trackler 2.0.0.6 → 2.0.0.7

checksums.yaml

@@ -1,7 +1,7 @@
 ---
 SHA1:
-  metadata.gz: fd26f913270ca0a9e000f69e94f05f446e3dbcf0
-  data.tar.gz: be8dca46c9162bd55189ae5840d5f9cce840cfa6
+  metadata.gz: ede1a059794b17371969bee2e6a0084800e958b3
+  data.tar.gz: 15006a8b2b6a8676d6815acb179bcd5c83536b4e
 SHA512:
-  metadata.gz: 40227845c9e6200c10cd5f4eb6f1d7b78bfba7160b9adaafc804293f92b7b0fef3eae27f56c3c810b4ed2daf6761b29e32a6d5dfbf9e77f788d0355d2cc95b28
-  data.tar.gz: 944ef6f86d085ea5b0d20e1c048ac31bc95f54a38f99ce7f0f9cf6358de4c6cd8a2bb096fb4b00f64455441115432bf45819cea2b1d9f23dc8b76f98788929b4
+  metadata.gz: d422468e9102e5055b208c0110d0c57d57c12cbaf46f81d3e237481a130c46566c8e00295000774b7b3287ea4c9a86ab2dfd05a49fa7b0e665d2db8718b727d9
+  data.tar.gz: 87cd0152877bde73b180983227b563a9acad8f2a5a14104bdb522fc82e262fce3388c1c15407b76e61000cb89c9724c968aea870fbfafdd264ed171acbeec783

data/.gitmodules

@@ -162,4 +162,4 @@
 	url = https://github.com/exercism/xpascal.git
 [submodule "tracks/prolog"]
 	path = tracks/prolog
-	url = https://github.com/exercism/xprolog
+	url = https://github.com/exercism/xprolog.git

data/lib/trackler/version.rb

@@ -1,3 +1,3 @@
 module Trackler
-  VERSION = "2.0.0.6"
+  VERSION = "2.0.0.7"
 end

data/tracks/prolog/README.md

@@ -1,12 +1,76 @@
-# Exercism prolog Track
+# xProlog
 ![build status](https://travis-ci.org/exercism/xprolog.svg?branch=master)
 
-Exercism exercises in prolog.
+Exercism Exercises in Prolog
 
-## TODO
+## Setup
 
-_Document how to contribute to the prolog track._
+See [INSTALLATION.md](https://github.com/exercism/xprolog/blob/master/docs/INSTALLATION.md)
 
-## Contributing Guide
+##Contributing
 
-Please see the [contributing guide](https://github.com/exercism/x-common/blob/master/CONTRIBUTING.md).
+Thank you so much for contributing! :tada:
+
+We welcome pull requests that provide fixes and improvements to existing
+exercises. If you're unsure, then go ahead and open a GitHub issue, and we'll
+discuss the change.
+
+Please keep the following in mind:
+
+- Please start by reading the general Exercism [contributing guide](https://github.com/exercism/x-api/blob/master/CONTRIBUTING.md#the-exercise-data).
+
+- Pull requests should be focused on a single exercise, issue, or change.
+
+- We welcome changes to code style, and wording. Please open a separate PR for
+  these changes if possible.
+
+- Please open an issue before creating a PR that makes significant (breaking)
+  changes to an existing exercise or makes changes across many exercises. It is
+  best to discuss these changes before doing the work.
+
+- Watch out for trailing spaces, extra blank lines, and spaces in blank lines.
+
+- Each exercise must stand on its own. Do not reference files outside the
+  exercise directory. They will not be included when the user fetches the
+  exercise.
+
+- Please do not add a README or README.md file to the exercise directory. The
+READMEs are constructed using shared metadata, which lives in the [exercism/x-common](https://github.com/exercism/x-common) repository.
+
+- Each problem should have a test suite, an example solution, and a template
+file for the real implementation. The example solution should have the
+`.example` file extension.
+
+- Each test file should have code like the following at the top of the file.
+  This allows the tests to be run on CI and configures tests to be skipped with
+  the `condition(pending)` flag.
+
+```prolog 
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
+```
+
+- All but the initial test for each exercise should be`condition(pending)`. The
+  first test should have `condition(true)` as an example of how to change the
+  tests to run. Here are the first two tests in the `hello_world` exercise.
+
+```prolog 
+test(hello_world, condition(true)) :-
+    hello_world('Hello World!').
+
+test(hello_world_with_a_name, condition(pending)) :-
+    hello_world('Alice', 'Hello Alice!').
+```
+
+All the tests for xProlog exercises can be run from the top level of the repo
+with `bin/build.sh`. Please run this command before submitting your PR.
+
+## License
+
+The MIT License (MIT)
+
+Copyright (c) 2016 Katrina Owen, _@kytrinyx.com

