trackler 2.2.1.171 → 2.2.1.172

data/tracks/rust/exercises/minesweeper/README.md

@@ -39,11 +39,31 @@ Execute the tests with:
 $ cargo test
 ```
 
-All but the first test have been ignored.  After you get the first test to
-pass, remove the ignore flag (`#[ignore]`) from the next test and get the tests
-to pass again.  The test file is located in the `tests` directory.   You can
-also remove the ignore flag from all the tests to get them to run all at once
-if you wish.
+All but the first test have been ignored. After you get the first test to
+pass, open the tests source file wich is located in the `tests` directory
+and remove the `#[ignore]` flag from the next test and get the tests to pass
+again. Each separate test is a function with `#[test]` flag above it.
+Continue, until you pass every test. 
+
+If you wish to run all tests without editing the tests source file, use:
+
+```bash
+$ cargo test -- --ignored
+```
+
+To run a specific test, for example `some_test`, you can use:
+
+```bash
+$ cargo test some_test
+```
+
+If the specfic test is ignored use:
+
+```bash
+$ cargo test some_test -- --ignored
+```
+
+To learn more about Rust tests refer to the [online test documentation][rust-tests]
 
 Make sure to read the [Modules](https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html) chapter if you
 haven't already, it will help you with organizing your files.
@@ -57,6 +77,7 @@ If you want to know more about Exercism, take a look at the [contribution guide]
 [help-page]: http://exercism.io/languages/rust
 [modules]: https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html
 [cargo]: https://doc.rust-lang.org/book/second-edition/ch14-00-more-about-cargo.html
+[rust-tests]: https://doc.rust-lang.org/book/second-edition/ch11-02-running-tests.html
 
 ## Submitting Incomplete Solutions
 It's possible to submit an incomplete solution so you can see how others have completed the exercise.

data/tracks/rust/exercises/minesweeper/src/lib.rs

@@ -0,0 +1 @@
+

data/tracks/rust/exercises/nth-prime/README.md

@@ -21,11 +21,31 @@ Execute the tests with:
 $ cargo test
 ```
 
-All but the first test have been ignored.  After you get the first test to
-pass, remove the ignore flag (`#[ignore]`) from the next test and get the tests
-to pass again.  The test file is located in the `tests` directory.   You can
-also remove the ignore flag from all the tests to get them to run all at once
-if you wish.
+All but the first test have been ignored. After you get the first test to
+pass, open the tests source file wich is located in the `tests` directory
+and remove the `#[ignore]` flag from the next test and get the tests to pass
+again. Each separate test is a function with `#[test]` flag above it.
+Continue, until you pass every test. 
+
+If you wish to run all tests without editing the tests source file, use:
+
+```bash
+$ cargo test -- --ignored
+```
+
+To run a specific test, for example `some_test`, you can use:
+
+```bash
+$ cargo test some_test
+```
+
+If the specfic test is ignored use:
+
+```bash
+$ cargo test some_test -- --ignored
+```
+
+To learn more about Rust tests refer to the [online test documentation][rust-tests]
 
 Make sure to read the [Modules](https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html) chapter if you
 haven't already, it will help you with organizing your files.
@@ -39,6 +59,7 @@ If you want to know more about Exercism, take a look at the [contribution guide]
 [help-page]: http://exercism.io/languages/rust
 [modules]: https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html
 [cargo]: https://doc.rust-lang.org/book/second-edition/ch14-00-more-about-cargo.html
+[rust-tests]: https://doc.rust-lang.org/book/second-edition/ch11-02-running-tests.html
 
