trackler 2.2.1.100 → 2.2.1.101

data/tracks/perl6/exercises/etl/etl.t

@@ -35,7 +35,6 @@ for $c-data<cases>.values -> %case-set {
 
 =head2 Canonical Data
 =begin code
-
 {
   "exercise": "etl",
   "version": "1.0.0",
@@ -113,5 +112,4 @@ for $c-data<cases>.values -> %case-set {
     }
   ]
 }
-
 =end code

data/tracks/perl6/exercises/flatten-array/flatten-array.t

@@ -19,7 +19,6 @@ is-deeply flatten-array(.<input><array>), |.<expected description> for @($c-data
 
 =head2 Canonical Data
 =begin code
-
 {
   "exercise": "flatten-array",
   "version": "1.2.0",
@@ -74,5 +73,4 @@ is-deeply flatten-array(.<input><array>), |.<expected description> for @($c-data
     }
   ]
 }
-
 =end code

data/tracks/perl6/exercises/grains/grains.t

@@ -26,7 +26,6 @@ is total-grains, |$c-data<cases>[1]<expected description>;
 
 =head2 Canonical Data
 =begin code
-
 {
   "exercise": "grains",
   "version": "1.0.0",
@@ -108,5 +107,4 @@ is total-grains, |$c-data<cases>[1]<expected description>;
     }
   ]
 }
-
 =end code

data/tracks/perl6/exercises/hamming/.meta/exercise-data.yaml

@@ -4,9 +4,9 @@ plan: 15
 tests: |-
   for $c-data<cases>.values {
     if .<expected><error> {
-      throws-like {hamming-distance(|.<strand1 strand2>)}, Exception, .<description>;
+      throws-like {hamming-distance(|.<input><strand1 strand2>)}, Exception, .<description>;
     } else {
-      is hamming-distance(|.<strand1 strand2>), |.<expected description>;
+      is hamming-distance(|.<input><strand1 strand2>), |.<expected description>;
     }
   }
 

data/tracks/perl6/exercises/hamming/hamming.t

@@ -17,18 +17,17 @@ if Hamming.^ver !~~ $version {
 my $c-data = from-json $=pod.pop.contents;
 for $c-data<cases>.values {
   if .<expected><error> {
-    throws-like {hamming-distance(|.<strand1 strand2>)}, Exception, .<description>;
+    throws-like {hamming-distance(|.<input><strand1 strand2>)}, Exception, .<description>;
   } else {
-    is hamming-distance(|.<strand1 strand2>), |.<expected description>;
+    is hamming-distance(|.<input><strand1 strand2>), |.<expected description>;
   }
 }
 
