trackler 2.1.0.8 → 2.1.0.9

data/tracks/java/exercises/minesweeper/src/test/java/MinesweeperBoardTest.java

@@ -28,7 +28,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithOneRowAndNoColumns() {
         final List<String> inputBoard = Collections.singletonList("");
@@ -39,7 +39,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithNoMines() {
         final List<String> inputBoard = Arrays.asList(
@@ -60,7 +60,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithOnlyMines() {
         final List<String> inputBoard = Arrays.asList(
@@ -81,7 +81,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithSingleMineAtCenter() {
         final List<String> inputBoard = Arrays.asList(
@@ -102,7 +102,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithMinesAroundPerimeter() {
         final List<String> inputBoard = Arrays.asList(
@@ -123,7 +123,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithSingleRowAndTwoMines() {
         final List<String> inputBoard = Collections.singletonList(
@@ -140,7 +140,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithSingleRowAndTwoMinesAtEdges() {
         final List<String> inputBoard = Collections.singletonList(
@@ -157,7 +157,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithSingleColumnAndTwoMines() {
         final List<String> inputBoard = Arrays.asList(
@@ -182,7 +182,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithSingleColumnAndTwoMinesAtEdges() {
         final List<String> inputBoard = Arrays.asList(
@@ -207,7 +207,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithMinesInCross() {
         final List<String> inputBoard = Arrays.asList(
@@ -232,7 +232,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLargeInputBoard() {
         final List<String> inputBoard = Arrays.asList(
@@ -259,7 +259,7 @@ public final class MinesweeperBoardTest {
         assertEquals(expectedAnnotatedRepresentation, actualAnnotatedRepresentation);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNullInputBoardIsRejected() {
         expectedException.expect(IllegalArgumentException.class);
@@ -268,7 +268,7 @@ public final class MinesweeperBoardTest {
         new MinesweeperBoard(null);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithInvalidSymbolsIsRejected() {
         expectedException.expect(IllegalArgumentException.class);
@@ -277,7 +277,7 @@ public final class MinesweeperBoardTest {
         new MinesweeperBoard(Collections.singletonList(" * & "));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputBoardWithInconsistentRowLengthsIsRejected() {
         expectedException.expect(IllegalArgumentException.class);

data/tracks/java/exercises/nth-prime/src/test/java/PrimeCalculatorTest.java

@@ -23,25 +23,25 @@ public class PrimeCalculatorTest {
         assertThat(primeCalculator.nth(1), is(2));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSecondPrime() {
         assertThat(primeCalculator.nth(2), is(3));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testSixthPrime() {
         assertThat(primeCalculator.nth(6), is(13));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testBigPrime() {
         assertThat(primeCalculator.nth(10001), is(104743));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testUndefinedPrime() {
         thrown.expect(IllegalArgumentException.class);

data/tracks/java/exercises/nucleotide-count/src/test/java/NucleotideTest.java

@@ -19,7 +19,7 @@ public class NucleotideTest {
         assertThat(dna.count('A'), is(0));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testEmptyDnaStringHasNoNucleotides() {
         DNA dna = new DNA("");
@@ -33,14 +33,14 @@ public class NucleotideTest {
         ));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testRepetitiveCytosineGetsCounted() {
         DNA dna = new DNA("CCCCC");
         assertThat(dna.count('C'), is(5));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testRepetitiveSequenceWithOnlyGuanine() {
         DNA dna = new DNA("GGGGGGGG");
@@ -54,14 +54,14 @@ public class NucleotideTest {
         ));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCountsOnlyThymine() {
         DNA dna = new DNA("GGGGGTAACCCGG");
         assertThat(dna.count('T'), is(1));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCountsANucleotideOnlyOnce() {
         DNA dna = new DNA("CGATTGGG");
@@ -69,7 +69,7 @@ public class NucleotideTest {
         assertThat(dna.count('T'), is(2));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testDnaCountsDoNotChangeAfterCountingAdenine() {
         DNA dna = new DNA("GATTACA");
@@ -84,7 +84,7 @@ public class NucleotideTest {
         ));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testValidatesNucleotides() {
         thrown.expect(IllegalArgumentException.class);
@@ -92,7 +92,7 @@ public class NucleotideTest {
         dna.count('X');
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCountsAllNucleotides() {
         String s = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";

data/tracks/java/exercises/palindrome-products/src/test/java/PalindromeCalculatorTest.java

@@ -34,7 +34,7 @@ public class PalindromeCalculatorTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void largestPalindromeFromDoubleDigitFactors() {
         final List<List<Integer>> expected = Collections.unmodifiableList(
                 Arrays.asList(
@@ -49,7 +49,7 @@ public class PalindromeCalculatorTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void smallestPalindromeFromDoubleDigitFactors() {
         final List<List<Integer>> expected = Collections.unmodifiableList(
                 Arrays.asList(
@@ -64,7 +64,7 @@ public class PalindromeCalculatorTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void largestPalindromeFromTripleDigitFactors() {
         final List<List<Integer>> expected = Collections.unmodifiableList(
                 Arrays.asList(
@@ -79,7 +79,7 @@ public class PalindromeCalculatorTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void smallestPalindromeFromTripleDigitFactors() {
         final List<List<Integer>> expected = Collections.unmodifiableList(
                 Arrays.asList(

data/tracks/java/exercises/pascals-triangle/src/test/java/PascalsTriangleGeneratorTest.java