 ## Source
 

data/tracks/rust/exercises/nucleotide-codons/README.md

@@ -31,11 +31,31 @@ Execute the tests with:
 $ cargo test
 ```
 
-All but the first test have been ignored.  After you get the first test to
-pass, remove the ignore flag (`#[ignore]`) from the next test and get the tests
-to pass again.  The test file is located in the `tests` directory.   You can
-also remove the ignore flag from all the tests to get them to run all at once
-if you wish.
+All but the first test have been ignored. After you get the first test to
+pass, open the tests source file wich is located in the `tests` directory
+and remove the `#[ignore]` flag from the next test and get the tests to pass
+again. Each separate test is a function with `#[test]` flag above it.
+Continue, until you pass every test. 
+
+If you wish to run all tests without editing the tests source file, use:
+
+```bash
+$ cargo test -- --ignored
+```
+
+To run a specific test, for example `some_test`, you can use:
+
+```bash
+$ cargo test some_test
+```
+
+If the specfic test is ignored use:
+
+```bash
+$ cargo test some_test -- --ignored
+```
+
+To learn more about Rust tests refer to the [online test documentation][rust-tests]
 
 Make sure to read the [Modules](https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html) chapter if you
 haven't already, it will help you with organizing your files.
@@ -49,6 +69,7 @@ If you want to know more about Exercism, take a look at the [contribution guide]
 [help-page]: http://exercism.io/languages/rust
 [modules]: https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html
 [cargo]: https://doc.rust-lang.org/book/second-edition/ch14-00-more-about-cargo.html
+[rust-tests]: https://doc.rust-lang.org/book/second-edition/ch11-02-running-tests.html
 
 ## Submitting Incomplete Solutions
 It's possible to submit an incomplete solution so you can see how others have completed the exercise.

data/tracks/rust/exercises/nucleotide-codons/src/lib.rs

@@ -0,0 +1 @@
+

data/tracks/rust/exercises/nucleotide-codons/tests/codons.rs

@@ -15,7 +15,8 @@ fn test_cysteine_tgt() {
 
 #[test]
 #[ignore]
-fn test_cysteine_tgy() { // "compressed" name for TGT and TGC
+fn test_cysteine_tgy() {
+    // "compressed" name for TGT and TGC
     let info = codons::parse(make_pairs());
     assert_eq!(info.name_for("TGT"), info.name_for("TGY"));
     assert_eq!(info.name_for("TGC"), info.name_for("TGY"));
@@ -35,7 +36,6 @@ fn test_valine() {
     assert_eq!(info.name_for("GTN"), Ok("valine"));
 }
 
-
 #[test]
 #[ignore]
 fn test_isoleucine() {
@@ -104,13 +104,14 @@ fn make_pairs() -> Vec<(&'static str, &'static str)> {
         ("aspartic acid", vec!["GAT", "GAC"]),
         ("lysine", vec!["AAA", "AAG"]),
         ("arginine", vec!["CGT", "CGC", "CGA", "CGG", "AGA", "AGG"]),
-        ("stop codon", vec!["TAA", "TAG", "TGA"])];
+        ("stop codon", vec!["TAA", "TAG", "TGA"]),
+    ];
     let mut pairs = Vec::<(&'static str, &'static str)>::new();
     for (name, codons) in grouped.into_iter() {
         for codon in codons {
             pairs.push((codon, name));
         }
-    };
+    }
     pairs.sort_by(|&(_, a), &(_, b)| a.cmp(b));
-    return pairs
+    return pairs;
 }

data/tracks/rust/exercises/nucleotide-count/README.md

@@ -25,11 +25,31 @@ Execute the tests with:
 $ cargo test
 ```
 
-All but the first test have been ignored.  After you get the first test to
-pass, remove the ignore flag (`#[ignore]`) from the next test and get the tests
-to pass again.  The test file is located in the `tests` directory.   You can
-also remove the ignore flag from all the tests to get them to run all at once
-if you wish.
+All but the first test have been ignored. After you get the first test to
+pass, open the tests source file wich is located in the `tests` directory
+and remove the `#[ignore]` flag from the next test and get the tests to pass
+again. Each separate test is a function with `#[test]` flag above it.
+Continue, until you pass every test. 
+
+If you wish to run all tests without editing the tests source file, use:
+
+```bash
+$ cargo test -- --ignored
+```
+
+To run a specific test, for example `some_test`, you can use:
+
+```bash
+$ cargo test some_test
+```
+
+If the specfic test is ignored use:
+
+```bash
+$ cargo test some_test -- --ignored
+```
+
+To learn more about Rust tests refer to the [online test documentation][rust-tests]
 
 Make sure to read the [Modules](https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html) chapter if you
 haven't already, it will help you with organizing your files.
@@ -43,6 +63,7 @@ If you want to know more about Exercism, take a look at the [contribution guide]
 [help-page]: http://exercism.io/languages/rust
 [modules]: https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html
 [cargo]: https://doc.rust-lang.org/book/second-edition/ch14-00-more-about-cargo.html
+[rust-tests]: https://doc.rust-lang.org/book/second-edition/ch11-02-running-tests.html
 
