sequenceserver 0.8.5 → 0.8.6

data/lib/sequenceserver.rb

@@ -506,7 +506,7 @@ HEADER
         return line
       else
         settings.log.debug('Added link for: `'+ sequence_id +'\''+ link)
-        return "><a href='#{url(link)}'>#{sequence_id}</a> \n"
+        return "><a href='#{url(link)}' target='_blank'>#{sequence_id}</a> \n"
       end
 
     end

data/public/js/jquery.activity.js

@@ -7,4 +7,4 @@
  * Author: Felix Gnass [fgnass at neteye dot de]
  * Version: 1.0.0
  */
-(function($){$.fn.activity=function(opts){this.each(function(){var $this=$(this);var el=$this.data("activity");if(el){clearInterval(el.data("interval"));el.remove();$this.removeData("activity");}if(opts!==false){opts=$.extend({color:$this.css("color")},$.fn.activity.defaults,opts);el=render($this,opts).css("position","absolute").prependTo(opts.outside?"body":$this);var h=$this.outerHeight()-el.height();var w=$this.outerWidth()-el.width();var margin={top:opts.valign=="top"?opts.padding:opts.valign=="bottom"?h-opts.padding:Math.floor(h/2),left:opts.align=="left"?opts.padding:opts.align=="right"?w-opts.padding:Math.floor(w/2)};var offset=$this.offset();if(opts.outside){el.css({top:offset.top+"px",left:offset.left+"px"});}else{margin.top-=el.offset().top-offset.top;margin.left-=el.offset().left-offset.left;}el.css({marginTop:margin.top+"px",marginLeft:margin.left+"px"});animate(el,opts.segments,Math.round(10/opts.speed)/10);$this.data("activity",el);}});return this;};$.fn.activity.defaults={segments:12,space:3,length:7,width:4,speed:1.2,align:"center",valign:"center",padding:4};$.fn.activity.getOpacity=function(opts,i){var steps=opts.steps||opts.segments-1;var end=opts.opacity!==undefined?opts.opacity:1/steps;return 1-Math.min(i,steps)*(1-end)/steps;};var render=function(){return $("<div>").addClass("busy");};var animate=function(){};function svg(tag,attr){var el=document.createElementNS("http://www.w3.org/2000/svg",tag||"svg");if(attr){$.each(attr,function(k,v){el.setAttributeNS(null,k,v);});}return $(el);}if(document.createElementNS&&document.createElementNS("http://www.w3.org/2000/svg","svg").createSVGRect){render=function(target,d){var innerRadius=d.width*2+d.space;var r=(innerRadius+d.length+Math.ceil(d.width/2)+1);var el=svg().width(r*2).height(r*2);var g=svg("g",{"stroke-width":d.width,"stroke-linecap":"round",stroke:d.color}).appendTo(svg("g",{transform:"translate("+r+","+r+")"}).appendTo(el));for(var i=0;i<d.segments;i++){g.append(svg("line",{x1:0,y1:innerRadius,x2:0,y2:innerRadius+d.length,transform:"rotate("+(360/d.segments*i)+", 0, 0)",opacity:$.fn.activity.getOpacity(d,i)}));}return $("<div>").append(el).width(2*r).height(2*r);};if(document.createElement("div").style.WebkitAnimationName!==undefined){var animations={};animate=function(el,steps,duration){if(!animations[steps]){var name="spin"+steps;var rule="@-webkit-keyframes "+name+" {";for(var i=0;i<steps;i++){var p1=Math.round(100000/steps*i)/1000;var p2=Math.round(100000/steps*(i+1)-1)/1000;var value="% { -webkit-transform:rotate("+Math.round(360/steps*i)+"deg); }\n";rule+=p1+value+p2+value;}rule+="100% { -webkit-transform:rotate(100deg); }\n}";document.styleSheets[0].insertRule(rule);animations[steps]=name;}el.css("-webkit-animation",animations[steps]+" "+duration+"s linear infinite");};}else{animate=function(el,steps,duration){var rotation=0;var g=el.find("g g").get(0);el.data("interval",setInterval(function(){g.setAttributeNS(null,"transform","rotate("+(++rotation%steps*(360/steps))+")");},duration*1000/steps));};}}else{var s=$("<shape>").css("behavior","url(#default#VML)").appendTo("body");if(s.get(0).adj){var sheet=document.createStyleSheet();$.each(["group","shape","stroke"],function(){sheet.addRule(this,"behavior:url(#default#VML);");});render=function(target,d){var innerRadius=d.width*2+d.space;var r=(innerRadius+d.length+Math.ceil(d.width/2)+1);var s=r*2;var o=-Math.ceil(s/2);var el=$("<group>",{coordsize:s+" "+s,coordorigin:o+" "+o}).css({top:o,left:o,width:s,height:s});for(var i=0;i<d.segments;i++){el.append($("<shape>",{path:"m "+innerRadius+",0  l "+(innerRadius+d.length)+",0"}).css({width:s,height:s,rotation:(360/d.segments*i)+"deg"}).append($("<stroke>",{color:d.color,weight:d.width+"px",endcap:"round",opacity:$.fn.activity.getOpacity(d,i)})));}return $("<group>",{coordsize:s+" "+s}).css({width:s,height:s,overflow:"hidden"}).append(el);};animate=function(el,steps,duration){var rotation=0;var g=el.get(0);el.data("interval",setInterval(function(){g.style.rotation=++rotation%steps*(360/steps);},duration*1000/steps));};}$(s).remove();}})(jQuery);
