trackler 1.0.0 → 1.0.0.1

data/tracks/csharp/paket.dependencies

@@ -1,4 +1,5 @@
 source https://www.nuget.org/api/v2/
 nuget FAKE
 nuget NUnit
-nuget NUnit.ConsoleRunner
+nuget NUnit.ConsoleRunner
+nuget Sprache

data/tracks/csharp/paket.lock

@@ -1,5 +1,77 @@
 NUGET
   remote: https://www.nuget.org/api/v2
     FAKE (4.37.2)
+    Microsoft.NETCore.Platforms (1.0.1) - framework: netstandard10, >= netstandard12
+    Microsoft.NETCore.Targets (1.0.1) - framework: netstandard10, >= netstandard12
     NUnit (3.4.1)
     NUnit.ConsoleRunner (3.4.1)
+    Sprache (2.1)
+      System.Globalization (>= 4.0.11) - framework: >= netstandard10
+      System.Linq (>= 4.1) - framework: >= netstandard10
+      System.Runtime (>= 4.1) - framework: >= netstandard10
+      System.Text.RegularExpressions (>= 4.1) - framework: >= netstandard10
+    System.Collections (4.0.11) - framework: netstandard10, >= netstandard16
+      Microsoft.NETCore.Platforms (>= 1.0.1) - framework: dnxcore50, netstandard10, >= netstandard13
+      Microsoft.NETCore.Targets (>= 1.0.1) - framework: dnxcore50, netstandard10, >= netstandard13
+      System.Runtime (>= 4.1) - framework: dnxcore50, netstandard10, >= netstandard13
+    System.Diagnostics.Debug (4.0.11) - framework: >= netstandard16
+      Microsoft.NETCore.Platforms (>= 1.0.1) - framework: dnxcore50, netstandard10, >= netstandard13
+      Microsoft.NETCore.Targets (>= 1.0.1) - framework: dnxcore50, netstandard10, >= netstandard13
+      System.Runtime (>= 4.1) - framework: dnxcore50, netstandard10, >= netstandard13
+    System.Globalization (4.0.11) - framework: >= netstandard10
+      Microsoft.NETCore.Platforms (>= 1.0.1) - framework: dnxcore50, netstandard10, >= netstandard13
+      Microsoft.NETCore.Targets (>= 1.0.1) - framework: dnxcore50, netstandard10, >= netstandard13
+      System.Runtime (>= 4.1) - framework: dnxcore50, netstandard10, >= netstandard13
+    System.IO (4.1) - framework: >= netstandard16
+      Microsoft.NETCore.Platforms (>= 1.0.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+      Microsoft.NETCore.Targets (>= 1.0.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+      System.Runtime (>= 4.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+      System.Text.Encoding (>= 4.0.11) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+      System.Threading.Tasks (>= 4.0.11) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+    System.Linq (4.1) - framework: >= netstandard10
+      System.Collections (>= 4.0.11) - framework: dnxcore50, netstandard10, >= netstandard16
+      System.Diagnostics.Debug (>= 4.0.11) - framework: dnxcore50, >= netstandard16
+      System.Resources.ResourceManager (>= 4.0.1) - framework: dnxcore50, >= netstandard16
+      System.Runtime (>= 4.1) - framework: dnxcore50, netstandard10, >= netstandard16
+      System.Runtime.Extensions (>= 4.1) - framework: dnxcore50, >= netstandard16
+    System.Reflection (4.1) - framework: >= netstandard16
