trackler 2.0.8.14 → 2.0.8.15

data/tracks/csharp/exercises/nth-prime/NthPrime.cs

@@ -0,0 +1,11 @@
+using System;
+using System.Collections.Generic;
+using System.Linq;
+
+public static class NthPrime
+{
+    public static int Nth(int nth)
+    {
+        throw new NotImplementedException("You need to implement this function.");
+    }
+}

data/tracks/csharp/exercises/nth-prime/NthPrime.csproj

@@ -0,0 +1,18 @@
+<Project Sdk="Microsoft.NET.Sdk">
+
+  <PropertyGroup>
+    <OutputType>Exe</OutputType>
+    <TargetFramework>netcoreapp1.0</TargetFramework>
+  </PropertyGroup>
+
+  <ItemGroup>
+    <Compile Remove="Example.cs" />
+  </ItemGroup>
+
+  <ItemGroup>
+    <PackageReference Include="Microsoft.NET.Test.Sdk" Version="15.0.0" />
+    <PackageReference Include="xunit" Version="2.2.0" />
+    <PackageReference Include="xunit.runner.visualstudio" Version="2.2.0" />
+  </ItemGroup>
+
+</Project>

data/tracks/csharp/exercises/nth-prime/NthPrimeTest.cs

@@ -1,20 +1,21 @@
-using NUnit.Framework;
+using Xunit;
 
 public class NthPrimeTest
 {
-    [TestCase(1, ExpectedResult = 2)]
-    [TestCase(2, ExpectedResult = 3, Ignore = "Remove to run test case")]
-    [TestCase(3, ExpectedResult = 5, Ignore = "Remove to run test case")]
-    [TestCase(4, ExpectedResult = 7, Ignore = "Remove to run test case")]
-    [TestCase(5, ExpectedResult = 11, Ignore = "Remove to run test case")]
-    [TestCase(6, ExpectedResult = 13, Ignore = "Remove to run test case")]
-    [TestCase(7, ExpectedResult = 17, Ignore = "Remove to run test case")]
-    [TestCase(8, ExpectedResult = 19, Ignore = "Remove to run test case")]
-    [TestCase(1000, ExpectedResult = 7919, Ignore = "Remove to run test case")]
-    [TestCase(10000, ExpectedResult = 104729, Ignore = "Remove to run test case")]
-    [TestCase(10001, ExpectedResult = 104743, Ignore = "Remove to run test case")]
-    public int Nth_prime_calculated(int nth)
+    [Theory]
+    [InlineData(1, 2)]
+    [InlineData(2, 3)]
+    [InlineData(3, 5)]
+    [InlineData(4, 7)]
+    [InlineData(5, 11)]
+    [InlineData(6, 13)]
+    [InlineData(7, 17)]
+    [InlineData(8, 19)]
+    [InlineData(1000, 7919)]
+    [InlineData(10000, 104729)]
+    [InlineData(10001, 104743)]
+    public void Nth_prime_calculated(int nth, int expected)
     {
-        return NthPrime.Nth(nth);
+        Assert.Equal(expected, NthPrime.Nth(nth));
     }
 }

data/tracks/csharp/exercises/nucleotide-count/NucleotideCount.cs

@@ -0,0 +1,24 @@
+using System;
+using System.Collections.Generic;
+
+public class DNA
+{
+    public DNA(string sequence)
+    {
+    }
+
+    public IDictionary<char, int> NucleotideCounts
+    {
+        get
+        {
+            throw new NotImplementedException("You need to implement this function.");
+        }
+    }
+
+    public int Count(char nucleotide)
+    {
+        throw new NotImplementedException("You need to implement this function.");
+    }
+}
+
+public class InvalidNucleotideException : Exception { }

data/tracks/csharp/exercises/nucleotide-count/NucleotideCount.csproj

@@ -0,0 +1,18 @@
+<Project Sdk="Microsoft.NET.Sdk">
+
+  <PropertyGroup>
+    <OutputType>Exe</OutputType>
+    <TargetFramework>netcoreapp1.0</TargetFramework>
+  </PropertyGroup>
+
+  <ItemGroup>
+    <Compile Remove="Example.cs" />
+  </ItemGroup>
+
+  <ItemGroup>
+    <PackageReference Include="Microsoft.NET.Test.Sdk" Version="15.0.0" />
+    <PackageReference Include="xunit" Version="2.2.0" />
+    <PackageReference Include="xunit.runner.visualstudio" Version="2.2.0" />
+  </ItemGroup>
+
+</Project>

data/tracks/csharp/exercises/nucleotide-count/NucleotideCountTest.cs

@@ -1,73 +1,65 @@
 using System.Collections.Generic;
-using NUnit.Framework;
+using Xunit;
 