data/tracks/prolog/bin/build.sh

@@ -5,17 +5,13 @@ for example_file in exercises/**/*.example
 do
     exercise_dir=$(dirname $example_file)
     exercise=$(basename $example_file .example)
-    mv "$exercise_dir/$exercise.pl" "$exercise_dir/$exercise.impl"
-    mv "$exercise_dir/$exercise.example" "$exercise_dir/$exercise.pl"
     echo '-------------------------------------------------------'
     echo "Testing $exercise"
-    swipl -f  "$exercise_dir/$exercise.pl" -s "$exercise_dir/${exercise}_tests.plt" -g run_tests,halt -t 'halt(1)'
+    swipl -f  "$exercise_dir/$exercise.example" -s "$exercise_dir/${exercise}_tests.plt" -g run_tests,halt -t 'halt(1)' -- --all
     if [ $? -ne 0 ]; then
         TEST_RESULT=1
         FAILED_EXERCISES+="$exercise\n"
     fi
-    mv "$exercise_dir/$exercise.pl" "$exercise_dir/$exercise.example"
-    mv "$exercise_dir/$exercise.impl" "$exercise_dir/$exercise.pl"
 done
 
 if [ $TEST_RESULT -ne 0 ]; then

data/tracks/prolog/docs/ABOUT.md

@@ -0,0 +1,9 @@
+Prolog-- short for "Programming Logic"-- is a
+[declarative](https://en.wikipedia.org/wiki/Declarative_programming) and logic
+based programming language developed in 1972 by Alain Colmerauer and Philippe
+Roussel. It has many applications, most notably in Artificial Intelligence for
+its pattern matching abilities over natural language parse trees.
+
+Prolog is written in "facts" and "rules" that define logical formulas, similar
+to functional programs. Learning Prolog is a great way to improve skills with
+recursion, predicate logic, and constraint logic programming.

data/tracks/prolog/docs/INSTALLATION.md

@@ -0,0 +1,8 @@
+##Installation
+
+**Mac Users**: Install using homebrew with `brew install swi-prolog`. Alternatively, download the source for your machine from the (SWI Prolog Website)[http://www.swi-prolog.org/download/stable].
+
+**Windows Users**: Download the source for your machine from the (SWI Prolog Website)[http://www.swi-prolog.org/download/stable].
+
+**Linux Users**: Follow the instructions for your distro from (here)[http://www.swi-prolog.org/build/LinuxDistro.txt].
+

data/tracks/prolog/docs/LEARNING.md

@@ -0,0 +1,6 @@
+## References
+* [SWI-Prolog Getting Started](http://www.swi-prolog.org/pldoc/man?section=quickstart)
+* [Tutorials and Resources](http://www.swi-prolog.org/Links.html)
+* [Seven Languages in Seven Weeks by Bruce A. Tate - Chapter 4](https://pragprog.com/book/btlang/seven-languages-in-seven-weeks)
+* [Learn Prolog Now](http://www.learnprolognow.org)
+* [prolog :- tutorial](https://www.cpp.edu/~jrfisher/www/prolog_tutorial/pt_framer.html)

data/tracks/prolog/docs/RESOURCES.md

@@ -0,0 +1,4 @@
+## Resources 
+* [SWI Prolog Documentation](http://www.swi-prolog.org)
+* [Prolog on Stack Overflow](https://stackoverflow.com/tags/prolog)
+* [Tutorials and Resources](http://www.swi-prolog.org/Links.html)

data/tracks/prolog/docs/TESTS.md

@@ -0,0 +1,30 @@
+##Running Tests
+
+SWI Prolog can either be run interactively or by executing it directly at the
+command line.
+
+To run prolog interactively first run:
+
+`$ swipl`
+
+After the prolog console starts, load your implementation and run the tests
+with:
+
+```
+?- ["hello_world.pl"].
+?- ["hello_world_tests.plt"].
+?- run_tests.
+```
+
+To run your implementation directly run:
+
+`swipl -f hello_world.pl -s hello_world_tests.plt -g run_tests,halt -t
+'halt(1)'`
+
+In both cases, replace `hello_world.pl` and `hello_world_tests.plt` with the
+name of the exercise you are implementing.
+
+When you first begin an exercise, only the first test will run. The rest have
+been skipped by adding `condition(pedning)` to the `test` goal. Once the first
+test passes, un-skip the next test by changing `pending` in `condition(pedning)`
+to `true`. Repeat for each test until they are all running and passing.

