.4949,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,58,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,59,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0
+#   => PR,60,396,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,61,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,62,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,63,396,0.0,0.0,0.0,0.0,0.0,0.0,0.2525,0.0,0.0,37.8788,0.0,0.0,61.8687,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,64,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,62.1212,0.0,37.8788,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,65,396,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,66,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,67,396,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,68,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,69,396,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,70,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,71,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,62.1212,37.8788,0.0,0.0,0.0
+#   => PR,72,396,0.0,0.0,0.0,37.8788,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,62.1212,0.0,0.0,0.0,0.0
+#   => PR,73,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,74,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+#   => PR,75,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0
+#   => PR,76,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,77,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,78,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,79,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,80,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+#   => PR,81,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,82,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0
+#   => PR,83,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.4949,0.0,0.0,0.0,0.5051,0.0,0.0,0.0,0.0,0.0
+#   => PR,84,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,85,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,86,396,0.0,0.0,0.0,0.5051,0.0,99.4949,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,87,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,88,396,0.0,0.0,62.1212,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,37.8788,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,89,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,90,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,91,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+#   => PR,92,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,93,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,94,396,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,95,396,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,96,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0
+#   => PR,97,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+#   => PR,98,396,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,99.7475,0.0,0.0,0.0,0.2525,0.0,0.0,0.0,0.0,0.0
+#   => PR,99,396,0.0,0.0,0.0,0.0,100.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
+
+
+
+module ViralSeq
+
+  # drug resistant mutation summary. input: amino acid array and starting codon, output, hash of summary
+  def self.sdrm_nrti(aa_array,start_aa=1)
+    out_hash = {}
+    sdrm = {}
+    sdrm[41] = ['M',['L']]
+    sdrm[65] = ['K',['R']]
+    sdrm[67] = ['D',['N','G','E']]
+    sdrm[69] = ['T',['D']]
+    sdrm[70] = ['K',['R','E']]
+    sdrm[74] = ['L',['V','I']]
+    sdrm[75] = ['V',['M','T','A','S']]
+    sdrm[77] = ['F',['L']]
+    sdrm[115] = ['Y',['F']]
+    sdrm[116] = ['F',['Y']]
+    sdrm[151] = ['Q',['M']]
+    sdrm[184] = ['M',['V','I']]
+    sdrm[210] = ['L',['W']]
+    sdrm[215] = ["T",["Y","F","I","C","D","V","E"]]
+    sdrm[219] = ["K",["Q","E","N","R"]]
+    aa_length = aa_array.size
+    end_aa = start_aa + aa_length - 1
+    (start_aa..end_aa).each do |position|
+      array_position = position - start_aa
+      if sdrm.keys.include?(position)
+        wt_aa = sdrm[position][0]
+        test_aa = aa_array[array_position]
+        if test_aa.size == 1
+          unless wt_aa == test_aa
+            if sdrm[position][1].include?(test_aa)
