trackler 2.2.1.91 → 2.2.1.92

data/problem-specifications/exercises/markdown/canonical-data.json

@@ -1,6 +1,6 @@
 {
   "exercise": "markdown",
-  "version": "1.1.0",
+  "version": "1.2.0",
   "comments": [
     "Markdown is a shorthand for creating HTML from text strings."
   ],
@@ -8,56 +8,74 @@
     {
       "description": "parses normal text as a paragraph",
       "property": "parse",
-      "input": "This will be a paragraph",
+      "input": {
+        "markdown": "This will be a paragraph"
+      },
       "expected": "<p>This will be a paragraph</p>"
     },
     {
       "description": "parsing italics",
       "property": "parse",
-      "input": "_This will be italic_",
+      "input": {
+        "markdown": "_This will be italic_"
+      },
       "expected": "<p><em>This will be italic</em></p>"
     },
     {
       "description": "parsing bold text",
       "property": "parse",
-      "input": "__This will be bold__",
+      "input": {
+        "markdown": "__This will be bold__"
+      },
       "expected": "<p><strong>This will be bold</strong></p>"
     },
     {
       "description": "mixed normal, italics and bold text",
       "property": "parse",
-      "input": "This will _be_ __mixed__",
+      "input": {
+        "markdown": "This will _be_ __mixed__"
+      },
       "expected": "<p>This will <em>be</em> <strong>mixed</strong></p>"
     },
     {
       "description": "with h1 header level",
       "property": "parse",
-      "input": "# This will be an h1",
+      "input": {
+        "markdown": "# This will be an h1"
+      },
       "expected": "<h1>This will be an h1</h1>"
     },
     {
       "description": "with h2 header level",
       "property": "parse",
-      "input": "## This will be an h2",
+      "input": {
+        "markdown": "## This will be an h2"
+      },
       "expected": "<h2>This will be an h2</h2>"
     },
     {
       "description": "with h6 header level",
       "property": "parse",
-      "input": "###### This will be an h6",
+      "input": {
+        "markdown": "###### This will be an h6"
+      },
       "expected": "<h6>This will be an h6</h6>"
     },
     {
       "description": "unordered lists",
       "property": "parse",
-      "input": "* Item 1\n* Item 2",
+      "input": {
+        "markdown": "* Item 1\n* Item 2"
+      },
       "expected": "<ul><li>Item 1</li><li>Item 2</li></ul>"
     },
     {
       "description": "With a little bit of everything",
       "property": "parse",
-      "input": "# Header!\n* __Bold Item__\n* _Italic Item_",
+      "input": {
+        "markdown": "# Header!\n* __Bold Item__\n* _Italic Item_"
+      },
       "expected": "<h1>Header!</h1><ul><li><strong>Bold Item</strong></li><li><em>Italic Item</em></li></ul>"
     }
   ]
-}
+}