+(function($){$.fn.activity=function(opts){this.each(function(){var $this=$(this);var el=$this.data("activity");if(el){clearInterval(el.data("interval"));el.remove();$this.removeData("activity");}if(opts!==false){opts=$.extend({color:$this.css("color")},$.fn.activity.defaults,opts);el=render($this,opts).css("position","absolute").prependTo(opts.outside?"body":$this);var h=$this.outerHeight()-el.height();var w=$this.outerWidth()-el.width();var margin={top:opts.valign=="top"?opts.padding:opts.valign=="bottom"?h-opts.padding:Math.floor(h/2),left:opts.align=="left"?opts.padding:opts.align=="right"?w-opts.padding:Math.floor(w/2)};var offset=$this.offset();if(opts.outside){el.css({top:offset.top+"px",left:offset.left+"px"});}else{margin.top-=el.offset().top-offset.top;margin.left-=el.offset().left-offset.left;}el.css({marginTop:margin.top+"px",marginLeft:margin.left+"px"});animate(el,opts.segments,Math.round(10/opts.speed)/10);$this.data("activity",el);}});return this;};$.fn.activity.defaults={segments:12,space:3,length:7,width:4,speed:1.2,align:"center",valign:"center",padding:4};$.fn.activity.getOpacity=function(opts,i){var steps=opts.steps||opts.segments-1;var end=opts.opacity!==undefined?opts.opacity:1/steps;return 1-Math.min(i,steps)*(1-end)/steps;};var render=function(){return $("<div>").addClass("busy");};var animate=function(){};function svg(tag,attr){var el=document.createElementNS("http://www.w3.org/2000/svg",tag||"svg");if(attr){$.each(attr,function(k,v){el.setAttributeNS(null,k,v);});}return $(el);}if(document.createElementNS&&document.createElementNS("http://www.w3.org/2000/svg","svg").createSVGRect){render=function(target,d){var innerRadius=d.width*2+d.space;var r=(innerRadius+d.length+Math.ceil(d.width/2)+1);var el=svg().width(r*2).height(r*2);var g=svg("g",{"stroke-width":d.width,"stroke-linecap":"round",stroke:d.color}).appendTo(svg("g",{transform:"translate("+r+","+r+")"}).appendTo(el));for(var i=0;i<d.segments;i++){g.append(svg("line",{x1:0,y1:innerRadius,x2:0,y2:innerRadius+d.length,transform:"rotate("+(360/d.segments*i)+", 0, 0)",opacity:$.fn.activity.getOpacity(d,i)}));}return $("<div>").append(el).width(2*r).height(2*r);};if(document.createElement("div").style.WebkitAnimationName!==undefined){var animations={};animate=function(el,steps,duration){if(!animations[steps]){var name="spin"+steps;var rule="@-webkit-keyframes "+name+" {";for(var i=0;i<steps;i++){var p1=Math.round(100000/steps*i)/1000;var p2=Math.round(100000/steps*(i+1)-1)/1000;var value="% { -webkit-transform:rotate("+Math.round(360/steps*i)+"deg); }\n";rule+=p1+value+p2+value;}rule+="100% { -webkit-transform:rotate(100deg); }\n}";document.styleSheets[0].insertRule(rule,0);animations[steps]=name;}el.css("-webkit-animation",animations[steps]+" "+duration+"s linear infinite");};}else{animate=function(el,steps,duration){var rotation=0;var g=el.find("g g").get(0);el.data("interval",setInterval(function(){g.setAttributeNS(null,"transform","rotate("+(++rotation%steps*(360/steps))+")");},duration*1000/steps));};}}else{var s=$("<shape>").css("behavior","url(#default#VML)").appendTo("body");if(s.get(0).adj){var sheet=document.createStyleSheet();$.each(["group","shape","stroke"],function(){sheet.addRule(this,"behavior:url(#default#VML);");});render=function(target,d){var innerRadius=d.width*2+d.space;var r=(innerRadius+d.length+Math.ceil(d.width/2)+1);var s=r*2;var o=-Math.ceil(s/2);var el=$("<group>",{coordsize:s+" "+s,coordorigin:o+" "+o}).css({top:o,left:o,width:s,height:s});for(var i=0;i<d.segments;i++){el.append($("<shape>",{path:"m "+innerRadius+",0  l "+(innerRadius+d.length)+",0"}).css({width:s,height:s,rotation:(360/d.segments*i)+"deg"}).append($("<stroke>",{color:d.color,weight:d.width+"px",endcap:"round",opacity:$.fn.activity.getOpacity(d,i)})));}return $("<group>",{coordsize:s+" "+s}).css({width:s,height:s,overflow:"hidden"}).append(el);};animate=function(el,steps,duration){var rotation=0;var g=el.get(0);el.data("interval",setInterval(function(){g.style.rotation=++rotation%steps*(360/steps);},duration*1000/steps));};}$(s).remove();}})(jQuery);