data/tracks/prolog/exercises/anagram/anagram_tests.plt

@@ -1,57 +1,64 @@
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
 :- begin_tests(anagram).
 
-    test(no_matches) :-
-        anagram("diaper", [ "hello", "world", "zombies", "pants"], []).
+    test(no_matches, condition(true)) :-
+        anagram("diaper", [ "hello", "world", "zombies", "pants"], Result),
+        is_list(Result).
 
-    test(detects_simple_anagram) :-
+    test(detects_simple_anagram, condition(pending)) :-
         anagram("ant", ["tan", "stand", "at"], ["tan"]).
 
-    test(does_not_detect_false_positives) :-
+    test(does_not_detect_false_positives, condition(pending)) :-
         anagram("galea", ["eagle"], []).
 
-    test(detects_multiple_anagrams) :-
+    test(detects_multiple_anagrams, condition(pending)) :-
         anagram("master", ["stream", "pigeon", "maters"], ["stream", "maters"]).
 
-    test(does_not_detect_anagram_subsets) :-
+    test(does_not_detect_anagram_subsets, condition(pending)) :-
         anagram("good", ["dog", "goody"], []).
 
-    test(detects_anagram) :-
+    test(detects_anagram, condition(pending)) :-
         anagram("listen", ["enlists", "google", "inlets", "banana"], ["inlets"]).
 
-    test(detects_multiple_anagrams) :-
+    test(detects_multiple_anagrams, condition(pending)) :-
         anagram("allergy", ["gallery", "ballerina", "regally", "clergy", "largely", "leading"], ["gallery", "regally", "largely"]).
 
-    test(does_not_detect_identical_words) :-
+    test(does_not_detect_identical_words, condition(pending)) :-
         anagram("corn", ["corn", "dark", "Corn", "rank", "CORN", "cron", "park"], ["cron"]).
 
-    test(does_not_detect_nonanagrams_with_identical_checksum) :-
+    test(does_not_detect_nonanagrams_with_identical_checksum, condition(pending)) :-
         anagram("mass", ["last"], []).
 
-    test(detects_anagrams_case_insensitively) :-
+    test(detects_anagrams_case_insensitively, condition(pending)) :-
         anagram("Orchestra", ["cashregister", "Carthorse", "radishes"], ["Carthorse"]).
 
-    test(detects_anagrams_using_case_insensitive_subject) :-
+    test(detects_anagrams_using_case_insensitive_subject, condition(pending)) :-
         anagram("Orchestra", ["cashregister", "carthorse", "radishes"], ["carthorse"]).
 
-    test(detects_anagrams_using_case_insensitive_possible_matches) :-
+    test(detects_anagrams_using_case_insensitive_possible_matches, condition(pending)) :-
         anagram("orchestra", ["cashregister", "Carthorse", "radishes"], ["Carthorse"]).
 
-    test(does_not_detect_a_word_as_its_own_anagram) :-
+    test(does_not_detect_a_word_as_its_own_anagram, condition(pending)) :-
         anagram("banana", ["Banana"], []).
 
-    test(does_not_detect_a_anagram_if_the_original_word_is_repeated) :-
+    test(does_not_detect_a_anagram_if_the_original_word_is_repeated, condition(pending)) :-
         anagram("go", ["go Go GO"], []).
 
-    test(anagrams_must_use_all_letters_exactly_once) :-
+    test(anagrams_must_use_all_letters_exactly_once, condition(pending)) :-
         anagram("tapper", ["patter"], []).
 
-    test(detects_unicode_anagrams) :-
+    test(detects_unicode_anagrams, condition(pending)) :-
         anagram("ΑΒΓ", ["ΒΓΑ", "ΒΓΔ", "γβα"], ["ΒΓΑ", "γβα"]).
 