+      Microsoft.NETCore.Platforms (>= 1.0.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+      Microsoft.NETCore.Targets (>= 1.0.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+      System.IO (>= 4.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+      System.Reflection.Primitives (>= 4.0.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+      System.Runtime (>= 4.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+    System.Reflection.Primitives (4.0.1) - framework: >= netstandard16
+      Microsoft.NETCore.Platforms (>= 1.0.1) - framework: dnxcore50, >= netstandard10
+      Microsoft.NETCore.Targets (>= 1.0.1) - framework: dnxcore50, >= netstandard10
+      System.Runtime (>= 4.1) - framework: dnxcore50, >= netstandard10
+    System.Resources.ResourceManager (4.0.1) - framework: >= netstandard16
+      Microsoft.NETCore.Platforms (>= 1.0.1) - framework: dnxcore50, >= netstandard10
+      Microsoft.NETCore.Targets (>= 1.0.1) - framework: dnxcore50, >= netstandard10
+      System.Globalization (>= 4.0.11) - framework: dnxcore50, >= netstandard10
+      System.Reflection (>= 4.1) - framework: dnxcore50, >= netstandard10
+      System.Runtime (>= 4.1) - framework: dnxcore50, >= netstandard10
+    System.Runtime (4.1) - framework: >= netstandard10
+      Microsoft.NETCore.Platforms (>= 1.0.1) - framework: dnxcore50, netstandard10, netstandard12, netstandard13, >= netstandard15
+      Microsoft.NETCore.Targets (>= 1.0.1) - framework: dnxcore50, netstandard10, netstandard12, netstandard13, >= netstandard15
+    System.Runtime.Extensions (4.1) - framework: >= netstandard16
+      Microsoft.NETCore.Platforms (>= 1.0.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+      Microsoft.NETCore.Targets (>= 1.0.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+      System.Runtime (>= 4.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard15
+    System.Text.Encoding (4.0.11) - framework: >= netstandard16
+      Microsoft.NETCore.Platforms (>= 1.0.1) - framework: dnxcore50, netstandard10, >= netstandard13
+      Microsoft.NETCore.Targets (>= 1.0.1) - framework: dnxcore50, netstandard10, >= netstandard13
+      System.Runtime (>= 4.1) - framework: dnxcore50, netstandard10, >= netstandard13
+    System.Text.RegularExpressions (4.1) - framework: >= netstandard10
+      System.Collections (>= 4.0.11) - framework: dnxcore50, >= netstandard16
+      System.Globalization (>= 4.0.11) - framework: dnxcore50, >= netstandard16
+      System.Resources.ResourceManager (>= 4.0.1) - framework: dnxcore50, >= netstandard16
+      System.Runtime (>= 4.1) - framework: dnxcore50, netstandard10, netstandard13, >= netstandard16
+      System.Runtime.Extensions (>= 4.1) - framework: dnxcore50, >= netstandard16
+      System.Threading (>= 4.0.11) - framework: dnxcore50, >= netstandard16
+    System.Threading (4.0.11) - framework: >= netstandard16
+      System.Runtime (>= 4.1) - framework: dnxcore50, netstandard10, >= netstandard13
+      System.Threading.Tasks (>= 4.0.11) - framework: dnxcore50, netstandard10, >= netstandard13
+    System.Threading.Tasks (4.0.11) - framework: >= netstandard16
+      Microsoft.NETCore.Platforms (>= 1.0.1) - framework: dnxcore50, netstandard10, >= netstandard13
+      Microsoft.NETCore.Targets (>= 1.0.1) - framework: dnxcore50, netstandard10, >= netstandard13
+      System.Runtime (>= 4.1) - framework: dnxcore50, netstandard10, >= netstandard13