+              out_hash[position] = [wt_aa,test_aa]
+            end
+          end
+        else
+          test_aa_array = test_aa.split("/")
+          if (test_aa_array & sdrm[position][1])
+            out_hash[position] = [wt_aa,test_aa]
+          end
+        end
+
+      end
+    end
+    return out_hash
+  end
+
+  def self.sdrm_nnrti(aa_array,start_aa=1)
+    out_hash = {}
+    sdrm = {}
+    sdrm[100] = ['L',['I']]
+    sdrm[101] = ['K',['E','P']]
+    sdrm[103] = ['K',['N','S']]
+    sdrm[106] = ['V',['M','A']]
+    sdrm[179] = ['V',['F','D']]
+    sdrm[181] = ['Y',['C','I','V']]
+    sdrm[188] = ['Y',['L','H','C']]
+    sdrm[190] = ['G',['A','S','E']]
+    sdrm[225] = ['P',['H']]
+    sdrm[230] = ['M',['L']]
+    aa_length = aa_array.size
+    end_aa = start_aa + aa_length - 1
+    (start_aa..end_aa).each do |position|
+      array_position = position - start_aa
+      if sdrm.keys.include?(position)
+        wt_aa = sdrm[position][0]
+        test_aa = aa_array[array_position]
+        if test_aa.size == 1
+          unless wt_aa == test_aa
+            if sdrm[position][1].include?(test_aa)
+              out_hash[position] = [wt_aa,test_aa]
+            end
+          end
+        else
+          test_aa_array = test_aa.split("/")
+          if (test_aa_array & sdrm[position][1])
+            out_hash[position] = [wt_aa,test_aa]
+          end
+        end
+
+      end
+    end
+    return out_hash
+  end
+
+  #HIV protease surveillance mutations
+
+  def self.hiv_protease(aa_array,start_aa=1)
+    out_hash = {}
+    sdrm = {}
+    sdrm[23] = ['L',['I']]
+    sdrm[24] = ['L',['I']]
+    sdrm[30] = ['D',['N']]
+    sdrm[32] = ['V',['I']]
+    sdrm[46] = ['M',['I','L','V']] # M46V not on the SDRM list but we still include it.
+    sdrm[47] = ['I',['V','A']]
+    sdrm[48] = ['G',['V','M']]
+    sdrm[50] = ['I',['V','L']]
+    sdrm[53] = ['F',['Y']]
+    sdrm[54] = ['I',['V','L','M','T','A','S']]
+    sdrm[73] = ['G',['S','T','C','A']]
+    sdrm[76] = ['L',['V']]
+    sdrm[82] = ['V',['A','T','S','F','L','C','M']]
+    sdrm[83] = ['N',['D']]
+    sdrm[84] = ['I',['V','A','C']]
+    sdrm[85] = ['I',['V']]
+    sdrm[88] = ['N',['D','S']]
+    sdrm[90] = ['L',['M']]
+    aa_length = aa_array.size
+    end_aa = start_aa + aa_length - 1
+    (start_aa..end_aa).each do |position|
+      array_position = position - start_aa
+      if sdrm.keys.include?(position)
+        wt_aa = sdrm[position][0]
+        test_aa = aa_array[array_position]
+        if test_aa.size == 1
+          unless wt_aa == test_aa
+            if sdrm[position][1].include?(test_aa)
+              out_hash[position] = [wt_aa,test_aa]
+            end
+          end
+        else
+          test_aa_array = test_aa.split("/")
+          if (test_aa_array & sdrm[position][1])
+            out_hash[position] = [wt_aa,test_aa]
+          end
+        end
+      end
+    end
+    return out_hash
+  end
+
+  #HIV integrase drug resistance mutations
+
+  def self.sdrm_int(aa_array,start_aa=1)
+    out_hash = {}
+    sdrm = {}
+    sdrm[66] = ['T',['A','I','K']]
+    sdrm[74] = ['L',['M']]
+    sdrm[92] = ['E',['Q']]
+    sdrm[95] = ['Q',['K']]
+    sdrm[97] = ['T',['A']]
+    sdrm[121] = ['F',['Y']]
+    sdrm[140] = ['G',['A','S','C']]
+    sdrm[143] = ["Y",["C","H","R"]]
+    sdrm[147] = ['S',['G']]
+    sdrm[148] = ['Q',['H','K','R']]
+    sdrm[155] = ['N',['S','H']]
+    aa_length = aa_array.size
+    end_aa = start_aa + aa_length - 1
+    (start_aa..end_aa).each do |position|
+      array_position = position - start_aa
+      if sdrm.keys.include?(position)
+        wt_aa = sdrm[position][0]
+        test_aa = aa_array[array_position]
+        if test_aa.size == 1
+          unless wt_aa == test_aa
+            if sdrm[position][1].include?(test_aa)
+              out_hash[position] = [wt_aa,test_aa]
+            end
+          end
+        else
+          test_aa_array = test_aa.split("/")
+          if (test_aa_array & sdrm[position][1])
+            out_hash[position] = [wt_aa,test_aa]
+          end
+        end
+
+      end
+    end
+    return out_hash
+  end
+
+  # input sequence hash, and Poisson cutoff for minority variants.