 ## Source
 

data/tracks/rust/exercises/nucleotide-count/src/lib.rs

@@ -0,0 +1 @@
+

data/tracks/rust/exercises/nucleotide-count/tests/nucleotide-count.rs

@@ -12,7 +12,7 @@ fn check_dna(s: &str, pairs: &[(char, usize)]) {
         assert_eq!((k, m.remove(&k)), (k, Some(v)));
     }
     // may fail with a message that clearly shows all extra pairs in the map
-    assert_eq!(m.iter().collect::<Vec<(&char,&usize)>>(), vec!());
+    assert_eq!(m.iter().collect::<Vec<(&char, &usize)>>(), vec![]);
 }
 
 #[test]
@@ -59,17 +59,13 @@ fn counts_returns_result() {
 #[test]
 #[ignore]
 fn test_nucleotide_count_empty() {
-    check_dna(
-        "",
-        &[('A', 0), ('T', 0), ('C', 0), ('G', 0)]);
+    check_dna("", &[('A', 0), ('T', 0), ('C', 0), ('G', 0)]);
 }
 
 #[test]
 #[ignore]
 fn test_nucleotide_count_only_guanine() {
-    check_dna(
-        "GGGGGGGG",
-        &[('A', 0), ('T', 0), ('C', 0), ('G', 8)]);
+    check_dna("GGGGGGGG", &[('A', 0), ('T', 0), ('C', 0), ('G', 8)]);
 }
 
 #[test]
@@ -78,7 +74,8 @@ fn test_nucleotide_count_counts_all() {
     check_dna(
         "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAA\
          GAGTGTCTGATAGCAGC",
-        &[('A', 20), ('T', 21), ('C', 12), ('G', 17)]);
+        &[('A', 20), ('T', 21), ('C', 12), ('G', 17)],
+    );
 }
 
 #[test]

data/tracks/rust/exercises/ocr-numbers/README.md

@@ -91,11 +91,31 @@ Execute the tests with:
 $ cargo test
 ```
 
-All but the first test have been ignored.  After you get the first test to
-pass, remove the ignore flag (`#[ignore]`) from the next test and get the tests
-to pass again.  The test file is located in the `tests` directory.   You can
-also remove the ignore flag from all the tests to get them to run all at once
-if you wish.
+All but the first test have been ignored. After you get the first test to
+pass, open the tests source file wich is located in the `tests` directory
+and remove the `#[ignore]` flag from the next test and get the tests to pass
+again. Each separate test is a function with `#[test]` flag above it.
+Continue, until you pass every test. 
+
+If you wish to run all tests without editing the tests source file, use:
+
+```bash
+$ cargo test -- --ignored
+```
+
+To run a specific test, for example `some_test`, you can use:
+
+```bash
+$ cargo test some_test
+```
+
+If the specfic test is ignored use:
+
+```bash
+$ cargo test some_test -- --ignored
+```
+
+To learn more about Rust tests refer to the [online test documentation][rust-tests]
 
 Make sure to read the [Modules](https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html) chapter if you
 haven't already, it will help you with organizing your files.
@@ -109,6 +129,7 @@ If you want to know more about Exercism, take a look at the [contribution guide]
 [help-page]: http://exercism.io/languages/rust
 [modules]: https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html
 [cargo]: https://doc.rust-lang.org/book/second-edition/ch14-00-more-about-cargo.html
+[rust-tests]: https://doc.rust-lang.org/book/second-edition/ch11-02-running-tests.html
 
 ## Source
 

data/tracks/rust/exercises/ocr-numbers/tests/ocr-numbers.rs

@@ -22,7 +22,6 @@ fn input_with_columns_not_multiple_of_three_is_error() {
     assert_eq!(Err(ocr::Error::InvalidColumnCount(4)), ocr::convert(&input));
 }
 
-
 #[test]
 #[ignore]
 #[cfg_attr(rustfmt, rustfmt_skip)]

data/tracks/rust/exercises/palindrome-products/README.md

@@ -45,11 +45,31 @@ Execute the tests with:
 $ cargo test
 ```
 
-All but the first test have been ignored.  After you get the first test to
-pass, remove the ignore flag (`#[ignore]`) from the next test and get the tests
-to pass again.  The test file is located in the `tests` directory.   You can
-also remove the ignore flag from all the tests to get them to run all at once
-if you wish.
+All but the first test have been ignored. After you get the first test to
+pass, open the tests source file wich is located in the `tests` directory
+and remove the `#[ignore]` flag from the next test and get the tests to pass
+again. Each separate test is a function with `#[test]` flag above it.
+Continue, until you pass every test. 
+
+If you wish to run all tests without editing the tests source file, use:
+
+```bash
+$ cargo test -- --ignored
+```
+
+To run a specific test, for example `some_test`, you can use:
+
+```bash
+$ cargo test some_test
+```
+
+If the specfic test is ignored use:
+
+```bash
+$ cargo test some_test -- --ignored
+```
+
+To learn more about Rust tests refer to the [online test documentation][rust-tests]
 