data/tracks/ecmascript/exercises/simple-cipher/simple-cipher.spec.js

@@ -4,7 +4,7 @@ describe('Random key cipher',  () => {
   const cipher = new Cipher();
 
   it('has a key made of letters', () => {
-    expect(cipher.key).toMatch(/[a-z]+/);
+    expect(cipher.key).toMatch(/^[a-z]+$/);
   });
 
   // Here we take advantage of the fact that plaintext of "aaa..."

data/tracks/elisp/config.json

@@ -16,7 +16,12 @@
       "robot-name",
       "rna-transcription",
       "atbash-cipher",
-      "raindrops"
+      "raindrops",
+      "roman-numerals",
+      "perfect-numbers",
+      "etl",
+      "word-count",
+      "nucleotide-count"
    ],
   "deprecated": [
 

data/tracks/elisp/exercises/etl/etl-test.el

@@ -0,0 +1,90 @@
+;;; etl-test.el --- Tests for etl (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+(load-file "etl.el")
+
+
+(defconst mixed-case-input #s(hash-table
+                              data (1 ("a" "E" "I" "o" "U" "L" "N" "r" "s" "T")
+                                      2 ("D" "G")
+                                      3 ("B" "c" "M" "P")
+                                      4 ("f" "h" "V" "W" "y")
+                                      5 ("K")
+                                      8 ("J" "x")
+                                      10 ("q" "z"))))
+
+
+(defconst mixed-case-expected #s(hash-table
+                                 data ("a" 1 
+                                        "b" 3
+                                        "c" 3
+                                        "d" 2
+                                        "e" 1
+                                        "f" 4
+                                        "g" 2
+                                        "h" 4
+                                        "i" 1 
+                                        "j" 8
+                                        "k" 5
+                                        "l" 1
+                                        "m" 3
+                                        "n" 1
+                                        "o" 1
+                                        "p" 3
+                                        "q" 10
+                                        "r" 1
+                                        "s" 1
+                                        "t" 1 
+                                        "u" 1
+                                        "v" 4
+                                        "x" 8
+                                        "w" 4
+                                        "y" 4
+                                        "z" 10)))
+  
+
+(defconst negative-keys-input #s(hash-table
+                                 data (1 ("L" "N")
+                                         -3 ("B" "c" "P"))))
+
+
+(defconst listof-chars-input #s(hash-table
+                                data (1 (?N ?r ?q))))
+
+
+(defun hash->list (hash)
+  (let (lst)
+    (maphash (lambda (k v) (push (cons k v) lst)) hash)
+    lst))
+
+
+(defun sort-pairs (lst fn)
+  (sort lst (lambda (a b) (funcall fn (car a) (car b)))))
+
+
+(defun hash-equal (a b fn)
+  (equal (sort-pairs (hash->list a) fn)
+         (sort-pairs (hash->list b) fn)))
+
+
+(ert-deftest empty-hash-test ()
+  (should (zerop (hash-table-count (etl (make-hash-table))))))
+
+
+(ert-deftest mixed-case-test ()
+  (should (hash-equal (etl mixed-case-input) mixed-case-expected 'string<)))
+
+
+(ert-deftest negative-key-test ()
+  (should-error (etl negative-keys-input)))
+
+
+(ert-deftest list-of-non-string-values-test ()
+  (should-error (etl listof-chars-input)))
+
+
+(provide 'etl)
+;;; etl-test.el ends here

data/tracks/elisp/exercises/etl/etl.el

@@ -0,0 +1,9 @@
+;;; etl.el --- etl Exercise (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+
+(provide 'etl)
+;;; etl.el ends here

data/tracks/elisp/exercises/etl/example.el

@@ -0,0 +1,22 @@
+;;; etl.el --- etl Exercise (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+
+(defun etl (data)
+  (let ((rtn (make-hash-table)))
+    (maphash (lambda (k v)
+               (when (< k 0)
+                 (error "Unexpected key value %s" k))
+               (dolist (i v)
+                 (when (not (stringp i))
+                   (error "Non string value found %s" i))
+                 (puthash (downcase i) k rtn)))
+             data)
+    rtn))
+
+
+(provide 'etl)
+;;; etl.el ends here

data/tracks/elisp/exercises/nucleotide-count/example.el

@@ -0,0 +1,19 @@
+;;; nucleotide-count.el --- nucleotide-count Exercise (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+
+(defun nucleotide-count (sequence)
+  (let ((counts (copy-alist '((?A . 0) (?C . 0) (?G . 0) (?T . 0)))))
+    (dolist (i (append sequence nil))
+      (let ((n (assoc i counts)))
+        (if n
+            (setcdr n (1+ (cdr n)))
+          (error "Invalid nucleotide '%c'" i))))
+    counts))
+
+
+(provide 'nucleotide-count)
+;;; nucleotide-count.el ends here

data/tracks/elisp/exercises/nucleotide-count/nucleotide-count-test.el

@@ -0,0 +1,34 @@
+;;; nucleotide-count-test.el --- Tests for nucleotide-count (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+(load-file "nucleotide-count.el")
+
+
+(defun sort-pairs (lst fn)
+  (sort lst (lambda (a b) (funcall fn (car a) (car b)))))
+
+
+(ert-deftest empty-dna-strand-has-no-nucleotides-test ()
+  (should (equal (sort-pairs (nucleotide-count "") #'<)
+                 '((?A . 0) (?C . 0) (?G . 0) (?T . 0)))))
+
+
+(ert-deftest repetitive-sequence-has-only-guanine-test ()
+  (should (equal (sort-pairs (nucleotide-count "GGGGGGGG") #'<)
+                 '((?A . 0) (?C . 0) (?G . 8) (?T . 0)))))
+
+
+(ert-deftest count-all-nucleotides-test ()
+  (should (equal (sort-pairs (nucleotide-count "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC") #'<)
+                 '((?A . 20) (?C . 12) (?G . 17) (?T . 21)))))
+
+
+(ert-deftest invalid-nucleotide-test ()
+  (should-error (nucleotide-count "AGGTCCXGA")))
+
+
+(provide 'nucleotide-count)
+;;; nucleotide-count-test.el ends here

data/tracks/elisp/exercises/nucleotide-count/nucleotide-count.el

@@ -0,0 +1,9 @@
+;;; nucleotide-count.el --- nucleotide-count Exercise (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+
+(provide 'nucleotide-count)
+;;; nucleotide-count.el ends here