+  # HIV-1 PR region SDRM based on HIVDB.stanford.edu
+  # only for MPID-DR MiSeq sequences, PR codon 1-99
+  # return [substitution rate with 95% CI, halpotype abundance with 95% CI, amino acid sequence report spreadsheet]
+  def self.sdrm_pr_bulk(sequences, cutoff = 0)
+    region = "PR"
+    rf_label = 0
+    start_codon_number = 1
+    n_seq = sequences.size
+    mut = {}
+    mut_com = []
+    aa = {}
+    point_mutation_list = []
+    sequences.each do |name,seq|
+      s = ViralSeq::Sequence.new(name,seq)
+      s.get_aa_array(rf_label)
+      aa_seq = s.aa_array
+      aa[name] = aa_seq.join("")
+      record = ViralSeq.hiv_protease(aa_seq)
+      mut_com << record
+      record.each do |position,mutation|
+        if mut[position]
+          mut[position][1] << mutation[1]
+        else
+          mut[position] = [mutation[0],[]]
+          mut[position][1] << mutation[1]
+        end
+      end
+    end
+    mut.each do |position,mutation|
+      wt = mutation[0]
+      mut_list = mutation[1]
+      count_mut_list = ViralSeq.count(mut_list)
+      count_mut_list.each do |m,number|
+        ci = ViralSeq.r_binom_CI(number, n_seq)
+        label = number < cutoff ? "*" : ""
+        point_mutation_list << [region, n_seq, position, wt, m, number, (number/n_seq.to_f).round(5), ci[0], ci[1], label]
+      end
+    end
+    point_mutation_list.sort_by! {|record| record[2]}
+
+    link = ViralSeq.count(mut_com)
+    link2 = {}
+    link.each do |k,v|
+      pattern = []
+      if k.size == 0
+        pattern = ['WT']
+      else
+        k.each do |p,m|
+          pattern << (m[0] + p.to_s + m[1])
+        end
+      end
+      link2[pattern.join("+")] = v
+    end
+    linkage_list = []
+    link2.sort_by{|_key,value|value}.reverse.to_h.each do |k,v|
+      ci = ViralSeq.r_binom_CI(v, n_seq)
+      label = v < cutoff ? "*" : ""
+      linkage_list << [region, n_seq, k, v, (v/n_seq.to_f).round(5), ci[0], ci[1], label]
+    end
+
+    report_list = []
+
+    div_aa = {}
+    aa_start = start_codon_number
+
+    aa_size = aa.values[0].size - 1
+
+    (0..aa_size).to_a.each do |p|
+      aas = []
+      aa.values.each do |r1|
+        aas << r1[p]
+      end
+      count_aas = ViralSeq.count(aas)
+      div_aa[aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h
+      aa_start += 1
+    end
+
+    div_aa.each do |k,v|
+      record = [region, k, n_seq]
+      ViralSeq::AMINO_ACID_LIST.each do |amino_acid|
+        aa_count = v[amino_acid]
+        record << (aa_count.to_f/n_seq*100).round(4)
+      end
+      report_list << record
+    end
+
+    return [point_mutation_list, linkage_list, report_list]
+  end
+
+
+  #input sequence hash, and Poisson cutoff for minority variants.
+  #HIV-1 RT region SDRM based on HIVDB.stanford.edu
+  #only for MPID-DR MiSeq sequences
+  #RT codon 34-122, 152-236 two regions are linked.
