trackler 2.0.6.28 → 2.0.6.29

data/tracks/erlang/exercises/leap/leap_tests.erl

@@ -1,20 +0,0 @@
-% To run tests:
-% erl -make
-% erl -noshell -eval "eunit:test(leap, [verbose])" -s init stop
-%
-
--module(leap_tests).
-
--include_lib("eunit/include/eunit.hrl").
-
-leap_year_test() ->
-  ?assert(leap:leap_year(1996)).
-
-non_leap_year_test() ->
-  ?assertNot(leap:leap_year(1997)).
-
-century_test() ->
-  ?assertNot(leap:leap_year(1900)).
-
-fourth_century_test() ->
-  ?assert(leap:leap_year(2400)).

data/tracks/erlang/exercises/luhn/luhn_tests.erl

@@ -1,19 +0,0 @@
--module(luhn_tests).
--include_lib("eunit/include/eunit.hrl").
-
-% To run tests:
-% erl -make
-% erl -noshell -eval "eunit:test(luhn, [verbose])" -s init stop
-
-invalid_test() ->
-  ?assertNot(luhn:valid("1111")),
-  ?assertNot(luhn:valid("738")).
-
-valid_test() ->
-  ?assert(luhn:valid("8739567")),
-  ?assert(luhn:valid("8763")),
-  ?assert(luhn:valid("2323 2005 7766 3554")).
-
-create_test() ->
-  ?assertEqual("2323 2005 7766 3554", luhn:create("2323 2005 7766 355")).
-

data/tracks/erlang/exercises/nucleotide-count/dna_tests.erl

@@ -1,27 +0,0 @@
--module(dna_tests).
-
--include_lib("eunit/include/eunit.hrl").
-
-empty_dna_string_has_no_adenine_test() ->
-  ?assertEqual(0, dna:count("", "A")).
-
-repetitive_cytosine_gets_counted_test() ->
-  ?assertEqual(5, dna:count("CCCCC", "C")).
-
-counts_only_thymine_test() ->
-  ?assertEqual(1, dna:count("GGGGGTAACCCGG", "T")).
-
-validates_nucleotides_test() ->
-  ?assertException(error, "Invalid nucleotide", dna:count("GACT", "X")).
-
-empty_dna_string_has_no_nucleotides_test() ->
-  ?assertEqual([{"A", 0}, {"T", 0}, {"C", 0}, {"G", 0}], dna:nucleotide_counts("")).
-
-repetitive_sequence_has_only_guanine_test() ->
-  ?assertEqual([{"A", 0}, {"T", 0}, {"C", 0}, {"G", 8}], dna:nucleotide_counts("GGGGGGGG")).
-
-counts_all_nucleotides_test() ->
-  ?assertEqual(
-     [{"A", 20}, {"T", 21}, {"C", 12}, {"G", 17}],
-     dna:nucleotide_counts(
-       "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")).

data/tracks/erlang/exercises/phone-number/phone_tests.erl

@@ -1,29 +0,0 @@
-% To run tests:
-% elc *.erl
-% erl -noshell -eval "eunit:test(phone, [verbose])" -s init stop
-%
--module(phone_tests).
-
--include_lib("eunit/include/eunit.hrl").
-
-cleans_number_test() ->
-  ?assertEqual("1234567890", phone:number("(123) 456-7890")).
-
-cleans_number_with_dots_test() ->
-  ?assertEqual("1234567890", phone:number("123.456.7890")).
-
-valid_when_eleven_digits_test() ->
-  ?assertEqual("1234567890", phone:number("11234567890")).
-
-invalid_when_eleven_digits_test() ->
-  ?assertEqual("0000000000", phone:number("21234567890")).
-
-invalid_when_nine_digits_test() ->
-  ?assertEqual("0000000000", phone:number("123456789")).
-
-area_code_test() ->
-  ?assertEqual("123", phone:areacode("1234567890")).
-
-pretty_print_test() ->
-  ?assertEqual("(123) 456-7890", phone:pretty_print("1234567890")),
-  ?assertEqual("(123) 456-7890", phone:pretty_print("11234567890")).

