trackler 2.0.6.19 → 2.0.6.20

data/tracks/ocaml/exercises/luhn/test.ml

@@ -6,7 +6,7 @@ let assert_valid expected input _test_ctxt =
   assert_equal ~printer:Bool.to_string expected (valid input)
 
 let tests = [
-  "single digit strings are not valid" >::
+  "single digit strings can not be valid" >::
     assert_valid false "1";
   "A single zero is invalid" >::
     assert_valid false "0";
@@ -16,8 +16,8 @@ let tests = [
     assert_valid false "046 454 287";
   "invalid credit card" >::
     assert_valid false "8273 1232 7352 0569";
-  "strings that contain non-digits are not valid" >::
-    assert_valid false "827a 1232 7352 0569";
+  "valid strings with a non-digit added become invalid" >::
+    assert_valid false "046a 454 286";
 ]
 
 let () =

data/tracks/ocaml/tools/test-generator/templates/dominoes/template.ml

@@ -4,16 +4,22 @@ open Dominoes
 
 let print_dominoe (d1, d2) = sprintf "(%d,%d)" d1 d2
 
+let dominoes_printer xs = "[" ^ String.concat ~sep:";" (List.map xs ~f:print_dominoe) ^ "]"
 let option_printer = function
   | None -> "None"
-  | Some xs -> "Some [" ^ String.concat ~sep:";" (List.map xs ~f:print_dominoe) ^ "]"
+  | Some xs -> "Some " ^ dominoes_printer xs
 
-let drop_1_right xs = List.rev xs |> List.tl_exn |> List.rev
+let rotate_1 xs = List.tl_exn xs @ [List.hd_exn xs]
 
-let check_chain (chained: dominoe list) = 
+let norm l =
+  let norm1 (x, y) = if x > y then (y, x) else (x, y) in
+  List.map ~f:norm1 l |> List.sort ~cmp:compare
+
+let check_chain (input: dominoe list) (chained: dominoe list) =
+  assert_equal (norm input) (norm chained) ~printer:dominoes_printer ~msg:"chain doesn't use the same dominoes as the input";
   let assert_dominoes_match d1 d2 =
     if snd d1 <> fst d2 then failwith @@ sprintf "%s and %s cannot be chained together" (print_dominoe d1) (print_dominoe d2) else () in
-  let consecutives = List.zip_exn (drop_1_right chained) (List.tl_exn chained) in
+  let consecutives = List.zip_exn chained (rotate_1 chained) in
   List.iter consecutives ~f:(fun (d1, d2) -> assert_dominoes_match d1 d2)
 
 let assert_empty c = if List.is_empty c then () else failwith "Expected 0 length chain"
@@ -21,7 +27,7 @@ let assert_empty c = if List.is_empty c then () else failwith "Expected 0 length
 let assert_valid_chain input _ctxt =
   match chain input with
   | None -> failwith "Expecting a chain"
-  | Some(c) -> (if List.is_empty input then assert_empty else check_chain) c  
+  | Some(c) -> (if List.is_empty input then assert_empty else check_chain input) c
 
 let assert_no_chain input _ctxt =
   assert_equal None (chain input) ~printer:option_printer

data/tracks/pascal/config.json

@@ -1,6 +1,6 @@
 {
   "slug": "pascal",
-  "language": "Object Pascal",
+  "language": "Delphi Pascal",
   "repository": "https://github.com/exercism/xpascal",
   "active": false,
   "exercises": [

data/tracks/pascal/docs/INSTALLATION.md

@@ -17,4 +17,56 @@ With Delphi successfully installed, and working correctly, please follow these s
 - Step-by-step instructions on how to install DUnitX into Delphi have been posted by Vincent Parrett in a blog post located [here](https://www.finalbuilder.com/resources/blogs/postid/702/dunitx-has-a-wizard).
 - The Starter Edition of Delphi doesn't allow the use of project experts.  DUnitX comes with an expert which will aid the student in creating a new DUnitX based project.  The expert creates the project's .DPR file.  The exercises in this track all include the .DPR file making the expert not necessary.  DUnitX otherwise has no issues with projects created in Delphi versions starting with XE all the way up to and including the Starter Edition of Berlin.
 