 Make sure to read the [Modules](https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html) chapter if you
 haven't already, it will help you with organizing your files.
@@ -63,6 +83,7 @@ If you want to know more about Exercism, take a look at the [contribution guide]
 [help-page]: http://exercism.io/languages/rust
 [modules]: https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html
 [cargo]: https://doc.rust-lang.org/book/second-edition/ch14-00-more-about-cargo.html
+[rust-tests]: https://doc.rust-lang.org/book/second-edition/ch11-02-running-tests.html
 
 ## Source
 

data/tracks/rust/exercises/pangram/README.md

@@ -21,11 +21,31 @@ Execute the tests with:
 $ cargo test
 ```
 
-All but the first test have been ignored.  After you get the first test to
-pass, remove the ignore flag (`#[ignore]`) from the next test and get the tests
-to pass again.  The test file is located in the `tests` directory.   You can
-also remove the ignore flag from all the tests to get them to run all at once
-if you wish.
+All but the first test have been ignored. After you get the first test to
+pass, open the tests source file wich is located in the `tests` directory
+and remove the `#[ignore]` flag from the next test and get the tests to pass
+again. Each separate test is a function with `#[test]` flag above it.
+Continue, until you pass every test. 
+
+If you wish to run all tests without editing the tests source file, use:
+
+```bash
+$ cargo test -- --ignored
+```
+
+To run a specific test, for example `some_test`, you can use:
+
+```bash
+$ cargo test some_test
+```
+
+If the specfic test is ignored use:
+
+```bash
+$ cargo test some_test -- --ignored
+```
+
+To learn more about Rust tests refer to the [online test documentation][rust-tests]
 
 Make sure to read the [Modules](https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html) chapter if you
 haven't already, it will help you with organizing your files.
@@ -39,6 +59,7 @@ If you want to know more about Exercism, take a look at the [contribution guide]
 [help-page]: http://exercism.io/languages/rust
 [modules]: https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html
 [cargo]: https://doc.rust-lang.org/book/second-edition/ch14-00-more-about-cargo.html
+[rust-tests]: https://doc.rust-lang.org/book/second-edition/ch11-02-running-tests.html
 
 ## Source
 

data/tracks/rust/exercises/pangram/src/lib.rs

@@ -1,4 +1,4 @@
 /// Determine whether a sentence is a pangram.
 pub fn is_pangram(sentence: &str) -> bool {
     unimplemented!("Is {} a pangram?", sentence);
-}
+}

data/tracks/rust/exercises/parallel-letter-frequency/README.md

@@ -54,11 +54,31 @@ Execute the tests with:
 $ cargo test
 ```
 
-All but the first test have been ignored.  After you get the first test to
-pass, remove the ignore flag (`#[ignore]`) from the next test and get the tests
-to pass again.  The test file is located in the `tests` directory.   You can
-also remove the ignore flag from all the tests to get them to run all at once
-if you wish.
+All but the first test have been ignored. After you get the first test to
+pass, open the tests source file wich is located in the `tests` directory
+and remove the `#[ignore]` flag from the next test and get the tests to pass
+again. Each separate test is a function with `#[test]` flag above it.
+Continue, until you pass every test. 
+
+If you wish to run all tests without editing the tests source file, use:
+
+```bash
+$ cargo test -- --ignored
+```
+
+To run a specific test, for example `some_test`, you can use:
+
+```bash
+$ cargo test some_test
+```
+
+If the specfic test is ignored use:
+
+```bash
+$ cargo test some_test -- --ignored
+```
+
+To learn more about Rust tests refer to the [online test documentation][rust-tests]
 
 Make sure to read the [Modules](https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html) chapter if you
 haven't already, it will help you with organizing your files.
@@ -72,6 +92,7 @@ If you want to know more about Exercism, take a look at the [contribution guide]
 [help-page]: http://exercism.io/languages/rust
 [modules]: https://doc.rust-lang.org/book/second-edition/ch07-00-modules.html
 [cargo]: https://doc.rust-lang.org/book/second-edition/ch14-00-more-about-cargo.html
+[rust-tests]: https://doc.rust-lang.org/book/second-edition/ch11-02-running-tests.html
 
 ## Submitting Incomplete Solutions
 It's possible to submit an incomplete solution so you can see how others have completed the exercise.