-[TestFixture]
 public class NucleoTideCountTest
 {
-    [Test]
+    [Fact]
     public void Has_no_nucleotides()
     {
         var dna = new DNA("");
         var expected = new Dictionary<char, int> { { 'A', 0 }, { 'T', 0 }, { 'C', 0 }, { 'G', 0 } };
-        Assert.That(dna.NucleotideCounts, Is.EqualTo(expected));
+        Assert.Equal(expected, dna.NucleotideCounts);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Has_no_adenosine()
     {
         var dna = new DNA("");
-        Assert.That(dna.Count('A'), Is.EqualTo(0));
+        Assert.Equal(0, dna.Count('A'));
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Repetitive_cytidine_gets_counts()
     {
         var dna = new DNA("CCCCC");
-        Assert.That(dna.Count('C'), Is.EqualTo(5));
+        Assert.Equal(5, dna.Count('C'));
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Repetitive_sequence_has_only_guanosine()
     {
         var dna = new DNA("GGGGGGGG");
         var expected = new Dictionary<char, int> { { 'A', 0 }, { 'T', 0 }, { 'C', 0 }, { 'G', 8 } };
-        Assert.That(dna.NucleotideCounts, Is.EqualTo(expected));
+        Assert.Equal(expected, dna.NucleotideCounts);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Counts_only_thymidine()
     {
         var dna = new DNA("GGGGTAACCCGG");
-        Assert.That(dna.Count('T'), Is.EqualTo(1));
+        Assert.Equal(1, dna.Count('T'));
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Counts_a_nucleotide_only_once()
     {
         var dna = new DNA("GGTTGG");
         dna.Count('T');
-        Assert.That(dna.Count('T'), Is.EqualTo(2));
+        Assert.Equal(2, dna.Count('T'));
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Validates_nucleotides()
     {
         var dna = new DNA("GGTTGG");
         Assert.Throws<InvalidNucleotideException>(() => dna.Count('X'));
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Counts_all_nucleotides()
     {
         var dna = new DNA("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC");
         var expected = new Dictionary<char, int> { { 'A', 20 }, { 'T', 21 }, { 'C', 12 }, { 'G', 17 } };
-        Assert.That(dna.NucleotideCounts, Is.EqualTo(expected));
+        Assert.Equal(expected, dna.NucleotideCounts);
     }
 }

data/tracks/csharp/exercises/ocr-numbers/OcrNumbers.cs

@@ -0,0 +1,9 @@
+using System;
+
+public static class OcrNumbers
+{
+    public static string Convert(string input)
+    {
+        throw new NotImplementedException();
+    }
+}

data/tracks/csharp/exercises/ocr-numbers/OcrNumbers.csproj

@@ -0,0 +1,18 @@
+<Project Sdk="Microsoft.NET.Sdk">
+
+  <PropertyGroup>
+    <OutputType>Exe</OutputType>
+    <TargetFramework>netcoreapp1.0</TargetFramework>
+  </PropertyGroup>
+
+  <ItemGroup>
+    <Compile Remove="Example.cs" />
+  </ItemGroup>
+
+  <ItemGroup>
+    <PackageReference Include="Microsoft.NET.Test.Sdk" Version="15.0.0" />
+    <PackageReference Include="xunit" Version="2.2.0" />
+    <PackageReference Include="xunit.runner.visualstudio" Version="2.2.0" />
+  </ItemGroup>
+
+</Project>

data/tracks/csharp/exercises/ocr-numbers/OcrNumbersTest.cs

@@ -1,168 +1,154 @@
-using NUnit.Framework;
+using Xunit;
 