+### Delphi Configuration for DunitX ###
+
+If you had to install DUnitX because your installation didn't already come with it then please follow the following illustrated steps to make the necessary configuration changes to Delphi in order for it to locate your installation of DUnitX.
+
+*Note: it is assumed that you have completed the installation of Delphi by this point.*
+
+- Start Delphi.  If your installation is new you will most likely end up at a Welcome Page similar to this.
+
+![Welcome Page](http://x.exercism.io/v3/tracks/pascal/docs/img/00delphiwelcomepage.png)
+
+- Find and click `Tools` along the top menu.
+ 
+![Tools](http://x.exercism.io/v3/tracks/pascal/docs/img/01delphiclicktools.png)
+
+- Click `Options`.
+
+![Options](http://x.exercism.io/v3/tracks/pascal/docs/img/02delphiclickoptions.png)
+
+- Along the left side of the Options screen find and click on `Environment Variables`.
+
+![Options Screen Environment Variables](http://x.exercism.io/v3/tracks/pascal/docs/img/03delphioptionsenvironmentvariables.png)
+
+- Click the `New` button located in the `User overrides` group 
+
+![Click New](http://x.exercism.io/v3/tracks/pascal/docs/img/04delphioptionsenvironmentvariablesclicknew.png)
+
+- A New User Variable window should appear that contains two fields.  In the top field enter `DUNITX` for the Variable Name.  In the bottom field enter the complete path to your copy of DUnitX, for example mine is `C:\Program Files\Embarcadero\Studio\18.0\source\DUnitX`. Click the `Ok` button to then close this window.
+
+![New User Variable](http://x.exercism.io/v3/tracks/pascal/docs/img/05delphinewuservariable.png)
+
+- Locate and click on `Library` along the left side of the Options screen.
+
+![Library](http://x.exercism.io/v3/tracks/pascal/docs/img/06delphioptionslibrary.png)
+
+- Click the `...` button associated with the Library path in the Directories group
+
+![...button](http://x.exercism.io/v3/tracks/pascal/docs/img/07delphiclicklibrarypathbutton.png)
+
+- In the Directories window enter the variable name that you created a few steps ago.  The entry should appear like this `$(DUNITX)` 
+
+![Directories](http://x.exercism.io/v3/tracks/pascal/docs/img/08delphidirectoriesinputvarnameclickadd.png)
+
+- Click the `Add` button to add this new item to the list.
+
+- Click the `Ok` button to store the change.
+
+![ClickOK](http://x.exercism.io/v3/tracks/pascal/docs/img/09delphidirectoriesclickok.png)
+
+- Finally, click the `Ok` button on the Options window to save all the changes.
+
+Delphi will now be able to locate units that pertain to the DUnitX testing framework library.
+
 *Note: It is assumed that Delphi versions XE and higher are being utilized by the student.*

data/tracks/pascal/exercises/nucleotide-count/uNucleotideCountExample.pas

@@ -6,33 +6,19 @@ uses SysUtils, System.Generics.Collections;
 type
   EInvalidNucleotideException = class(Exception);
 
-  IDNA = interface(IInvokable)
-  ['{AE218E73-90BB-4445-B40E-D8693CA54E2F}']
-    function Count(aChar: char): integer;
-    function GetNucleotideCounts: TDictionary<char, integer>;
-    property NucleotideCounts: TDictionary<char, integer> read GetNucleotideCounts;
-  end;
-
-  function NewDNA(aSequence: string): IDNA;
-
-implementation
-
-type
-  TDNA = class(TInterfacedObject, IDNA)
+  TDNA = class
   private
     fNucleotideCounts: TDictionary<char, integer>;
-  protected
     function GetNucleotideCounts: TDictionary<char, integer>;
   public
     constructor create(aSequence: string);
+    destructor destroy;
     function Count(aChar: char): integer;
     property NucleotideCounts: TDictionary<char, integer> read GetNucleotideCounts;
   end;
 
-function NewDNA(aSequence: string): IDNA;
-begin
-  result := TDNA.create(aSequence);
-end;
+implementation
+
 
 constructor TDNA.create(aSequence: string);
 var NucleotideList: TList<TPair<char, integer>>;
@@ -57,6 +43,11 @@ begin
   end;
 end;
 