data/tracks/erlang/exercises/rna-transcription/rna_transcription_tests.erl

@@ -1,24 +0,0 @@
-% to run tests:
-% erl -make
-% erl -noshell -eval "eunit:test(rna_transcription, [verbose])" -s init stop
-
--module(rna_transcription_tests).
--include_lib("eunit/include/eunit.hrl").
-
-transcribes_cytidine_unchanged_test() ->
-  ?assertEqual("C", rna_transcription:to_rna("G")).
-
-transcribes_guanosine_unchanged_test() ->
-  ?assertEqual("G", rna_transcription:to_rna("C")).
-
-transcribes_adenosine_unchanged_test() ->
-  ?assertEqual("A", rna_transcription:to_rna("T")).
-
-transcribes_thymidine_to_uracil_test() ->
-  ?assertEqual("U", rna_transcription:to_rna("A")).
-
-transcribes_all_occurences_test() ->
-  ?assertEqual(
-     "UGCACCAGAAUU",
-     rna_transcription:to_rna("ACGTGGTCTTAA")
-    ).

data/tracks/erlang/exercises/robot-simulator/robot_simulator_tests.erl

@@ -1,96 +0,0 @@
--module( robot_simulator_tests ).
--include_lib( "eunit/include/eunit.hrl" ).
-
-create_test() ->
-  Robot = robot_simulator:create(),
-  ?assert( robot_simulator:direction(Robot) =:= undefined ),
-  ?assert( robot_simulator:position(Robot) =:= {undefined, undefined} ).
-
-place_test() ->
-  Robot = robot_simulator:create(),
-  Position = {1, 2},
-  robot_simulator:place( Robot, north, Position ),
-  ?assert( robot_simulator:direction(Robot) =:= north ),
-  ?assert( robot_simulator:position(Robot) =:= Position ).
-
-left_test() ->
-  Robot = robot_simulator:create(),
-  Position = {3, 4},
-  robot_simulator:place( Robot, north, Position ),
-  robot_simulator:left( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= west ),
-  ?assert( robot_simulator:position(Robot) =:= Position ),
-  robot_simulator:left( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= south ),
-  ?assert( robot_simulator:position(Robot) =:= Position ),
-  robot_simulator:left( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= east ),
-  ?assert( robot_simulator:position(Robot) =:= Position ),
-  robot_simulator:left( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= north ),
-  ?assert( robot_simulator:position(Robot) =:= Position ).
-
-right_test() ->
-  Robot = robot_simulator:create(),
-  Position = {5, 6},
-  robot_simulator:place( Robot, north, Position ),
-  robot_simulator:right( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= east ),
-  ?assert( robot_simulator:position(Robot) =:= Position ),
-  robot_simulator:right( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= south ),
-  ?assert( robot_simulator:position(Robot) =:= Position ),
-  robot_simulator:right( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= west ),
-  ?assert( robot_simulator:position(Robot) =:= Position ),
-  robot_simulator:right( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= north ),
-  ?assert( robot_simulator:position(Robot) =:= Position ).
-
-advance_north_test() ->
-  Robot = robot_simulator:create(),
-  Direction = north,
-  robot_simulator:place( Robot, Direction, {7, 8} ),
-  robot_simulator:advance( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= Direction ),
-  ?assert( robot_simulator:position(Robot) =:= {7, 9} ).
-
-advance_south_test() ->
-  Robot = robot_simulator:create(),
-  Direction = south,
-  robot_simulator:place( Robot, Direction, {9, 10} ),
-  robot_simulator:advance( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= Direction ),
-  ?assert( robot_simulator:position(Robot) =:= {9, 9} ).
-
-advance_east_test() ->
-  Robot = robot_simulator:create(),
-  Direction = east,
-  robot_simulator:place( Robot, Direction, {11, 12} ),
-  robot_simulator:advance( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= Direction ),
-  ?assert( robot_simulator:position(Robot) =:= {12, 12} ).
-
-advance_west_test() ->
-  Robot = robot_simulator:create(),
-  Direction = west,
-  robot_simulator:place( Robot, Direction, {13, 14} ),
-  robot_simulator:advance( Robot ),
-  ?assert( robot_simulator:direction(Robot) =:= Direction ),
-  ?assert( robot_simulator:position(Robot) =:= {12, 14} ).
-
-control_test() ->
-  Robot = robot_simulator:create(),
-  robot_simulator:place( Robot, north, {7, 3} ),
-  robot_simulator:control( Robot, "RAALAL" ),
-  ?assert( robot_simulator:direction(Robot) =:= west ),
-  ?assert( robot_simulator:position(Robot) =:= {9, 4} ).
-
-control_unknown_test() ->
-  Robot = robot_simulator:create(),
-  Direction = north,
-  Position = {7, 3},
-  robot_simulator:place( Robot, Direction, Position ),
-  robot_simulator:control( Robot, "unknown" ),
-  ?assert( robot_simulator:direction(Robot) =:= Direction ),
-  ?assert( robot_simulator:position(Robot) =:= Position ).