-    test(eliminates_misleading_unicode_anagrams) :-
+    test(eliminates_misleading_unicode_anagrams, condition(pending)) :-
         anagram("ΑΒΓ", ["ABΓ"], []).
 
-    test(capital_word_is_not_own_anagram) :-
+    test(capital_word_is_not_own_anagram, condition(pending)) :-
         anagram("BANANA", ["Banana"], []).
 
 :- end_tests(anagram).

data/tracks/prolog/exercises/binary/binary_tests.plt

@@ -1,51 +1,58 @@
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
 :- begin_tests(binary).
 
-    test(binary_0_is_decimal_0) :-
-        binary("0", 0).
+    test(binary_0_is_decimal_0, condition(true)) :-
+        binary("0", Result),
+            Result == 0.
 
-    test(binary_0_is_decimal_0) :-
+    test(binary_0_is_decimal_0, condition(pending)) :-
         binary("0", 0).
 
-    test(binary_1_is_decimal_1) :-
+    test(binary_1_is_decimal_1, condition(pending)) :-
         binary("1", 1).
 
-    test(binary_10_is_decimal_2) :-
+    test(binary_10_is_decimal_2, condition(pending)) :-
         binary("10", 2).
 
-    test(binary_11_is_decimal_3) :-
+    test(binary_11_is_decimal_3, condition(pending)) :-
         binary("11", 3).
 
-    test(binary_100_is_decimal_4) :-
+    test(binary_100_is_decimal_4, condition(pending)) :-
         binary("100", 4).
 
-    test(binary_1001_is_decimal_9) :-
+    test(binary_1001_is_decimal_9, condition(pending)) :-
         binary("1001", 9).
 
-    test(binary_11010_is_decimal_26) :-
+    test(binary_11010_is_decimal_26, condition(pending)) :-
         binary("11010", 26).
 
-    test(binary_10001101000_is_decimal_1128) :-
+    test(binary_10001101000_is_decimal_1128, condition(pending)) :-
         binary("10001101000", 1128).
 
-    test(binary_ignores_leading_zeros) :-
+    test(binary_ignores_leading_zeros, condition(pending)) :-
         binary("000011111", 31).
 
-    test(two_is_not_a_valid_binary_digit, [fail]) :-
+    test(two_is_not_a_valid_binary_digit, [fail, condition(pending)]) :-
         binary("2", _).
 
-    test(nonbinary_digit_is_invalid, [fail]) :-
+    test(nonbinary_digit_is_invalid, [fail, condition(pending)]) :-
         binary("01201", _).
 
-    test(trailing_nonbinary_characters_is_invalid, [fail]) :-
+    test(trailing_nonbinary_characters_is_invalid, [fail, condition(pending)]) :-
         binary("10nope", _).
 
-    test(nonbinary_characters_is_invalid, [fail]) :-
+    test(nonbinary_characters_is_invalid, [fail, condition(pending)]) :-
         binary("nope10", _).
 
-    test(internal_nonbinary_characters_is_invalid, [fail]) :-
+    test(internal_nonbinary_characters_is_invalid, [fail, condition(pending)]) :-
         binary("10nope10", _).
 
-    test(whitespace_separated_is_invalid, [fail]) :-
+    test(whitespace_separated_is_invalid, [fail, condition(pending)]) :-
         binary("001 nope", _).
 
 :- end_tests(binary).

data/tracks/prolog/exercises/grains/grains_tests.plt

@@ -1,39 +1,46 @@
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
 :- begin_tests(grains).
 
-    test(first) :-
-        square(1, 1).
+    test(first, condition(true)) :-
+        square(1, Result),
+            Result == 1.
 
-    test(second) :-
+    test(second, condition(pending)) :-
         square(2, 2).
 
-    test(third) :-
+    test(third, condition(pending)) :-
         square(3, 4).
 
-    test(sixteen) :-
+    test(sixteen, condition(pending)) :-
         square(16, 32768).
 
-    test(twenty_three) :-
+    test(twenty_three, condition(pending)) :-
         square(23, 4194304).
 
-    test(thirty_two) :-
+    test(thirty_two, condition(pending)) :-
         square(32, 2147483648).
 
-    test(fifty_five) :-
+    test(fifty_five, condition(pending)) :-
         square(55, 18014398509481984).
 