@@ -30,7 +30,7 @@ public class PascalsTriangleGeneratorTest {
         assertArrayEquals(expectedOutput, pascalsTriangleGenerator.generateTriangle(0));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTriangleWithOneRow() {
         int[][] expectedOutput = new int[][]{
@@ -40,7 +40,7 @@ public class PascalsTriangleGeneratorTest {
         assertArrayEquals(expectedOutput, pascalsTriangleGenerator.generateTriangle(1));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTriangleWithTwoRows() {
         int[][] expectedOutput = new int[][]{
@@ -51,7 +51,7 @@ public class PascalsTriangleGeneratorTest {
         assertArrayEquals(expectedOutput, pascalsTriangleGenerator.generateTriangle(2));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTriangleWithThreeRows() {
         int[][] expectedOutput = new int[][]{
@@ -63,7 +63,7 @@ public class PascalsTriangleGeneratorTest {
         assertArrayEquals(expectedOutput, pascalsTriangleGenerator.generateTriangle(3));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testTriangleWithFourRows() {
         int[][] expectedOutput = new int[][]{
@@ -76,7 +76,7 @@ public class PascalsTriangleGeneratorTest {
         assertArrayEquals(expectedOutput, pascalsTriangleGenerator.generateTriangle(4));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testValidatesNotNegativeRows() {
         thrown.expect(IllegalArgumentException.class);

data/tracks/java/exercises/phone-number/src/test/java/PhoneNumberTest.java

@@ -25,7 +25,7 @@ public class PhoneNumberTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cleansNumberWithDots() {
         final String expectedNumber = "1234567890";
@@ -36,7 +36,7 @@ public class PhoneNumberTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void cleansNumberWithMultipleSpaces() {
         final String expectedNumber = "1234567890";
@@ -47,7 +47,7 @@ public class PhoneNumberTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWhen9Digits() {
         expectedException.expect(IllegalArgumentException.class);
@@ -55,7 +55,7 @@ public class PhoneNumberTest {
         new PhoneNumber("123456789");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWhen11Digits() {
         expectedException.expect(IllegalArgumentException.class);
@@ -63,7 +63,7 @@ public class PhoneNumberTest {
         new PhoneNumber("21234567890");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void validWhen11DigitsAndFirstIs1() {
         final String expectedNumber = "1234567890";
@@ -74,7 +74,7 @@ public class PhoneNumberTest {
         );
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWhen12Digits() {
         expectedException.expect(IllegalArgumentException.class);
@@ -82,7 +82,7 @@ public class PhoneNumberTest {
         new PhoneNumber("321234567890");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWithLetters() {
         expectedException.expect(IllegalArgumentException.class);
@@ -90,7 +90,7 @@ public class PhoneNumberTest {
         new PhoneNumber("123-abc-7890");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWithPunctuation() {
         expectedException.expect(IllegalArgumentException.class);
@@ -98,7 +98,7 @@ public class PhoneNumberTest {
         new PhoneNumber("123-@:!-7890");
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void invalidWithRightNumberOfDigitsButLettersMixedIn() {
         expectedException.expect(IllegalArgumentException.class);

data/tracks/java/exercises/pythagorean-triplet/src/test/java/PythagoreanTripletTest.java

@@ -21,7 +21,7 @@ public class PythagoreanTripletTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldCalculateProduct() {
         PythagoreanTriplet sut = new PythagoreanTriplet(3, 4, 5);
         final long expected = 60l;
@@ -30,21 +30,21 @@ public class PythagoreanTripletTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testIsPythagoreanOK() {
         PythagoreanTriplet sut = new PythagoreanTriplet(3, 4, 5);
         assertTrue(sut.isPythagorean());
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void testIsPythagoreanFail() {
         PythagoreanTriplet sut = new PythagoreanTriplet(5, 6, 7);
         assertFalse(sut.isPythagorean());
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldMakeTripletsUpToTen() {
         final List<Long> actual
                 = PythagoreanTriplet
@@ -60,7 +60,7 @@ public class PythagoreanTripletTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldMakeTripletsElevenToTwenty() {
         final List<Long> actual
                 = PythagoreanTriplet
@@ -77,7 +77,7 @@ public class PythagoreanTripletTest {
     }
 
     @Test
-    @Ignore
+    @Ignore("Remove to run test")
     public void shouldMakeTripletsAndFilterOnSum() {
         final List<Long> actual
                 = PythagoreanTriplet

data/tracks/java/exercises/queen-attack/src/test/java/QueenAttackCalculatorTest.java