data/problem-specifications/exercises/minesweeper/canonical-data.json

@@ -1,6 +1,6 @@
 {
   "exercise": "minesweeper",
-  "version": "1.0.0",
+  "version": "1.1.0",
   "comments": [
     " The expected outputs are represented as arrays of strings to   ",
     " improve readability in this JSON file.                         ",
@@ -11,23 +11,29 @@
     {
       "description": "no rows",
       "property": "annotate",
-      "input": [],
+      "input": {
+        "minefield": []
+      },
       "expected": []
     },
     {
       "description": "no columns",
       "property": "annotate",
-      "input": [""],
+      "input": {
+        "minefield": [""]
+      },
       "expected": [""]
     },
     {
       "description": "no mines",
       "property": "annotate",
-      "input": [
-        "   ",
-        "   ",
-        "   "
-      ],
+      "input": {
+        "minefield": [
+          "   ",
+          "   ",
+          "   "
+        ]
+      },
       "expected": [
         "   ",
         "   ",
@@ -35,13 +41,15 @@
       ]
     },
     {
-      "description": "board with only mines",
+      "description": "minefield with only mines",
       "property": "annotate",
-      "input": [
-        "***",
-        "***",
-        "***"
-      ],
+      "input": {
+        "minefield": [
+          "***",
+          "***",
+          "***"
+        ]
+      },
       "expected": [
         "***",
         "***",
@@ -51,11 +59,13 @@
     {
       "description": "mine surrounded by spaces",
       "property": "annotate",
-      "input": [
-        "   ",
-        " * ",
-        "   "
-      ],
+      "input": {
+        "minefield": [
+          "   ",
+          " * ",
+          "   "
+        ]
+      },
       "expected": [
         "111",
         "1*1",
@@ -65,11 +75,13 @@
     {
       "description": "space surrounded by mines",
       "property": "annotate",
-      "input": [
-        "***",
-        "* *",
-        "***"
-      ],
+      "input": {
+        "minefield": [
+          "***",
+          "* *",
+          "***"
+        ]
+      },
       "expected": [
         "***",
         "*8*",
@@ -79,25 +91,31 @@
     {
       "description": "horizontal line",
       "property": "annotate",
-      "input": [" * * "],
+      "input": {
+        "minefield": [" * * "]
+      },
       "expected": ["1*2*1"]
     },
     {
       "description": "horizontal line, mines at edges",
       "property": "annotate",
-      "input": ["*   *"],
+      "input": {
+        "minefield": ["*   *"]
+      },
       "expected": ["*1 1*"]
     },
     {
       "description": "vertical line",
       "property": "annotate",
-      "input": [
-        " ",
-        "*",
-        " ",
-        "*",
-        " "
-      ],
+      "input": {
+        "minefield": [
+          " ",
+          "*",
+          " ",
+          "*",
+          " "
+        ]
+      },
       "expected": [
         "1",
         "*",
@@ -109,13 +127,15 @@
     {
       "description": "vertical line, mines at edges",
       "property": "annotate",
-      "input": [
-        "*",
-        " ",
-        " ",
-        " ",
-        "*"
-      ],
+      "input": {
+        "minefield": [
+          "*",
+          " ",
+          " ",
+          " ",
+          "*"
+        ]
+      },
       "expected": [
         "*",
         "1",
@@ -127,13 +147,15 @@
     {
       "description": "cross",
       "property": "annotate",
-      "input": [
-        "  *  ",
-        "  *  ",
-        "*****",
-        "  *  ",
-        "  *  "
-      ],
+      "input": {
+        "minefield": [
+          "  *  ",
+          "  *  ",
+          "*****",
+          "  *  ",
+          "  *  "
+        ]
+      },
       "expected": [
         " 2*2 ",
         "25*52",
@@ -143,16 +165,18 @@
       ]
     },
     {
-      "description": "large board",
+      "description": "large minefield",
       "property": "annotate",
-      "input": [
-        " *  * ",
-        "  *   ",
-        "    * ",
-        "   * *",
-        " *  * ",
-        "      "
-      ],
+      "input": {
+        "minefield": [
+          " *  * ",
+          "  *   ",
+          "    * ",
+          "   * *",
+          " *  * ",
+          "      "
+        ]
+      },
       "expected": [
         "1*22*1",
         "12*322",

data/problem-specifications/exercises/minesweeper/metadata.yml

@@ -1,2 +1,2 @@
 ---
-blurb: "Add the numbers to a minesweeper board" 
+blurb: "Add the numbers to a minesweeper board"

data/problem-specifications/exercises/nth-prime/canonical-data.json

@@ -1,36 +1,48 @@
 {
   "exercise": "nth-prime",
-  "version": "2.0.0",
+  "version": "2.1.0",
   "cases": [
     {
       "description": "first prime",
       "property": "prime",
-      "input": 1,
+      "input": {
+        "number": 1
+      },
       "expected": 2
     },
     {
       "description": "second prime",
       "property": "prime",
-      "input": 2,
+      "input": {
+        "number": 2
+      },
       "expected": 3
     },
     {
       "description": "sixth prime",
       "property": "prime",
-      "input": 6,
+      "input": {
+        "number": 6
+      },
       "expected": 13
     },
     {
       "description": "big prime",
       "property": "prime",
-      "input": 10001,
+      "input": {
+        "number": 10001
+      },
       "expected": 104743
     },
     {
       "description": "there is no zeroth prime",
       "property": "prime",
-      "input": 0,
-      "expected": { "error": "there is no zeroth prime" }
+      "input": {
+        "number": 0
+      },
+      "expected": {
+        "error": "there is no zeroth prime"
+      }
     }
   ]
-}
+}