-    test(sixty_four) :-
+    test(sixty_four, condition(pending)) :-
         square(64, 9223372036854775808).
 
-    test(total) :-
+    test(total, condition(pending)) :-
         total(18446744073709551615).
 
-    test(zero, [fail]) :-
+    test(zero, [fail, condition(pending)]) :-
         square(0, _).
 
-    test(negative, [fail]) :-
+    test(negative, [fail, condition(pending)]) :-
         square(-1, _).
 
-    test(off_board, [fail]) :-
+    test(off_board, [fail, condition(pending)]) :-
         square(65, _).
 
 :- end_tests(grains).

data/tracks/prolog/exercises/hamming/hamming_tests.plt

@@ -1,48 +1,55 @@
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
 :- begin_tests(hamming).
 
-    test(identical_strands) :-
-        hamming_distance("A", "A", 0).
+    test(identical_strands, condition(true)) :-
+        hamming_distance("A", "A", Result),
+            Result == 0.
 
-    test(long_identical_strands) :-
+    test(long_identical_strands, condition(pending)) :-
         hamming_distance("GGACTGA", "GGACTGA", 0).
 
-    test(complete_distance_in_single_nucleotide_strands) :-
+    test(complete_distance_in_single_nucleotide_strands, condition(pending)) :-
         hamming_distance("A", "G", 1).
 
-    test(complete_distance_in_small_strands) :-
+    test(complete_distance_in_small_strands, condition(pending)) :-
         hamming_distance("AG", "CT", 2).
 
-    test(small_distance_in_small_strands) :-
+    test(small_distance_in_small_strands, condition(pending)) :-
         hamming_distance("AT", "CT", 1).
 
-    test(small_distance) :-
+    test(small_distance, condition(pending)) :-
         hamming_distance("GGACG", "GGTCG", 1).
 
-    test(small_distance_in_long_strands) :-
+    test(small_distance_in_long_strands, condition(pending)) :-
         hamming_distance("ACCAGGG", "ACTATGG", 2).
 
-    test(nonunique_character_in_first_strand) :-
+    test(nonunique_character_in_first_strand, condition(pending)) :-
         hamming_distance("AGA", "AGG", 1).
 
-    test(nonunique_character_in_second_strand) :-
+    test(nonunique_character_in_second_strand, condition(pending)) :-
         hamming_distance("AGG", "AGA", 1).
 
-    test(same_nucleotides_in_different_positions) :-
+    test(same_nucleotides_in_different_positions, condition(pending)) :-
         hamming_distance("TAG", "GAT", 2).
 
-    test(large_distance) :-
+    test(large_distance, condition(pending)) :-
         hamming_distance("GATACA", "GCATAA", 4).
 
-    test(large_distance_in_offbyone_strand) :-
+    test(large_distance_in_offbyone_strand, condition(pending)) :-
         hamming_distance("GGACGGATTCTG", "AGGACGGATTCT", 9).
 
-    test(empty_strands) :-
+    test(empty_strands, condition(pending)) :-
         hamming_distance("", "", 0).
 
-    test(disallow_first_strand_longer, [fail]) :-
+    test(disallow_first_strand_longer, [fail, condition(pending)]) :-
         hamming_distance("AATG", "AAA", _).
 
-    test(disallow_second_strand_longer, [fail]) :-
+    test(disallow_second_strand_longer, [fail, condition(pending)]) :-
         hamming_distance("ATA", "AGTG", _).
 
 :- end_tests(hamming).

data/tracks/prolog/exercises/hello-world/hello_world.pl

@@ -0,0 +1,9 @@
+% Please visit http://exercism.io/languages/prolog/installing
+% for instructions on setting up prolog.
+% Visit http://exercism.io/languages/prolog/tests
+% for help running the tests for prolog exercises.
+
+% Replace the goal below with
+% your implementation.
+
+hello_world(false).

data/tracks/prolog/exercises/hello-world/hello_world_tests.plt

@@ -1,11 +1,31 @@
+% Please visit http://exercism.io/languages/prolog/installing
+% for instructions on setting up prolog.
+% Visit http://exercism.io/languages/prolog/tests
+% for help running the tests for prolog exercises.
+
+% The goal below allows tests to be skipped
+% unless the "--all" flag is passed at
+% the command line.
+
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
 :- begin_tests(hello_word).
-    test(hello_world) :-
+
+    test(hello_world, condition(true)) :-
         hello_world('Hello World!').
 