+destructor TDNA.Destroy;
+begin
+  fNucleotideCounts.Free;
+end;
+
 function TDNA.GetNucleotideCounts: TDictionary<char, integer>;
 begin
   result := fNucleotideCounts;

data/tracks/pascal/exercises/nucleotide-count/uNucleotideCountTest.pas

@@ -81,7 +81,7 @@ begin
 end;
 
 procedure NucleoTideCountTest.Has_no_nucleotides;
-var dna: IDNA;
+var dna: TDNA;
     expected: TDictionary<char, integer>;
 begin
   expected := TDictionary<char, integer>.Create;
@@ -90,33 +90,33 @@ begin
   expected.Add('C',0);
   expected.Add('G',0);
 
-  dna := NewDNA('');
+  dna := TDNA.Create('');
 
   CompareDictionaries(expected, dna.NucleotideCounts);
 end;
 
 procedure NucleoTideCountTest.Has_no_adenosine;
-var dna: IDNA;
+var dna: TDNA;
     inStr: string;
 begin
   inStr := '';
-  dna := NewDNA(inStr);
+  dna := TDNA.Create(inStr);
 
   Assert.AreEqual(length(inStr), dna.Count('A'));
 end;
 
 procedure NucleoTideCountTest.Repetitive_cytidine_gets_counts;
-var dna: IDNA;
+var dna: TDNA;
     inStr: string;
 begin
   inStr := 'CCCCC';
-  dna := NewDNA(inStr);
+  dna := TDNA.Create(inStr);
 
   Assert.AreEqual(length(inStr), dna.Count('C'));
 end;
 
 procedure NucleoTideCountTest.Repetitive_sequence_has_only_guanosine;
-var dna: IDNA;
+var dna: TDNA;
     expected: TDictionary<char, integer>;
     inStr: string;
 begin
@@ -127,27 +127,27 @@ begin
   expected.Add('G',8);
   inStr := 'GGGGGGGG';
 
-  dna := NewDNA(inStr);
+  dna := TDNA.Create(inStr);
 
   CompareDictionaries(expected, dna.NucleotideCounts);
 end;
 
 procedure NucleoTideCountTest.Counts_only_thymidine;
-var dna: IDNA;
+var dna: TDNA;
     inStr: string;
 begin
   inStr := 'GGGGTAACCCGG';
-  dna := NewDNA(inStr);
+  dna := TDNA.Create(inStr);
 
   Assert.AreEqual(length('T'), dna.Count('T'));
 end;
 
 procedure NucleoTideCountTest.Counts_a_nucleotide_only_once;
-var dna: IDNA;
+var dna: TDNA;
     inStr: string;
 begin
   inStr := 'GGTTGG';
-  dna := NewDNA(inStr);
+  dna := TDNA.Create(inStr);
   dna.Count('T');
 
   Assert.AreEqual(2, dna.Count('T'));
@@ -157,11 +157,11 @@ procedure NucleoTideCountTest.Validates_nucleotides;
 var MyProc: TTestLocalMethod;
 begin
   MyProc := procedure
-            var dna: IDNA;
+            var dna: TDNA;
                 inStr: string;
             begin
               inStr := 'GGTTGG';
-              dna := NewDNA(inStr);
+              dna := TDNA.Create(inStr);
               dna.Count('X');
             end;
 
@@ -169,7 +169,7 @@ begin
 end;
 
 procedure NucleoTideCountTest.Counts_all_nucleotides;
-var dna: IDNA;
+var dna: TDNA;
     expected: TDictionary<char, integer>;
     inStr: string;
 begin
@@ -180,7 +180,7 @@ begin
   expected.Add('G',17);
   inStr := 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC';
 
-  dna := NewDNA(inStr);
+  dna := TDNA.Create(inStr);
 