data/problem-specifications/exercises/nucleotide-count/canonical-data.json

@@ -1,6 +1,6 @@
 {
   "exercise": "nucleotide-count",
-  "version": "1.2.0",
+  "version": "1.3.0",
   "cases": [
     {
       "description": "count all nucleotides in a strand",
@@ -8,7 +8,9 @@
         {
           "description": "empty strand",
           "property": "nucleotideCounts",
-          "strand": "",
+          "input": {
+            "strand": ""
+          },
           "expected": {
             "A": 0,
             "C": 0,
@@ -19,7 +21,9 @@
         {
           "description": "can count one nucleotide in single-character input",
           "property": "nucleotideCounts",
-          "strand": "G",
+          "input": {
+            "strand": "G"
+          },
           "expected": {
             "A": 0,
             "C": 0,
@@ -30,7 +34,9 @@
         {
           "description": "strand with repeated nucleotide",
           "property": "nucleotideCounts",
-          "strand": "GGGGGGG",
+          "input": {
+            "strand": "GGGGGGG"
+          },
           "expected": {
             "A": 0,
             "C": 0,
@@ -41,7 +47,9 @@
         {
           "description": "strand with multiple nucleotides",
           "property": "nucleotideCounts",
-          "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
+          "input": {
+            "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+          },
           "expected": {
             "A": 20,
             "C": 12,
@@ -52,7 +60,9 @@
         {
           "description": "strand with invalid nucleotides",
           "property": "nucleotideCounts",
-          "strand": "AGXXACT",
+          "input": {
+            "strand": "AGXXACT"
+          },
           "expected": {
             "error": "Invalid nucleotide in strand"
           }
@@ -60,4 +70,4 @@
       ]
     }
   ]
-}
+}

data/problem-specifications/exercises/pascals-triangle/canonical-data.json

@@ -1,6 +1,6 @@
 {
   "exercise": "pascals-triangle",
-  "version": "1.2.0",
+  "version": "1.3.0",
   "comments": [
     "Expectations are represented here as an array of arrays.",
     "How you represent this idiomatically in your language is up to you.",
@@ -13,55 +13,73 @@
         {
           "description": "zero rows",
           "property": "rows",
-          "count": 0,
+          "input": {
+            "count": 0
+          },
           "expected": []
         },
         {
           "description": "single row",
           "property": "rows",
-          "count": 1,
+          "input": {
+            "count": 1
+          },
           "expected": [[1]]
         },
         {
           "description": "two rows",
           "property": "rows",
-          "count": 2,
+          "input": {
+            "count": 2
+          },
           "expected": [[1], [1, 1]]
         },
         {
           "description": "three rows",
           "property": "rows",
-          "count": 3,
+          "input": {
+            "count": 3
+          },
           "expected": [[1], [1, 1], [1, 2, 1]]
         },
         {
           "description": "four rows",
           "property": "rows",
-          "count": 4,
+          "input": {
+            "count": 4
+          },
           "expected": [[1], [1, 1], [1, 2, 1], [1, 3, 3, 1]]
         },
         {
           "description": "five rows",
           "property": "rows",
-          "count": 5,
+          "input": {
+            "count": 5
+          },
           "expected": [[1], [1, 1], [1, 2, 1], [1, 3, 3, 1], [1, 4, 6, 4, 1]]
         },
         {
           "description": "six rows",
           "property": "rows",
-          "count": 6,
+          "input": {
+            "count": 6
+          },
           "expected": [[1], [1, 1], [1, 2, 1], [1, 3, 3, 1], [1, 4, 6, 4, 1], [1, 5, 10, 10, 5, 1]]
         },
         {
           "description": "ten rows",
           "property": "rows",
-          "count": 10,
+          "input": {
+            "count": 10
+          },
           "expected": [[1], [1, 1], [1, 2, 1], [1, 3, 3, 1], [1, 4, 6, 4, 1], [1, 5, 10, 10, 5, 1], [1, 6, 15, 20, 15, 6, 1], [1, 7, 21, 35, 35, 21, 7, 1], [1, 8, 28, 56, 70, 56, 28, 8, 1], [1, 9, 36, 84, 126, 126, 84, 36, 9, 1]]
         },
         {
           "description": "negative rows",
           "property": "rows",
-          "count": -1,
+          "input": {
+            "count": -1
+          },
           "expected": -1
         }
       ]