-    test(hello_world_fail, blocked("Pending")) :-
+    % Once the first test passes, un-skip the following test by
+    % changing `pending` in `condition(pedning)` to `true`.
+    % Repeat for each test until they are all passing.
+
+    test(hello_world_with_a_name, condition(pending)) :-
         hello_world('Alice', 'Hello Alice!').
 
-    test(hello_world_fail, blocked("Pending")) :-
+    test(hello_world_another_name, condition(pending)) :-
         hello_world('Bob', 'Hello Bob!').
 
 :- end_tests(hello_word).

data/tracks/prolog/exercises/leap/leap.pl

@@ -1 +1 @@
-leap(Year).
+leap(0).

data/tracks/prolog/exercises/leap/leap_tests.plt

@@ -1,24 +1,30 @@
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
 :- begin_tests(leap_tests).
 
-    test(leap_year) :-
+    test(leap_year, condition(true)) :-
         leap(1996).
 
-    test(standard_and_odd_year) :-
+    test(standard_and_odd_year, condition(pending)) :-
         not(leap(1997)).
 
-    test(standard_even_year) :-
+    test(standard_even_year, condition(pending)) :-
         not(leap(1998)).
 
-    test(standard_nineteeth_century) :-
+    test(standard_nineteeth_century, condition(pending)) :-
         not(leap(1900)).
 
-    test(standard_eighteenth_century) :-
+    test(standard_eighteenth_century, condition(pending)) :-
         not(leap(1800)).
 
-    test(leap_twenty_fourth_century) :-
+    test(leap_twenty_fourth_century, condition(pending)) :-
         leap(2400).
 
-    test(leap_y2k) :-
+    test(leap_y2k, condition(pending)) :-
         leap(2000).
 
 :- end_tests(leap_tests).

data/tracks/prolog/exercises/nucleotide-count/nucleotide_count_tests.plt

@@ -1,22 +1,28 @@
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
 :- begin_tests(nucleotide_counting).
 
-    test(empty_dna_strand_has_no_adenosine) :-
+    test(empty_dna_strand_has_no_adenosine, condition(true)) :-
         nucleotide_count('', [('A', 0) | _ ]), !.
 
-    test(repetitive_cytidine_gets_counted) :-
+    test(repetitive_cytidine_gets_counted, condition(pending)) :-
         nucleotide_count('CCCCC', Counts),
         member(('C', 5), Counts), !.
 
-    test(counts_only_thymidine) :-
+    test(counts_only_thymidine, condition(pending)) :-
         nucleotide_count('GGGGGTAACCCGG', Counts),
         member(('T', 1), Counts), !.
 
-    test(counts_only_thymidine) :-
+    test(counts_only_thymidine, condition(pending)) :-
         nucleotide_count(
             'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC',
             [ ('A' ,20), ('C' , 12), ('G' , 17), ('T', 21) ]), !.
 
-    test(fails_when_not_dns, [fail]) :-
+    test(fails_when_not_dns, [fail, condition(pending)]) :-
         nucleotide_count('JOHNNYAPPLESEED', _), !.
 
 :- end_tests(nucleotide_counting).

data/tracks/prolog/exercises/rna-transcription/rna_transcription_tests.plt

@@ -1,27 +1,34 @@
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
 :- begin_tests(rna_transcription).
 
-    test(rna_complement_of_cytosine_is_guanine) :-
-        rna_transcription("C", "G").
+    test(rna_complement_of_cytosine_is_guanine, condition(true)) :-
+        rna_transcription("C", Result),
+            Result == "G".
 
-    test(rna_complement_of_guanine_is_cytosine) :-
+    test(rna_complement_of_guanine_is_cytosine, condition(pending)) :-
         rna_transcription("G", "C").
 
-    test(rna_complement_of_thymine_is_adenine) :-
+    test(rna_complement_of_thymine_is_adenine, condition(pending)) :-
         rna_transcription("T", "A").
 
-    test(rna_complement_of_adenine_is_uracil) :-
+    test(rna_complement_of_adenine_is_uracil, condition(pending)) :-
         rna_transcription("A", "U").
 