@@ -23,7 +23,7 @@ public final class QueenAttackCalculatorTest {
         assertFalse(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnTheSameRank() {
         final QueenAttackCalculator calculator
@@ -32,7 +32,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnTheSameFile() {
         final QueenAttackCalculator calculator
@@ -41,7 +41,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnFirstDiagonal() {
         final QueenAttackCalculator calculator
@@ -50,7 +50,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnSecondDiagonal() {
         final QueenAttackCalculator calculator
@@ -59,7 +59,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnThirdDiagonal() {
         final QueenAttackCalculator calculator
@@ -68,7 +68,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensCanAttackOnFourthDiagonal() {
         final QueenAttackCalculator calculator
@@ -77,7 +77,7 @@ public final class QueenAttackCalculatorTest {
         assertTrue(calculator.canQueensAttackOneAnother());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCoordinateWithNegativeRankNotAllowed() {
         expectedException.expect(IllegalArgumentException.class);
@@ -86,7 +86,7 @@ public final class QueenAttackCalculatorTest {
         new BoardCoordinate(-2, 2);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCoordinateWithRankGreaterThan7NotAllowed() {
         expectedException.expect(IllegalArgumentException.class);
@@ -95,7 +95,7 @@ public final class QueenAttackCalculatorTest {
         new BoardCoordinate(8, 4);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCoordinateWithNegativeFileNotAllowed() {
         expectedException.expect(IllegalArgumentException.class);
@@ -104,7 +104,7 @@ public final class QueenAttackCalculatorTest {
         new BoardCoordinate(2, -2);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testCoordinateWithFileGreaterThan7NotAllowed() {
         expectedException.expect(IllegalArgumentException.class);
@@ -113,7 +113,7 @@ public final class QueenAttackCalculatorTest {
         new BoardCoordinate(4, 8);
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNullCoordinateNotAllowed() {
         expectedException.expect(IllegalArgumentException.class);
@@ -122,7 +122,7 @@ public final class QueenAttackCalculatorTest {
         new QueenAttackCalculator(null, new BoardCoordinate(0, 7));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testQueensMustNotOccupyTheSameSquare() {
         expectedException.expect(IllegalArgumentException.class);

data/tracks/java/exercises/rectangles/src/test/java/RectangleCounterTest.java

@@ -20,7 +20,7 @@ public final class RectangleCounterTest {
         assertEquals(0, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testNonTrivialInputWithNoRectangles() {
         String[] inputGrid = new String[]{" "};
@@ -28,7 +28,7 @@ public final class RectangleCounterTest {
         assertEquals(0, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputWithOneRectangle() {
         String[] inputGrid = new String[]{
@@ -40,7 +40,7 @@ public final class RectangleCounterTest {
         assertEquals(1, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputWithTwoRectanglesWithoutSharedEdges() {
         String[] inputGrid = new String[]{
@@ -54,7 +54,7 @@ public final class RectangleCounterTest {
         assertEquals(2, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testInputWithFiveRectanglesWithSharedEdges() {
         String[] inputGrid = new String[]{
@@ -68,7 +68,7 @@ public final class RectangleCounterTest {
         assertEquals(5, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatRectangleOfHeightOneIsCounted() {
         String[] inputGrid = new String[]{
@@ -79,7 +79,7 @@ public final class RectangleCounterTest {
         assertEquals(1, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatRectangleOfWidthOneIsCounted() {
         String[] inputGrid = new String[]{
@@ -91,7 +91,7 @@ public final class RectangleCounterTest {
         assertEquals(1, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatOneByOneSquareIsCounted() {
         String[] inputGrid = new String[]{
@@ -102,7 +102,7 @@ public final class RectangleCounterTest {
         assertEquals(1, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatIncompleteRectanglesAreNotCounted() {
         String[] inputGrid = new String[]{
@@ -116,7 +116,7 @@ public final class RectangleCounterTest {
         assertEquals(1, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatRectanglesOfDifferentSizesAreAllCounted() {
         String[] inputGrid = new String[]{
@@ -130,7 +130,7 @@ public final class RectangleCounterTest {
         assertEquals(3, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testThatIntersectionsWithoutCornerCharacterDoNotCountAsRectangleCorners() {
         String[] inputGrid = new String[]{
@@ -144,7 +144,7 @@ public final class RectangleCounterTest {
         assertEquals(2, rectangleCounter.countRectangles(inputGrid));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void testLargeInputWithManyRectangles() {
         String[] inputGrid = new String[]{

data/tracks/java/exercises/robot-name/src/test/java/RobotTest.java

@@ -22,13 +22,13 @@ public class RobotTest {
         assertIsValidName(robot.getName());
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void differentRobotsHaveDifferentNames() {
         assertThat(robot.getName(), not(equalTo(new Robot().getName())));
     }
 
-    @Ignore
+    @Ignore("Remove to run test")
     @Test
     public void resetName() {
         final String name = robot.getName();