trackler 2.2.1.52 → 2.2.1.53

data/tracks/kotlin/exercises/largest-series-product/src/test/kotlin/SeriesInvalidInputTest.kt

@@ -1,30 +0,0 @@
-
-import org.junit.Test
-import org.junit.Ignore
-
-class SeriesInvalidInputTest {
-
-
-    @Test(expected = IllegalArgumentException::class)
-    fun nonDigitCharacters() {
-        Series("1234a5")
-    }
-
-    @Ignore
-    @Test(expected = IllegalArgumentException::class)
-    fun negativeSpan() {
-        Series("12345").getLargestProduct(-1)
-    }
-
-    @Ignore
-    @Test(expected = IllegalArgumentException::class)
-    fun spanLargerThanStringSize() {
-        Series("123").getLargestProduct(4)
-    }
-
-    @Ignore
-    @Test(expected = IllegalArgumentException::class)
-    fun spanLargerThanStringSizeUsingEmptyString() {
-        Series("").getLargestProduct(1)
-    }
-}

data/tracks/kotlin/exercises/largest-series-product/src/test/kotlin/SeriesValidInputTest.kt

@@ -1,34 +0,0 @@
-
-import org.junit.Test
-import org.junit.Ignore
-import org.junit.runner.RunWith
-import org.junit.runners.Parameterized
-import kotlin.test.assertEquals
-
-@RunWith(Parameterized::class)
-class SeriesValidInputTest(val input: String, val span: Int, val expectedOutput: Long) {
-
-    companion object {
-        @JvmStatic
-        @Parameterized.Parameters(name = "{index}: lsp({0},{1})={2}")
-        fun data() = listOf(
-                arrayOf("0123456789", 2, 72),
-                arrayOf("576802143", 2, 48),
-                arrayOf("0123456789", 3, 504),
-                arrayOf("1027839564", 3, 270),
-                arrayOf("0123456789", 5, 15120),
-                arrayOf("73167176531330624919225119674426574742355349194934", 6, 23520),
-                arrayOf("52677741234314237566414902593461595376319419139427", 6, 28350),
-                arrayOf("7316717653133062491922511967442657474235534919493496983520312774506326239578318016984801869478851843858615607891129494954595017379583319528532088055111254069874715852386305071569329096329522744304355766896648950445244523161731856403098711121722383113622298934233803081353362766142828064444866452387493035890729629049156044077239071381051585930796086670172427121883998797908792274921901699720888093776657273330010533678812202354218097512545405947522435258490771167055601360483958644670632441572215539753697817977846174064955149290862569321978468622482839722413756570560574902614079729686524145351004748216637048440319989000889524345065854122758866688116427171479924442928230863465674813919123162824586178664583591245665294765456828489128831426076900422421902267105562632111110937054421750694165896040807198403850962455444362981230987879927244284909188845801561660979191338754992005240636899125607176060588611646710940507754100225698315520005593572972571636269561882670428252483600823257530420752963450", 13, 23514624000),
-                arrayOf("0000", 2, 0),
-                arrayOf("99099", 3, 0),
-                arrayOf("", 0, 1)
-        )
-    }
-
-
-    @Test
-    fun validInputTest() {
-        assertEquals(expectedOutput, Series(input).getLargestProduct(span))
-    }
-}

data/tracks/kotlin/exercises/nucleotide-count/src/test/kotlin/NucleotideTest.kt

@@ -1,87 +0,0 @@
-import org.junit.Test
-import org.junit.Ignore;
-import kotlin.test.assertEquals
-
-class NucleotideTest {
-
-
-    @Test
-    fun emptyDnaStringHasNoAdenosine() {
-        val dna = DNA("");
-
-        assertEquals(0, dna.count('A'))
-    }
-
-    @Ignore
-    @Test
-    fun emptyDnaStringHasNoNucleotides() {
-        val dna = DNA("");
-        val expected = mapOf('A' to 0, 'C' to 0, 'G' to 0, 'T' to 0)
-
-        assertEquals(expected, dna.nucleotideCounts)
-    }
-
-    @Ignore
-    @Test
-    fun repetitiveCytidineGetsCounted() {
-        val dna = DNA("CCCCC");
-        assertEquals(5, dna.count('C'))
-    }
-
-    @Ignore
-    @Test
-    fun repetitiveSequenceWithOnlyGuanosine() {
-        val dna = DNA("GGGGGGGG");
-        val expected = mapOf('A' to 0, 'C' to 0, 'G' to 8, 'T' to 0)
-
-        assertEquals(expected, dna.nucleotideCounts)
-    }
-
-    @Ignore
-    @Test
-    fun countsOnlyThymidine() {
-        val dna = DNA("GGGGGTAACCCGG");
-
-        assertEquals(1, dna.count('T'))
-    }
-
-    @Ignore
-    @Test
-    fun countsANucleotideOnlyOnce() {
-        val dna = DNA("CGATTGGG");
-
-        dna.count('T')
-        assertEquals(2, dna.count('T'))
-    }
-
-    @Ignore
-    @Test
-    fun dnaCountsDoNotChangeAfterCountingAdenosine() {
-        val dna = DNA("GATTACA");
-        val expected = mapOf('A' to 3, 'C' to 1, 'G' to 1, 'T' to 2)
-
-        dna.count('A');
-        assertEquals(expected, dna.nucleotideCounts)
-    }
-
-    @Ignore
-    @Test(expected = IllegalArgumentException::class)
-    fun validatesNucleotides() {
-        DNA("GX")
-    }
-
-    @Ignore
-    @Test(expected = IllegalArgumentException::class)
-    fun validatesNucleotidesCountInput() {
-        DNA("GACT").count('X');
-    }
-
-    @Ignore
-    @Test
-    fun countsAllNucleotides() {
-        val dna = DNA("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
-        val expected = mapOf('A' to 20, 'C' to 12, 'G' to 17, 'T' to 21)
-
-        assertEquals(expected, dna.nucleotideCounts)
-    }
-}