+  #return [substitution rate with 95% CI, halpotype abundance with 95% CI, amino acid sequence report spreadsheet]
+  def self.sdrm_rt_bulk(sequences, cutoff = 0)
+    region = "RT"
+    rf_label = 1
+    start_codon_number = 34
+    gap = "AGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCAC"
+
+    n_seq = sequences.size
+    mut_nrti = {}
+    mut_nnrti = {}
+    mut_com = []
+    r1_aa = {}
+    r2_aa = {}
+    point_mutation_list = []
+    sequences.each do |name,seq|
+      r1 = seq[0,267]
+      r2 = seq[267..-1]
+      seq = r1 + gap + r2
+      s = ViralSeq::Sequence.new(name,seq)
+      s.get_aa_array(rf_label)
+      aa_seq = s.aa_array
+
+      r1_aa[name] = aa_seq[0,89].join("")
+      r2_aa[name] = aa_seq[-85..-1].join("")
+      nrti = ViralSeq.sdrm_nrti(aa_seq,start_codon_number)
+      nnrti = ViralSeq.sdrm_nnrti(aa_seq,start_codon_number)
+      mut_com << (nrti.merge(nnrti))
+
+      nrti.each do |position,mutation|
+        if mut_nrti[position]
+          mut_nrti[position][1] << mutation[1]
+        else
+          mut_nrti[position] = [mutation[0],[]]
+          mut_nrti[position][1] << mutation[1]
+        end
+      end
+      nnrti.each do |position,mutation|
+        if mut_nnrti[position]
+          mut_nnrti[position][1] << mutation[1]
+        else
+          mut_nnrti[position] = [mutation[0],[]]
+          mut_nnrti[position][1] << mutation[1]
+        end
+      end
+    end
+
+    mut_nrti.each do |position,mutation|
+      wt = mutation[0]
+      mut_list = mutation[1]
+      count_mut_list = ViralSeq.count(mut_list)
+      count_mut_list.each do |m,number|
+        ci = ViralSeq.r_binom_CI(number, n_seq)
+        label = number < cutoff ? "*" : ""
+        point_mutation_list << ["NRTI", n_seq, position, wt, m, number, (number/n_seq.to_f).round(5), ci[0], ci[1], label]
+      end
+    end
+
+    mut_nnrti.each do |position,mutation|
+      wt = mutation[0]
+      mut_list = mutation[1]
+      count_mut_list = ViralSeq.count(mut_list)
+      count_mut_list.each do |m,number|
+        ci = ViralSeq.r_binom_CI(number, n_seq)
+        label = number < cutoff ? "*" : ""
+        point_mutation_list << ["NNRTI", n_seq, position, wt, m, number, (number/n_seq.to_f).round(5), ci[0], ci[1], label]
+      end
+    end
+    point_mutation_list.sort_by! {|record| record[2]}
+
+    link = ViralSeq.count(mut_com)
+    link2 = {}
+    link.each do |k,v|
+      pattern = []
+      if k.size == 0
+        pattern = ['WT']
+      else
+        k.each do |p,m|
+          pattern << (m[0] + p.to_s + m[1])
+        end
+      end
+      link2[pattern.join("+")] = v
+    end
+    linkage_list = []
+    link2.sort_by{|_key,value|value}.reverse.to_h.each do |k,v|
+      ci = ViralSeq.r_binom_CI(v, n_seq)
+      label = v < cutoff ? "*" : ""
+      linkage_list << [region, n_seq, k, v, (v/n_seq.to_f).round(5), ci[0], ci[1], label]
+    end
+
+    report_list = []
+
+    div_aa = {}
+    r1_aa_start = 34
+    r2_aa_start = 152
+
+    r1_aa_size = r1_aa.values[0].size - 1
+    r2_aa_size = r2_aa.values[0].size - 1
+
+    (0..r1_aa_size).to_a.each do |p|
+      aas = []
+      r1_aa.values.each do |r1|
+        aas << r1[p]
+      end
+      count_aas = ViralSeq.count(aas)
+      div_aa[r1_aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h
+      r1_aa_start += 1
+    end
+
+    (0..r2_aa_size).to_a.each do |p|
+      aas = []
+      r2_aa.values.each do |r1|
+        aas << r1[p]
+      end
+      count_aas = ViralSeq.count(aas)
+      div_aa[r2_aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h
+      r2_aa_start += 1
+    end
+
+    div_aa.each do |k,v|
+      record = [region, k, n_seq]
+      ViralSeq::AMINO_ACID_LIST.each do |amino_acid|
+        aa_count = v[amino_acid]
+        record << (aa_count.to_f/n_seq*100).round(4)
+      end
+      report_list << record
+    end
+
+    return [point_mutation_list, linkage_list, report_list]
+  end
+
+  #input sequence hash, and Poisson cutoff for minority variants.