data/sequenceserver.gemspec

@@ -1,7 +1,7 @@
 Gem::Specification.new do |s|
   # meta
   s.name        = 'sequenceserver'
-  s.version     = '0.8.5'
+  s.version     = '0.8.6'
   s.authors     = ['Anurag Priyam', 'Ben J Woodcroft', 'Yannick Wurm']
   s.email       = 'anurag08priyam@gmail.com'
   s.homepage    = 'http://sequenceserver.com'

metadata

@@ -1,7 +1,7 @@
 --- !ruby/object:Gem::Specification
 name: sequenceserver
 version: !ruby/object:Gem::Version
-  version: 0.8.5
+  version: 0.8.6
   prerelease: 
 platform: ruby
 authors:
@@ -11,7 +11,7 @@ authors:
 autorequire: 
 bindir: bin
 cert_chain: []
-date: 2013-04-27 00:00:00.000000000 Z
+date: 2013-11-28 00:00:00.000000000 Z
 dependencies:
 - !ruby/object:Gem::Dependency
   name: bundler
@@ -152,75 +152,49 @@ extensions: []
 extra_rdoc_files: []
 files:
 - lib/sequenceserver/sequencehelpers.rb
-- lib/sequenceserver/helpers.rb
+- lib/sequenceserver/customisation.rb
 - lib/sequenceserver/blast.rb
-- lib/sequenceserver/sinatralikeloggerformatter.rb
-- lib/sequenceserver/database_formatter.rb~
 - lib/sequenceserver/database.rb
 - lib/sequenceserver/version.rb
+- lib/sequenceserver/helpers.rb
+- lib/sequenceserver/sinatralikeloggerformatter.rb
 - lib/sequenceserver/database_formatter.rb
-- lib/sequenceserver/customisation.rb
-- lib/blast.rb~
 - lib/sequenceserver.rb
-- views/500.erb
 - views/_options.erb
+- views/500.erb
 - views/search.erb
-- views/search.erb~
-- public/js/bootstrap.modal.js
-- public/js/bootstrap.dropdown.js
-- public/js/bootstrap.transition.js
+- public/js/jquery.activity.js
+- public/js/sequenceserver.js
+- public/js/jquery.js
 - public/js/jquery-scrollspy.js
-- public/js/jquery-ui.js
 - public/js/sequenceserver.blast.js
+- public/js/bootstrap.dropdown.js
 - public/js/store.min.js
-- public/js/sequenceserver.js~
+- public/js/bootstrap.modal.js
+- public/js/bootstrap.transition.js
+- public/js/jquery-ui.js
 - public/js/jquery.enablePlaceholder.min.js
-- public/js/jquery.activity.js
-- public/js/sequenceserver.js
-- public/js/jquery.js
-- public/img/glyphicons-halflings.png
-- public/img/glyphicons-halflings-white.png
-- public/css/bootstrap.dropdown.css
+- public/css/bootstrap.min.css
+- public/css/bootstrap.modal.css
 - public/css/bootstrap.icons.css
-- public/css/custom.css
-- public/css/beige.css~
+- public/css/bootstrap.dropdown.css
 - public/css/beige.css.css
-- public/css/bootstrap.modal.css
-- public/css/bootstrap.min.css
-- tests/database/nucleotide/Sinvicta2-2-3.cdna.subset.fasta
-- tests/database/nucleotide/headVno_parse.archive.csv
-- tests/database/nucleotide/head.faVparse.html