data/tracks/elisp/exercises/perfect-numbers/example.el

@@ -0,0 +1,28 @@
+;;; perfect-numbers.el --- perfect-numbers Exercise (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+(require 'cl)
+
+
+(defun divisors (n)
+  (cl-loop for i from 1 to (truncate (sqrt n))
+           if (= (% n i) 0) collect i
+           and if (not (= i (/ n i))) collect (/ n i)))
+
+
+(defun sum-divisors (n)
+  ;; Remove n from the list and add'em up.
+  (apply '+ (cdr (sort (divisors n) '>))))
+
+
+(defun perfect-numbers (n)
+  (cl-loop for i from 2 to n by 2
+           when (= i (sum-divisors i))
+           collect i))
+
+
+(provide 'perfect-numbers)
+;;; perfect-numbers.el ends here

data/tracks/elisp/exercises/perfect-numbers/perfect-numbers-test.el

@@ -0,0 +1,24 @@
+;;; perfect-numbers-test.el --- Tests for perfect-numbers (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+(load-file "perfect-numbers.el")
+
+
+(ert-deftest no-perfect-numbers-in-1-to-5 ()
+    (should (equal (perfect-numbers 5) '())))
+
+(ert-deftest return-one-perfect-number-for-range-1-to-6 ()
+    (should (equal (perfect-numbers 6) '(6))))
+
+(ert-deftest return-3-perfect-numbers-for-range-1-to-1000 ()
+    (should (equal (perfect-numbers 1000) '(6 28 496))))
+
+(ert-deftest return-4-perfect-numbers-for-range-1-to-10000 ()
+    (should (equal (perfect-numbers 10000) '(6 28 496 8128))))
+
+
+(provide 'perfect-numbers)
+;;; perfect-numbers-test.el ends here

data/tracks/elisp/exercises/perfect-numbers/perfect-numbers.el

@@ -0,0 +1,10 @@
+;;; perfect-numbers.el --- perfect-numbers Exercise (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+
+
+(provide 'perfect-numbers)
+;;; perfect-numbers.el ends here

data/tracks/elisp/exercises/roman-numerals/example.el

@@ -0,0 +1,36 @@
+;;; roman-numerals.el --- roman-numerals Exercise (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+
+(defun to-roman (value)
+  (let ((decode '(("M"  . 1000)
+                  ("CM" . 900)
+                  ("D"  . 500)
+                  ("CD" . 400)
+                  ("C"  . 100)
+                  ("XC" .  90)
+                  ("L"  .  50)
+                  ("XL" .  40)
+                  ("X"  .  10)
+                  ("IX" .   9)
+                  ("V"  .   5)
+                  ("IV" .   4)
+                  ("I"  .   1)))
+        (roman nil))
+    (if (> value 3000)
+        (error "Value out of range"))
+    (while (not (eq value 0))
+      (let ((r (caar decode))
+            (d (cdar decode)))
+        (when (>= value d)
+          (setq roman (append roman (make-list (/ value d) r)))
+          (setq value (% value d)))
+        (setq decode (cdr decode))))
+    (apply 'concat roman)))
+
+
+(provide 'roman-numerals)
+;;; roman-numerals.el ends here

data/tracks/elisp/exercises/roman-numerals/roman-numerals-test.el

@@ -0,0 +1,30 @@
+;;; roman-numerals-test.el --- Tests for roman-numerals (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+(load-file "roman-numerals.el")
+
+(ert-deftest roman-numerals-test ()
+  (should (equal (to-roman 1) "I"))
+  (should (equal (to-roman 2) "II"))
+  (should (equal (to-roman 3) "III"))
+  (should (equal (to-roman 4) "IV"))
+  (should (equal (to-roman 5) "V"))
+  (should (equal (to-roman 6) "VI"))
+  (should (equal (to-roman 9) "IX"))
+  (should (equal (to-roman 27) "XXVII"))
+  (should (equal (to-roman 48) "XLVIII"))
+  (should (equal (to-roman 59) "LIX"))
+  (should (equal (to-roman 93) "XCIII"))
+  (should (equal (to-roman 141) "CXLI"))
+  (should (equal (to-roman 163) "CLXIII"))
+  (should (equal (to-roman 402) "CDII"))
+  (should (equal (to-roman 575) "DLXXV"))
+  (should (equal (to-roman 911) "CMXI"))
+  (should (equal (to-roman 1024) "MXXIV"))
+  (should (equal (to-roman 3000) "MMM")))
+
+(provide 'roman-numerals)
+;;; roman-numerals-test.el ends here

data/tracks/elisp/exercises/roman-numerals/roman-numerals.el

@@ -0,0 +1,10 @@
+;;; roman-numerals.el --- roman-numerals Exercise (exercism)
+
+;;; Commentary:
+
+;;; Code:
+
+
+
+(provide 'roman-numerals)
+;;; roman-numerals.el ends here