+  #HIV-1 IN region SDRM based on HIVDB.stanford.edu
+  #only for MPID-DR MiSeq sequences
+  #IN codon 53-174
+  #return [substitution rate with 95% CI, halpotype abundance with 95% CI, amino acid sequence report spreadsheet]
+  def self.sdrm_in_bulk(sequences, cutoff = 0)
+    region = "IN"
+    rf_label = 2
+    start_codon_number = 53
+    n_seq = sequences.size
+    mut = {}
+    mut_com = []
+    aa = {}
+    point_mutation_list = []
+    sequences.each do |name,seq|
+      s = ViralSeq::Sequence.new(name,seq)
+      s.get_aa_array(rf_label)
+      aa_seq = s.aa_array
+      aa[name] = aa_seq.join("")
+      record = ViralSeq.sdrm_int(aa_seq, start_codon_number)
+      mut_com << record
+      record.each do |position,mutation|
+        if mut[position]
+          mut[position][1] << mutation[1]
+        else
+          mut[position] = [mutation[0],[]]
+          mut[position][1] << mutation[1]
+        end
+      end
+    end
+    mut.each do |position,mutation|
+      wt = mutation[0]
+      mut_list = mutation[1]
+      count_mut_list = ViralSeq.count(mut_list)
+      count_mut_list.each do |m,number|
+        ci = ViralSeq.r_binom_CI(number, n_seq)
+        label = number < cutoff ? "*" : ""
+        point_mutation_list << [region, n_seq, position, wt, m, number, (number/n_seq.to_f).round(5), ci[0], ci[1], label]
+      end
+    end
+    point_mutation_list.sort_by! {|record| record[2]}
+
+    link = ViralSeq.count(mut_com)
+    link2 = {}
+    link.each do |k,v|
+      pattern = []
+      if k.size == 0
+        pattern = ['WT']
+      else
+        k.each do |p,m|
+          pattern << (m[0] + p.to_s + m[1])
+        end
+      end
+      link2[pattern.join("+")] = v
+    end
+    linkage_list = []
+    link2.sort_by{|_key,value|value}.reverse.to_h.each do |k,v|
+      ci = ViralSeq.r_binom_CI(v, n_seq)
+      label = v < cutoff ? "*" : ""
+      linkage_list << [region, n_seq, k, v, (v/n_seq.to_f).round(5), ci[0], ci[1], label]
+    end
+
+    report_list = []
+
+    div_aa = {}
+    aa_start = start_codon_number
+
+    aa_size = aa.values[0].size - 1
+
+    (0..aa_size).to_a.each do |p|
+      aas = []
+      aa.values.each do |r1|
+        aas << r1[p]
+      end
+      count_aas = ViralSeq.count(aas)
+      div_aa[aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h
+      aa_start += 1
+    end
+
+    div_aa.each do |k,v|
+      record = [region, k, n_seq]
+      ViralSeq::AMINO_ACID_LIST.each do |amino_acid|
+        aa_count = v[amino_acid]
+        record << (aa_count.to_f/n_seq*100).round(4)
+      end
+      report_list << record
+    end
+
+    return [point_mutation_list, linkage_list, report_list]
+  end
+
+end