data/tracks/erlang/exercises/roman-numerals/roman_numerals.erl

@@ -1,6 +0,0 @@
--module(roman_numerals).
-
--export([numerals/1]).
-
--spec numerals(non_neg_integer()) -> string().
-numerals(Number) ->  "".

data/tracks/erlang/exercises/series/series_tests.erl

@@ -1,6 +0,0 @@
--module( series_tests ).
--include_lib( "eunit/include/eunit.hrl" ).
-
-three_test() -> ?assert( series:from_string(3, "01234") =:= ["012", "123", "234"] ).
-
-four_test() -> ?assert( series:from_string(4, "01234") =:= ["0123", "1234"] ).

data/tracks/erlang/exercises/space-age/space_age_tests.erl

@@ -1,48 +0,0 @@
--module(space_age_tests).
-
--include_lib("eunit/include/eunit.hrl").
-
-age_in_earth_years_test() ->
-  equalFloat(space_age:ageOn(earth, 1000000000), 31.69).
-
-age_in_mercury_years_test() ->
-  Seconds = 2134835688,
-  equalFloat(space_age:ageOn(earth, Seconds), 67.65),
-  equalFloat(space_age:ageOn(mercury, Seconds), 280.88).
-
-age_in_venus_years_test() ->
-  Seconds = 189839836,
-  equalFloat(space_age:ageOn(earth, Seconds), 6.02),
-  equalFloat(space_age:ageOn(venus, Seconds), 9.78).
-
-age_in_mars_years_test() ->
-  Seconds = 2329871239,
-  equalFloat(space_age:ageOn(earth, Seconds), 73.83),
-  equalFloat(space_age:ageOn(mars, Seconds), 39.25).
-
-age_in_jupiter_years_test() ->
-  Seconds = 901876382,
-  equalFloat(space_age:ageOn(earth, Seconds), 28.58),
-  equalFloat(space_age:ageOn(jupiter, Seconds), 2.41).
-
-age_in_saturn_years_test() ->
-  Seconds = 3000000000,
-  equalFloat(space_age:ageOn(earth, Seconds), 95.06),
-  equalFloat(space_age:ageOn(saturn, Seconds), 3.23).
-
-age_in_uranus_years_test() ->
-  Seconds = 3210123456,
-  equalFloat(space_age:ageOn(earth, Seconds), 101.72),
-  equalFloat(space_age:ageOn(uranus, Seconds), 1.21).
-
-age_in_neptune_years_test() ->
-  Seconds = 8210123456,
-  equalFloat(space_age:ageOn(earth, Seconds), 260.16),
-  equalFloat(space_age:ageOn(neptune, Seconds), 1.58).
-
-equalFloat(A, B) ->
-  ?assertEqual(B, round(A,2)).
-
-round(Number, Precision) ->
-  P = math:pow(10, Precision),
-  round(Number * P) / P.

data/tracks/erlang/exercises/strain/strain_tests.erl

@@ -1,49 +0,0 @@
--module(strain_tests).
-
--include_lib("eunit/include/eunit.hrl").
-
-empty_keep_test() ->
-  ?assertEqual([], strain:keep(fun(X) -> X < 10 end, [])).
-
-keep_everything_test() ->
-  ?assertEqual([1, 2, 3], strain:keep(fun(X) -> X < 10 end, [1,2,3])).
-
-keep_first_last_test() ->
-  ?assertEqual([1, 3], strain:keep(fun(X) -> odd(X) end, [1,2,3])).
-
-keep_nothin_test() ->
-  ?assertEqual([], strain:keep(fun(X) -> even(X) end, [1,3,5,7])).
-
-keep_neither_first_nor_last_test() ->
-  ?assertEqual([2], strain:keep(fun(X) -> even(X) end, [1,2,3])).
-
-keep_strings_test() ->
-  Str = ["apple", "zebra", "banana", "zombies", "cherimoya", "zealot"],
-  ?assertEqual(
-     ["zebra", "zombies", "zealot"],
-     strain:keep(fun(S) -> string:sub_string(S, 1,1) =:= "z" end, Str)).
-
-empty_discard_test() ->
-  ?assertEqual([], strain:discard(fun(X) -> X < 10 end, [])).
-
-discard_everything_test() ->
-  ?assertEqual([], strain:discard(fun(X) -> X < 10 end, [1,2,3])).
-
-discard_first_and_last_test() ->
-  ?assertEqual([2], strain:discard(fun(X) -> odd(X) end, [1,2,3])).
-
-discard_nothing_test() ->
-  ?assertEqual([1, 3, 5, 7], strain:discard(fun(X) -> even(X) end, [1,3,5,7])).
-
-discard_neither_first_nor_last_test() ->
-  ?assertEqual([1, 3], strain:discard(fun(X) -> even(X) end, [1,2,3])).
-
-discard_strings_test() ->
-  Str = ["apple", "zebra", "banana", "zombies", "cherimoya", "zealot"],
-  ?assertEqual(
-     ["apple", "banana", "cherimoya"],
-     strain:discard(fun(S) -> string:sub_string(S, 1,1) =:= "z" end, Str)).
-
-odd(N) -> N rem 2 > 0.
-
-even(N) -> N rem 2 =:= 0.