 =head2 Canonical Data
 =begin code
-
 {
 "exercise": "hamming",
-"version": "2.0.1",
+"version": "2.1.0",
   "comments": [
     "Language implementations vary on the issue of unequal length strands.",
     "A language may elect to simplify this task by only presenting equal",
@@ -45,109 +44,138 @@ for $c-data<cases>.values {
     {
       "description": "empty strands",
       "property": "distance",
-      "strand1": "",
-      "strand2": "",
+      "input": {
+        "strand1": "",
+        "strand2": ""
+      },
       "expected": 0
     },
     {
       "description": "identical strands",
       "property": "distance",
-      "strand1": "A",
-      "strand2": "A",
+      "input": {
+        "strand1": "A",
+        "strand2": "A"
+      },
       "expected": 0
     },
     {
       "description": "long identical strands",
       "property": "distance",
-      "strand1": "GGACTGA",
-      "strand2": "GGACTGA",
+      "input": {
+        "strand1": "GGACTGA",
+        "strand2": "GGACTGA"
+      },
       "expected": 0
     },
     {
       "description": "complete distance in single nucleotide strands",
       "property": "distance",
-      "strand1": "A",
-      "strand2": "G",
+      "input": {
+        "strand1": "A",
+        "strand2": "G"
+      },
       "expected": 1
     },
     {
       "description": "complete distance in small strands",
       "property": "distance",
-      "strand1": "AG",
-      "strand2": "CT",
+      "input": {
+        "strand1": "AG",
+        "strand2": "CT"
+      },
       "expected": 2
     },
     {
       "description": "small distance in small strands",
       "property": "distance",
-      "strand1": "AT",
-      "strand2": "CT",
+      "input": {
+        "strand1": "AT",
+        "strand2": "CT"
+      },
       "expected": 1
     },
     {
       "description": "small distance",
       "property": "distance",
-      "strand1": "GGACG",
-      "strand2": "GGTCG",
+      "input": {
+        "strand1": "GGACG",
+        "strand2": "GGTCG"
+      },
       "expected": 1
     },
     {
       "description": "small distance in long strands",
       "property": "distance",
-      "strand1": "ACCAGGG",
-      "strand2": "ACTATGG",
+      "input": {
+        "strand1": "ACCAGGG",
+        "strand2": "ACTATGG"
+      },
       "expected": 2
     },
     {
       "description": "non-unique character in first strand",
       "property": "distance",
-      "strand1": "AAG",
-      "strand2": "AAA",
+      "input": {
+        "strand1": "AAG",
+        "strand2": "AAA"
+      },
       "expected": 1
     },
     {
       "description": "non-unique character in second strand",
       "property": "distance",
-      "strand1": "AAA",
-      "strand2": "AAG",
+      "input": {
+        "strand1": "AAA",
+        "strand2": "AAG"
+      },
       "expected": 1
     },
     {
       "description": "same nucleotides in different positions",
       "property": "distance",
-      "strand1": "TAG",
-      "strand2": "GAT",
+      "input": {
+        "strand1": "TAG",
+        "strand2": "GAT"
+      },
       "expected": 2
     },
     {
       "description": "large distance",
       "property": "distance",
-      "strand1": "GATACA",
-      "strand2": "GCATAA",
+      "input": {
+        "strand1": "GATACA",
+        "strand2": "GCATAA"
+      },
       "expected": 4
     },
     {
       "description": "large distance in off-by-one strand",
       "property": "distance",
-      "strand1":  "GGACGGATTCTG",
-      "strand2": "AGGACGGATTCT",
+      "input": {
+        "strand1": "GGACGGATTCTG",
+        "strand2": "AGGACGGATTCT"
+      },
       "expected": 9
     },
     {
       "description": "disallow first strand longer",
       "property": "distance",
-      "strand1": "AATG",
-      "strand2": "AAA",
+      "input": {
+        "strand1": "AATG",
+        "strand2": "AAA"
+      },
       "expected": {"error": "left and right strands must be of equal length"}
     },
     {
       "description": "disallow second strand longer",
       "property": "distance",
-      "strand1": "ATA",
-      "strand2": "AGTG",
+      "input": {
+        "strand1": "ATA",
+        "strand2": "AGTG"
+      },
       "expected": {"error": "left and right strands must be of equal length"}
     }
   ]
 }
-
 =end code

data/tracks/perl6/exercises/hello-world/hello-world.t

@@ -22,17 +22,16 @@ is hello, |.<expected description> for @($c-data<cases>);
 
 =head2 Canonical Data
 =begin code
-
 {
   "exercise": "hello-world",
-  "version": "1.0.0",
+  "version": "1.1.0",
   "cases": [
     {
       "description": "Say Hi!",
       "property": "hello",
+      "input": {},
       "expected": "Hello, World!"
     }
   ]
 }
-
 =end code

data/tracks/perl6/exercises/leap/.meta/exercise-data.yaml

@@ -3,7 +3,7 @@ version: 4
 plan: 4
 tests: |-
   for $c-data<cases>.values {
-    given is-leap-year .<input> -> $result {
+    given is-leap-year .<input><year> -> $result {
       subtest .<description>, {
         plan 2;
         isa-ok $result, Bool;

data/tracks/perl6/exercises/leap/leap.t

@@ -16,7 +16,7 @@ if Leap.^ver !~~ $version {
 
 my $c-data = from-json $=pod.pop.contents;
 for $c-data<cases>.values {
-  given is-leap-year .<input> -> $result {
+  given is-leap-year .<input><year> -> $result {
     subtest .<description>, {
       plan 2;
       isa-ok $result, Bool;
@@ -27,36 +27,42 @@ for $c-data<cases>.values {
 