-- tests/database/nucleotide/parse.info
-- tests/database/nucleotide/headVparse.archive.csv
-- tests/database/nucleotide/headVparse.archive
-- tests/database/nucleotide/parse.fa.nsi
-- tests/database/nucleotide/headVno_parse.archive
-- tests/database/nucleotide/parse.fa.nsd
-- tests/database/nucleotide/parse.fa.nsq
-- tests/database/nucleotide/parse.fa.nhr
-- tests/database/nucleotide/head.faVno_parse.html
-- tests/database/nucleotide/parse.fa.nog
-- tests/database/nucleotide/no_parse.fa
-- tests/database/nucleotide/parse.fa
-- tests/database/nucleotide/no_parse.fa.nsq
-- tests/database/nucleotide/parse.fa.nin
-- tests/database/nucleotide/Sinvicta2-2-3.cdna.subset.fasta.nsq
-- tests/database/nucleotide/Sinvicta2-2-3.cdna.subset.fasta.nhr
-- tests/database/nucleotide/Sinvicta2-2-3.cdna.subset.fasta.nin
-- tests/database/nucleotide/no_parse.fa.nin
-- tests/database/nucleotide/head.fa
-- tests/database/nucleotide/no_parse.info
-- tests/database/nucleotide/no_parse.fa.nhr
-- tests/database/protein/Sinvicta2-2-3.prot.subset.fasta.pin
-- tests/database/protein/Sinvicta2-2-3.prot.subset.fasta
-- tests/database/protein/Sinvicta2-2-3.prot.subset.fasta.psq
-- tests/database/protein/Sinvicta2-2-3.prot.subset.fasta.phr
-- tests/run
+- public/css/custom.css
+- public/img/glyphicons-halflings-white.png
+- public/img/glyphicons-halflings.png
+- tests/ui.specs.todo
 - tests/test_sequenceserver_blast.rb
 - tests/test_ui.rb
-- tests/ui.specs.todo
-- tests/chromedriver.log
 - tests/test_sequencehelpers.rb
+- tests/database/protein/Sinvicta2-2-3.prot.subset.fasta.psq
+- tests/database/protein/Sinvicta2-2-3.prot.subset.fasta.pin
+- tests/database/protein/Sinvicta2-2-3.prot.subset.fasta.phr
+- tests/database/protein/Sinvicta2-2-3.prot.subset.fasta
+- tests/database/nucleotide/Sinvicta2-2-3.cdna.subset.fasta.nhr
+- tests/database/nucleotide/Sinvicta2-2-3.cdna.subset.fasta.nin
+- tests/database/nucleotide/Sinvicta2-2-3.cdna.subset.fasta.nsq
+- tests/database/nucleotide/Sinvicta2-2-3.cdna.subset.fasta
+- tests/run
 - config.ru
 - example.config.yml
 - LICENSE.txt
@@ -228,8 +202,7 @@ files:
 - README.txt
 - Gemfile
 - sequenceserver.gemspec
-- !binary |-
-  YmluL3NlcXVlbmNlc2VydmVy
+- bin/sequenceserver
 homepage: http://sequenceserver.com
 licenses:
 - SequenceServer (custom)
@@ -254,9 +227,8 @@ required_rubygems_version: !ruby/object:Gem::Requirement
       version: '0'
 requirements: []
 rubyforge_project: 
-rubygems_version: 1.8.24
+rubygems_version: 1.8.23
 signing_key: 
 specification_version: 3
 summary: BLAST search made easy!
 test_files: []
-has_rdoc: 