data/tracks/erlang/exercises/sum-of-multiples/sum_of_multiples_tests.erl

@@ -1,37 +0,0 @@
--module(sum_of_multiples_tests).
--import(sum_of_multiples, [sumOfMultiples/2]).
-
--include_lib("eunit/include/eunit.hrl").
-
-sum_with_3_5_to_1_test() ->
-  ?assertEqual(0, sumOfMultiples([3, 5], 1)).
-
-sum_with_3_5_to_3_test() ->
-  ?assertEqual(3, sumOfMultiples([3, 5], 4)).
-
-sum_with_3_5_to_10_test() ->
-  ?assertEqual(23, sumOfMultiples([3, 5], 10)).
-
-sum_with_3_5_to_100_test() ->
-  ?assertEqual(2318, sumOfMultiples([3, 5], 100)).
-
-sum_with_3_5_to_1000_test() ->
-  ?assertEqual(233168, sumOfMultiples([3, 5], 1000)).
-
-sum_with_7_13_17_to_20_test() ->
-  ?assertEqual(51, sumOfMultiples([7,13,17], 20)).
-
-sum_with_4_6_to_15_test() ->
-?assertEqual(30, sumOfMultiples([4,6], 15)).
-
-sum_with_5_6_8_to_150_test() ->
-?assertEqual(4419, sumOfMultiples([5, 6, 8], 150)).
-
-sum_with_43_47_to_10000_test() ->
-  ?assertEqual(2203160, sumOfMultiples([43,47], 10000)).
-
-sum_with_1_to_100_test() ->
-  ?assertEqual(4950, sumOfMultiples([1], 100)).
-
-sum_with_empty_to_10000_test() ->
-  ?assertEqual(0, sumOfMultiples([], 10000)).

data/tracks/erlang/exercises/trinary/trinary_tests.erl

@@ -1,37 +0,0 @@
--module(trinary_tests).
--include_lib("eunit/include/eunit.hrl").
-
-% To run tests:
-% erl -make
-% erl -noshell -eval "eunit:test(trinary, [verbose])" -s init stop
-
-trinary_1_is_decimal_1_test() ->
-  ?assertEqual(1, trinary:to_decimal("1")).
-
-trinary_2_is_decimal_2_test() ->
-  ?assertEqual(2, trinary:to_decimal("2")).
-
-trinary_10_is_decimal_3_test() ->
-  ?assertEqual(3, trinary:to_decimal("10")).
-
-trinary_11_is_decimal_4_test() ->
-  ?assertEqual(4, trinary:to_decimal("11")).
-
-trinary_100_is_decimal_9_test() ->
-  ?assertEqual(9, trinary:to_decimal("100")).
-
-trinary_112_is_decimal_14_test() ->
-  ?assertEqual(14, trinary:to_decimal("112")).
-
-trinary_222_is_decimal_26_test() ->
-  ?assertEqual(26, trinary:to_decimal("222")).
-
-trinary_1120_is_decimal_42_test() ->
-  ?assertEqual(42, trinary:to_decimal("1120")).
-
-trinary_1122000120_is_decimal_32091_test() ->
-  ?assertEqual(32091, trinary:to_decimal("1122000120")).
-
-invalid_trinary_is_decimal_0_test() ->
-  ?assertEqual(0, trinary:to_decimal("carrot")).
-