 =head2 Canonical Data
 =begin code
-
 {
   "exercise": "leap",
-  "version": "1.2.0",
+  "version": "1.3.0",
   "cases": [
     {
       "description": "year not divisible by 4: common year",
       "property": "leapYear",
-      "input": 2015,
+      "input": {
+        "year": 2015
+      },
       "expected": false
     },
     {
       "description": "year divisible by 4, not divisible by 100: leap year",
       "property": "leapYear",
-      "input": 1996,
+      "input": {
+        "year": 1996
+      },
       "expected": true
     },
     {
       "description": "year divisible by 100, not divisible by 400: common year",
       "property": "leapYear",
-      "input": 2100,
+      "input": {
+        "year": 2100
+      },
       "expected": false
     },
     {
       "description": "year divisible by 400: leap year",
       "property": "leapYear",
-      "input": 2000,
+      "input": {
+        "year": 2000
+      },
       "expected": true
     }
   ]
 }
-
 =end code

data/tracks/perl6/exercises/luhn/luhn.t

@@ -27,7 +27,6 @@ for $c-data<cases>.values {
 
 =head2 Canonical Data
 =begin code
-
 {
   "exercise": "luhn",
   "version": "1.1.0",
@@ -138,5 +137,4 @@ for $c-data<cases>.values {
     }
   ]
 }
-
 =end code

data/tracks/perl6/exercises/nucleotide-count/.meta/exercise-data.yaml

@@ -4,10 +4,10 @@ plan: 5
 tests: |-
   for $c-data<cases>».<cases>».Array.flat {
     if .<expected><error> {
-      throws-like {nucleotide-count(.<strand>)}, Exception, .<description>;
+      throws-like {nucleotide-count(.<input><strand>)}, Exception, .<description>;
     }
     else {
-      cmp-ok nucleotide-count(.<strand>), '~~', .<expected>.Bag, .<description>;
+      cmp-ok nucleotide-count(.<input><strand>), '~~', .<expected>.Bag, .<description>;
     }
   }
 

data/tracks/perl6/exercises/nucleotide-count/nucleotide-count.t

@@ -17,19 +17,18 @@ if NucleotideCount.^ver !~~ $version {
 my $c-data = from-json $=pod.pop.contents;
 for $c-data<cases>».<cases>».Array.flat {
   if .<expected><error> {
-    throws-like {nucleotide-count(.<strand>)}, Exception, .<description>;
+    throws-like {nucleotide-count(.<input><strand>)}, Exception, .<description>;
   }
   else {
-    cmp-ok nucleotide-count(.<strand>), '~~', .<expected>.Bag, .<description>;
+    cmp-ok nucleotide-count(.<input><strand>), '~~', .<expected>.Bag, .<description>;
   }
 }
 
 =head2 Canonical Data
 =begin code
-
 {
   "exercise": "nucleotide-count",
-  "version": "1.2.0",
+  "version": "1.3.0",
   "cases": [
     {
       "description": "count all nucleotides in a strand",
@@ -37,7 +36,9 @@ for $c-data<cases>».<cases>».Array.flat {
         {
           "description": "empty strand",
           "property": "nucleotideCounts",
-          "strand": "",
+          "input": {
+            "strand": ""
+          },
           "expected": {
             "A": 0,
             "C": 0,
@@ -48,7 +49,9 @@ for $c-data<cases>».<cases>».Array.flat {
         {
           "description": "can count one nucleotide in single-character input",
           "property": "nucleotideCounts",
-          "strand": "G",
+          "input": {
+            "strand": "G"
+          },
           "expected": {
             "A": 0,
             "C": 0,
@@ -59,7 +62,9 @@ for $c-data<cases>».<cases>».Array.flat {
         {
           "description": "strand with repeated nucleotide",
           "property": "nucleotideCounts",
-          "strand": "GGGGGGG",
+          "input": {
+            "strand": "GGGGGGG"
+          },
           "expected": {
             "A": 0,
             "C": 0,
@@ -70,7 +75,9 @@ for $c-data<cases>».<cases>».Array.flat {
         {
           "description": "strand with multiple nucleotides",
           "property": "nucleotideCounts",
-          "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
+          "input": {
+            "strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+          },
           "expected": {
             "A": 20,
             "C": 12,
@@ -81,7 +88,9 @@ for $c-data<cases>».<cases>».Array.flat {
         {
           "description": "strand with invalid nucleotides",
           "property": "nucleotideCounts",
-          "strand": "AGXXACT",
+          "input": {
+            "strand": "AGXXACT"
+          },
           "expected": {
             "error": "Invalid nucleotide in strand"
           }
@@ -90,5 +99,4 @@ for $c-data<cases>».<cases>».Array.flat {
     }
   ]
 }
-
 =end code