   CompareDictionaries(expected, dna.NucleotideCounts);
 end;

data/tracks/php/config.json

@@ -331,6 +331,13 @@
       "Algorithms",
       "Transforming"
     ]
+  },
+  {
+    "slug": "book-store",
+    "difficulty": 3,
+    "topics": [
+      "Algorithms"
+    ]
   }
   ]
 }

data/tracks/php/exercises/book-store/book-store_test.php

@@ -0,0 +1,146 @@
+<?php
+
+include_once 'book-store.php';
+
+/**
+ * Calculate lowest price for shopping basket only
+ * containing books from a single series. There is no
+ * discount advantage for having more than one copy of
+ * any single book in a grouping.
+ */
+
+class BookStoreTest extends PHPUnit_Framework_TestCase
+{
+
+    /**
+     * A basket containing only a single book.
+     * Target grouping: [[1]]
+     */
+    public function testSingleBook()
+    {
+        $basket = [1];
+        $this->assertEquals(8.0, total($basket));
+    }
+
+    /**
+     * A basket containing only two of the same book.
+     * Target grouping: [[2], [2]]
+     */
+    public function testTwoSame()
+    {
+        $basket = [2, 2];
+        $this->assertEquals(16.0, total($basket));
+    }
+
+    /**
+     * No charge to carry around an empty basket.
+     * Target grouping: []
+     */
+    public function testEmpty()
+    {
+        $basket = [];
+        $this->assertEquals(0.0, total($basket));
+    }
+
+    /**
+     * A basket containing only two different books.
+     * Target grouping: [[1, 2]]
+     */
+    public function testTwoDifferent()
+    {
+        $basket = [1, 2];
+        $this->assertEquals(15.2, total($basket));
+    }
+
+    /**
+     * A basket of three different books.
+     * Target grouping: [[1, 2, 3]]
+     */
+    public function testThreeDifferent()
+    {
+        $basket = [1, 2, 3];
+        $this->assertEquals(21.60, total($basket));
+    }
+
+    /**
+     * A basket of four different books.
+     * Target grouping: [[1, 2, 3, 4]]
+     */
+    public function testFourDifferent()
+    {
+        $basket = [1, 2, 3, 4];
+        $this->assertEquals(25.60, total($basket));
+    }
+
+    /**
+     * A basket of five different books.
+     * Target grouping: [[1, 2, 3, 4, 5]]
+     */
+    public function testFiveDifferent()
+    {
+        $basket = [1, 2, 3, 4, 5];
+        $this->assertEquals(30.00, total($basket));
+    }
+
+    /**
+     * A basket containing eight books consisting of a
+     * pair each of the first three books plus one copy
+     * each of the last two books. Please pay careful
+     * attention to this particular target grouping, it
+     * is not intuitive, but does grant the largest
+     * discount.
+     * Target grouping: [[1, 2, 3, 4], [1, 2, 3, 5]]
+     */
+    public function testEight()
+    {
+        $basket = [1, 1, 2, 2, 3, 3, 4, 5];
+        $this->assertEquals(51.20, total($basket));
+    }
+
+    /**
+     * A basket containing nine books consisting of a
+     * pair each of the first four books plus one of
+     * the last book.
+     * Target grouping: [[1, 2, 3, 4, 5], [1, 2, 3, 4]],
+     */
+    public function testFourPairsPlusOne()
+    {
+        $basket = [1, 1, 2, 2, 3, 3, 4, 4, 5];
+        $this->assertEquals(55.60, total($basket));
+    }
+
+    /**
+     * A basket containing ten books consisting of two
+     * copies of each book in the series.
+     * Target grouping: [[1, 2, 3, 4, 5], [1, 2, 3, 4, 5]]
+     */
+    public function testFivePairs()
+    {
+        $basket = [1, 1, 2, 2, 3, 3, 4, 4, 5, 5];
+        $this->assertEquals(60.00, total($basket));
+    }
+
+    /**
+     * A basket containing eleven books consisting
+     * of three copies of the first book plus two each
+     * of the remaining four books in the series.
+     * Target grouping: [[1, 2, 3, 4, 5], [1, 2, 3, 4, 5], [1]]
+     */
+    public function testFivePairsPlusOne()
+    {
+        $basket = [1, 1, 2, 2, 3, 3, 4, 4, 5, 5, 1];
+        $this->assertEquals(68.00, total($basket));
+    }
+
+    /**
+     * A basket containing twelve books consisting of
+     * three copies of the first two books, plus two
+     * each of the remaining three books in the series.
+     * Target grouping: [[1, 2, 3, 4, 5], [1, 2, 3, 4, 5], [1, 2]]
+     */
+    public function testTwelve()
+    {
+        $basket = [1, 1, 2, 2, 3, 3, 4, 4, 5, 5, 1, 2];
+        $this->assertEquals(75.20, total($basket));
+    }
+}