 public class OcrNumbersTest
 {
-    [Test]
+    [Fact]
     public void Recognizes_zero()
     {
         var converted = OcrNumbers.Convert(" _ " + "\n" +
                                            "| |" + "\n" +
                                            "|_|" + "\n" +
                                            "   ");
-        Assert.That(converted, Is.EqualTo("0"));
+        Assert.Equal("0", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_one()
     {
         var converted = OcrNumbers.Convert("   " + "\n" +
                                            "  |" + "\n" +
                                            "  |" + "\n" +
                                            "   ");
-        Assert.That(converted, Is.EqualTo("1"));
+        Assert.Equal("1", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_two()
     {
         var converted = OcrNumbers.Convert(" _ " + "\n" +
                                            " _|" + "\n" +
                                            "|_ " + "\n" +
                                            "   ");
-        Assert.That(converted, Is.EqualTo("2"));
+        Assert.Equal("2", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_three()
     {
         var converted = OcrNumbers.Convert(" _ " + "\n" +
                                            " _|" + "\n" +
                                            " _|" + "\n" +
                                            "   ");
-        Assert.That(converted, Is.EqualTo("3"));
+        Assert.Equal("3", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_four()
     {
         var converted = OcrNumbers.Convert("   " + "\n" +
                                            "|_|" + "\n" +
                                            "  |" + "\n" +
                                            "   ");
-        Assert.That(converted, Is.EqualTo("4"));
+        Assert.Equal("4", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_five()
     {
         var converted = OcrNumbers.Convert(" _ " + "\n" +
                                            "|_ " + "\n" +
                                            " _|" + "\n" +
                                            "   ");
-        Assert.That(converted, Is.EqualTo("5"));
+        Assert.Equal("5", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_six()
     {
         var converted = OcrNumbers.Convert(" _ " + "\n" +
                                            "|_ " + "\n" +
                                            "|_|" + "\n" +
                                            "   ");
-        Assert.That(converted, Is.EqualTo("6"));
+        Assert.Equal("6", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_seven()
     {
         var converted = OcrNumbers.Convert(" _ " + "\n" +
                                            "  |" + "\n" +
                                            "  |" + "\n" +
                                            "   ");
-        Assert.That(converted, Is.EqualTo("7"));
+        Assert.Equal("7", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_eight()
     {
         var converted = OcrNumbers.Convert(" _ " + "\n" +
                                            "|_|" + "\n" +
                                            "|_|" + "\n" +
                                            "   ");
-        Assert.That(converted, Is.EqualTo("8"));
+        Assert.Equal("8", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_nine()
     {
         var converted = OcrNumbers.Convert(" _ " + "\n" +
                                            "|_|" + "\n" +
                                            " _|" + "\n" +
                                            "   ");
-        Assert.That(converted, Is.EqualTo("9"));
+        Assert.Equal("9", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_garble()
     {
         var converted = OcrNumbers.Convert("   " + "\n" +
                                            "| |" + "\n" +
                                            "| |" + "\n" +
                                            "   ");
-        Assert.That(converted, Is.EqualTo("?"));
+        Assert.Equal("?", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_ten()
     {
         var converted = OcrNumbers.Convert("    _ " + "\n" +
                                            "  || |" + "\n" +
                                            "  ||_|" + "\n" +
                                            "      ");
-        Assert.That(converted, Is.EqualTo("10"));
+        Assert.Equal("10", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_110101100()
     {
         var converted = OcrNumbers.Convert("       _     _        _  _ " + "\n" +
                                            "  |  || |  || |  |  || || |" + "\n" +
                                            "  |  ||_|  ||_|  |  ||_||_|" + "\n" +
                                            "                           ");
-        Assert.That(converted, Is.EqualTo("110101100"));
+        Assert.Equal("110101100", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_numbers_and_garble()
     {
         var converted = OcrNumbers.Convert("       _     _           _ " + "\n" +
                                            "  |  || |  || |     || || |" + "\n" +
                                            "  |  | _|  ||_|  |  ||_||_|" + "\n" +
                                            "                           ");
-        Assert.That(converted, Is.EqualTo("11?10?1?0"));
+        Assert.Equal("11?10?1?0", converted);
     }
 
-    [Ignore("Remove to run test")]
-    [Test]
+    [Fact(Skip = "Remove to run test")]
     public void Recognizes_1234567890()
     {
         var converted = OcrNumbers.Convert("    _  _     _  _  _  _  _  _ " + "\n" +
                                            "  | _| _||_||_ |_   ||_||_|| |" + "\n" +
                                            "  ||_  _|  | _||_|  ||_| _||_|" + "\n" +
                                            "                              ");
-        Assert.That(converted, Is.EqualTo("1234567890"));
+        Assert.Equal("1234567890", converted);
     }
 }

data/tracks/csharp/exercises/palindrome-products/PalindromeProducts.cs

@@ -0,0 +1,42 @@
+using System;
+using System.Collections.Generic;
+using System.Linq;
+
+public class Palindrome
+{
+    public int Value
+    {
+        get
+        {
+            throw new NotImplementedException("You need to implement this function.");
+        }
+    }
+
+    public ISet<Tuple<int, int>> Factors
+    {
+        get
+        {
+            throw new NotImplementedException("You need to implement this function.");
+        }
+    }
+
+    public static Palindrome Largest(int maxFactor)
+    {
+        throw new NotImplementedException("You need to implement this function.");
+    }
+
+    public static Palindrome Largest(int minFactor, int maxFactor)
+    {
+        throw new NotImplementedException("You need to implement this function.");
+    }
+
+    public static Palindrome Smallest(int maxFactor)
+    {
+        throw new NotImplementedException("You need to implement this function.");
+    }
+
+    public static Palindrome Smallest(int minFactor, int maxFactor)
+    {
+        throw new NotImplementedException("You need to implement this function.");
+    }
+}