data/tracks/erlang/exercises/zipper/zipper_tests.erl

@@ -1,103 +0,0 @@
-% To run tests:
-% erl -make
-% erl -noshell -eval "eunit:test(zipper, [verbose])" -s init stop
-
--module(zipper_tests).
--include_lib("eunit/include/eunit.hrl").
-
-%% Fixtures and helpers
-
-%% defp bt(value, left, right), do: %BT{value: value, left: left, right: right}
-%% defp leaf(value), do: %BT{value: value}
-
-bt(V, L, R) -> zipper:new_tree(V, L, R).
-empty() -> zipper:empty().
-leaf(V) -> zipper:new_tree(V, empty(), empty()).
-
-
-t1() -> bt(1, bt(2, empty(), leaf(3)), leaf(4)).
-t2() -> bt(1, bt(5, empty(), leaf(3)), leaf(4)).
-t3() -> bt(1, bt(2, leaf(5), leaf(3)), leaf(4)).
-t4() -> bt(1, leaf(2),                 leaf(4)).
-t5() -> bt(1, bt(2, empty(), leaf(3)), bt(6, leaf(7), leaf(8))).
-t6() -> bt(1, bt(2, empty(), leaf(5)), leaf(4)).
-
-data_is_retained_test() ->
-    Exp = t1(),
-    ?assertMatch(Exp, zipper:to_tree(zipper:from_tree(t1()))).
-
-left_right_and_value_test() ->
-    ?assertMatch(3, zipper:value(zipper:right(zipper:left(zipper:from_tree(t1()))))).
-
-dead_end_test() ->
-    Exp = empty(),
-    ?assertMatch(Exp, zipper:left(zipper:left(zipper:from_tree(t1())))).
-
-tree_from_deep_focus_test() ->
-    Exp = t1(),
-    Zipper = zipper:right(zipper:left(zipper:from_tree(t1()))),
-    ?assertMatch(Exp, zipper:to_tree(Zipper)).
-
-traversing_up_from_top_test() ->
-    Exp = empty(),
-    ?assertMatch(Exp, zipper:up(zipper:from_tree(t1()))).
-
-left_right_and_up_test() ->
-    Act0 = zipper:from_tree(t1()),
-    Act1 = zipper:left(Act0),
-    Act2 = zipper:up(Act1),
-    Act3 = zipper:right(Act2),
-    Act4 = zipper:up(Act3),
-    Act5 = zipper:left(Act4),
-    Act6 = zipper:right(Act5),
-    ?assertMatch(3, zipper:value(Act6)).
-
-set_value_test() ->
-    Exp  = t2(),
-    Act0 = zipper:from_tree(t1()),
-    Act1 = zipper:left(Act0),
-    Act2 = zipper:set_value(Act1, 5),
-    Act3 = zipper:to_tree(Act2),
-    ?assertMatch(Exp, Act3).
-
-set_value_after_traversiing_up_test() ->
-    Exp  = t2(),
-    Act0 = zipper:from_tree(t1()),
-    Act1 = zipper:left(Act0),
-    Act2 = zipper:right(Act1),
-    Act3 = zipper:up(Act2),
-    Act4 = zipper:set_value(Act3, 5),
-    Act5 = zipper:to_tree(Act4),
-    ?assertMatch(Exp, Act5).
-
-set_left_with_leaf_test() ->
-    Exp  = t3(),
-    Act0 = zipper:from_tree(t1()),
-    Act1 = zipper:left(Act0),
-    Act2 = zipper:set_left(Act1, leaf(5)),
-    Act3 = zipper:to_tree(Act2),
-    ?assertMatch(Exp, Act3).
-
-set_right_with_empty_test() ->
-    Exp  = t4(),
-    Act0 = zipper:from_tree(t1()),
-    Act1 = zipper:left(Act0),
-    Act2 = zipper:set_right(Act1, empty()),
-    Act3 = zipper:to_tree(Act2),
-    ?assertMatch(Exp, Act3).
-
-set_right_with_subtree_test() ->
-    Exp  = t5(),
-    Act0 = zipper:from_tree(t1()),
-    Act1 = zipper:set_right(Act0, bt(6, leaf(7), leaf(8))),
-    Act2 = zipper:to_tree(Act1),
-    ?assertMatch(Exp, Act2).
-
-set_value_from_deep_focus_test() ->
-    Exp  = t6(),
-    Act0 = zipper:from_tree(t1()),
-    Act1 = zipper:left(Act0),
-    Act2 = zipper:right(Act1),
-    Act3 = zipper:set_value(Act2, 5),
-    Act4 = zipper:to_tree(Act3),
-    ?assertMatch(Exp, Act4).