-    test(rna_complement) :-
+    test(rna_complement, condition(pending)) :-
         rna_transcription("ACGTGGTCTTAA", "UGCACCAGAAUU").
 
-    test(dna_correctly_handles_invalid_input, [fail]) :-
+    test(dna_correctly_handles_invalid_input, [fail, condition(pending)]) :-
         rna_transcription("U", _).
 
-    test(dna_correctly_handles_completely_invalid_input, [fail]) :-
+    test(dna_correctly_handles_completely_invalid_input, [fail, condition(pending)]) :-
         rna_transcription("XXX", _).
 
-    test(dna_correctly_handles_partially_invalid_input, [fail]) :-
+    test(dna_correctly_handles_partially_invalid_input, [fail, condition(pending)]) :-
         rna_transcription("ACGTXXXCTTAA", _).
 
 :- end_tests(rna_transcription).

data/tracks/prolog/exercises/space-age/space_age_tests.plt

@@ -1,37 +1,43 @@
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
 :- begin_tests(space_age).
 
     float_eq(Real, Expected) :-
         Expected is round(Real * 100).
 
-    test(earth) :-
+    test(earth, condition(true)) :-
         space_age("Earth", 1000000000, Age),
         float_eq(Age, 3169).
 
-    test(mercury) :-
+    test(mercury, condition(pending)) :-
         space_age("Mercury", 2134835688, Age),
         float_eq(Age, 28088).
 
-    test(venus) :-
+    test(venus, condition(pending)) :-
         space_age("Venus", 189839836, Age),
         float_eq(Age, 978).
 
-    test(mars) :-
+    test(mars, condition(pending)) :-
         space_age("Mars", 2329871239, Age),
         float_eq(Age, 3925).
 
-    test(jupiter) :-
+    test(jupiter, condition(pending)) :-
         space_age("Jupiter", 901876382, Age),
         float_eq(Age, 241).
 
-    test(saturn) :-
+    test(saturn, condition(pending)) :-
         space_age("Saturn", 3000000000, Age),
         float_eq(Age, 323).
     
-    test(uranus) :-
+    test(uranus, condition(pending)) :-
         space_age("Uranus", 3210123456, Age),
         float_eq(Age, 121).
 
-    test(neptune) :-
+    test(neptune, condition(pending)) :-
         space_age("Neptune", 8210123456, Age),
         float_eq(Age, 158).
 

data/tracks/prolog/exercises/sum-of-multiples/sum_of_multiples_tests.plt

@@ -1,39 +1,46 @@
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
 :- begin_tests(sum_of_multiples).
 
-    test(low_limit) :-
-        sum_of_multiples([3, 5], 1, 0).
+    test(low_limit, condition(true)) :-
+        sum_of_multiples([3, 5], 1, Result),
+        Result == 0.
 
-    test(just_one_multiple) :-
+    test(just_one_multiple, condition(pending)) :-
         sum_of_multiples([3, 5], 4, 3).
 
-    test(a_few_multiples) :-
+    test(a_few_multiples, condition(pending)) :-
         sum_of_multiples([3, 5], 10, 23).
 
-    test(sum_more_multiples) :-
+    test(sum_more_multiples, condition(pending)) :-
         sum_of_multiples([3, 5], 100, 2318).
 
-    test(even_more_multiples) :-
+    test(even_more_multiples, condition(pending)) :-
         sum_of_multiples([3, 5], 1000, 233168).
 
-    test(new_factors) :-
+    test(new_factors, condition(pending)) :-
         sum_of_multiples([7, 13, 17], 20, 51).
 
-    test(sum_more_new_factors) :-
+    test(sum_more_new_factors, condition(pending)) :-
         sum_of_multiples([4, 6], 15, 30).
 
-    test(even_more_new_factors) :-
+    test(even_more_new_factors, condition(pending)) :-
         sum_of_multiples([5, 6, 8], 150, 4419).
 
-    test(divisible_factor) :-
+    test(divisible_factor, condition(pending)) :-
         sum_of_multiples([5, 25], 51, 275).
 
-    test(large_factors) :-
+    test(large_factors, condition(pending)) :-
         sum_of_multiples([43, 47], 10000, 2203160).
 
-    test(every_num) :-
+    test(every_num, condition(pending)) :-
         sum_of_multiples([1], 100, 4950).
 
-    test(no_factors) :-
+    test(no_factors, condition(pending)) :-
         sum_of_multiples([], 10000, 0).
 
 :- end_tests(sum_of_multiples).

data/tracks/prolog/exercises/triangle/triangle_tests.plt

@@ -1,45 +1,52 @@
+pending :-
+    current_prolog_flag(argv, ['--all'|_]).
+pending :-
+    write('\nA TEST IS PENDING!\n'),
+    fail.
+
 :- begin_tests(triangle).
 
-    test(equilateral_triangle_has_all_sides_equal) :-
-        triangle(2, 2, 2, "equilateral").
+    test(equilateral_triangle_has_all_sides_equal, condition(true)) :-
+        triangle(2, 2, 2, Result),
+            Result == "equilateral".
 
-    test(larger_equilateral_triangle) :-
+    test(larger_equilateral_triangle, condition(pending)) :-
         triangle(10, 10, 10, "equilateral").
 
-    test(isosceles_triangle_with_last_two_sides_equal) :-
+    test(isosceles_triangle_with_last_two_sides_equal, condition(pending)) :-
         triangle(3, 4, 4, "isosceles").
 
-    test(isosceles_triangle_with_first_two_sides_equal) :-
+    test(isosceles_triangle_with_first_two_sides_equal, condition(pending)) :-
         triangle(4, 4, 3, "isosceles").
 
-    test(isosceles_triangle_with_first_and_last_sides_equal) :-
+    test(isosceles_triangle_with_first_and_last_sides_equal, condition(pending)) :-
         triangle(4, 3, 4, "isosceles").
 
-    test(isosceles_triangle_with_unequal_side_larger_than_equal_sides) :-
+    test(isosceles_triangle_with_unequal_side_larger_than_equal_sides, condition(pending)) :-
         triangle(4, 7, 4, "isosceles").
 
-    test(scalene_triangle_has_no_equal_sides) :-
+    test(scalene_triangle_has_no_equal_sides, condition(pending)) :-
         triangle(3, 4, 5, "scalene").
 
-    test(a2_equals_b_plus_c_isnt_always_equilateral) :-
+    test(a2_equals_b_plus_c_isnt_always_equilateral, condition(pending)) :-
         triangle(5, 4, 6, "scalene").
 
-    test(larger_scalene_triangle) :-
+    test(larger_scalene_triangle, condition(pending)) :-
         triangle(10, 11, 12, "scalene").
 
-    test(scalene_triangle_with_sides_in_descending_order) :-
+    test(scalene_triangle_with_sides_in_descending_order, condition(pending)) :-
         triangle(5, 4, 2, "scalene").
 
-    test(small_scalene_triangle_with_floating_point_values) :-
+    test(small_scalene_triangle_with_floating_point_values, condition(pending)) :-
         triangle((0.4), (0.6), (0.3), "scalene").
 
-    test(a_triangle_violating_the_triangle_inequality_is_illegal, [fail]) :-
+    test(a_triangle_violating_the_triangle_inequality_is_illegal, [fail, condition(pending)]) :-
         triangle(7, 3, 2, _).
 
-    test(two_sides_equal_but_violates_triangle_inequality, [fail]) :-
+    test(two_sides_equal_but_violates_triangle_inequality, [fail, condition(pending)]) :-
         triangle(1, 1, 3, _).
 
-    test(triangles_with_all_sides_zero_are_illegal, [fail]) :-
+    test(triangles_with_all_sides_zero_are_illegal, [fail, condition(pending)]) :-
         triangle(0, 0, 0, _).
 
 :- end_tests(triangle).

metadata

@@ -1,7 +1,7 @@
 --- !ruby/object:Gem::Specification
 name: trackler
 version: !ruby/object:Gem::Version
-  version: 2.0.0.6
+  version: 2.0.0.7
 platform: ruby
 authors:
 - Katrina Owen
@@ -5180,7 +5180,6 @@ files:
 - tracks/prolog/docs/LEARNING.md
 - tracks/prolog/docs/RESOURCES.md
 - tracks/prolog/docs/TESTS.md
-- tracks/prolog/exercises/.keep
 - tracks/prolog/exercises/anagram/anagram.example
 - tracks/prolog/exercises/anagram/anagram.pl
 - tracks/prolog/exercises/anagram/anagram_tests.plt