data/lib/blast.rb~

@@ -1,200 +0,0 @@
-require 'tempfile'
-require 'open3'
-
-module SequenceServer
-  # Simple ncbi-blast wrapper. Check examples below.
-  class Blast
-    # blast method
-    attr_accessor :method
-
-    # database name
-    attr_accessor :db
-
-    # query sequence string
-    attr_accessor :qstring
-
-    # query file name
-    attr_accessor :qfile
-
-    # advanced blast options
-    attr_accessor :options
-
-    # command string to be executed
-    attr_reader   :command
-
-    # result of executing command
-    attr_reader   :result
-
-    # blast archive file output
-    attr_reader   :blast_archive_tempfile
-
-    # errors if any while executing command
-    attr_reader   :error
-
-    # Initialize a new blast search.
-    # ---
-    # Arguments(optional):
-    # * method(String)  - blast executable (shell executable, or absolute path)
-    # * db(String)      - database name as returned by 'blastdbcmd -list'
-    # * query(Hash)     - query string/file, and options.
-    #
-    # In the query Hash, use:
-    # * :qfile(String)   - to run Blast against a file.
-    # * :qstrin(String)  - to run Blast against a string.
-    # * :options(String) - to specify multiple blast options.
-    #
-    # Either :qfile, or :qstring should be used. If both are given, by design
-    # :qstring will be used to run blast.
-    # ---
-    # Examples:
-    #
-    #   b = Blast.new("blastn", "S.cdna.fasta", :qfile => 'query.seq', :options => "-html -num_threads 4")
-    #   b = Blast.new("blastn", "S.cdna.fasta", :qstring => 'ATGTCCGCGAATCGATTGAACGTGCTGGTGACCCTGATGCTCGCCGTCGCGCTTCTTGTG')
-    #
-    #   b.run!        => true
-    #   b.result      => "blast output"
-    #
-    #   # change the blast method.
-    #   b.method = 'blastp'
-    #
-    #   b.run!        => false
-    #   b.error       => "blast error output"
-    def initialize(method = nil, db = nil, query = {})
-      @method  = method
-      @db      = db
-      @qstring = query[:qstring]
-      @qfile   = query[:qfile]
-      @options = query[:options]
-    end
-
-    # Run blast everytime it is called. Returns the success
-    # status - true, or false. Blast method, db, and qfile/qstring
-    # need to be set before calling this method, else blast will fail.
-    #
-    #   b = Blast.new
-    #   b.run!   => false
-    #
-    #   # set blast method, and db
-    #   b.method = 'blastn'
-    #   b.db     = 'S.cdna.fasta'
-    #
-    #   b.run!   => false
-    #   b.errors => "blast error output"
-    #
-    #   # set qfile
-    #   b.qfile  = 'query1.seq'    
-    #
-    #   b.run!   => true
-    #   b.reuslt => "blast output"
-    def run!
-      # can not run blast if method is not specified
-      return false unless @method
-
-      # create a tempfile if qstring is given
-      if @qstring
-      @tempfile = Tempfile.new('qfile')
-      @tempfile.puts(qstring)
-      @tempfile.close
-      @qfile    = @tempfile.path
-      end
-
-      # form command to execute
-      @command = to_s
-
-      # execute command and capture both stdout, and stderr
-      Open3.popen3(@command) do |stdin, stdout, stderr|
-      @result = stdout.readlines # convert to string?
-      @error  = stderr.readlines
-      end
-
-      # set and return success status
-      return @success = @error.empty?
-
-    ensure
-      # delete tempfile if it was created
-      @tempfile.unlink if @tempfile
-    end
-
-    # Return the blast type used as a String.
-    #
-    #   b.method = '/home/yeban/opt/blastn'
-    #   b.type   => 'blastn'
-    def type
-      @type ||= @method[(@method.rindex('/') + 1)..-1]
-    end
-
-    # Return success status - true, false, or nil.
-    # 'nil' implies that blast has not been run yet.
-    def success?
-      @success
-    end
-
-    # String representation of the blast object - same as
-    # the command to be executed.
-    def to_s
-      s = "#@method "
-      s << "-db '#@db' " if @db
-      s << "-query #@qfile " if @qfile
-      s << @options.to_s if @options
-      s
-    end
-
-    # Especially helpful in irb - "status : command"
-    def inspect
-      return to_s if success?.nil?
-      (success? ? "success : " : "fail : ") + @command
-    end
-
-    # Run the blast with the options specified by the user, returning a blast archive file, which can be further transformed into other formats
-    def run_to_blast_archive!
-      @blast_archive_tempfile = Tempfile.open('seqserve_formatter')
-
-      # Add -outfmt 11 to list of options so that it outputs a blast archive
-      @options ||= ''
-      @options += " -outfmt 11 -out #{@blast_archive_tempfile.path}"
-
-      # Run the blast
-      run!
-      return @success unless @success
-    end
-
-    # convert the blast archive to a regular HTML result, stored
-    # as an instance variable Blast#result
-    def convert_blast_archive_to_html_result(blast_formatter_path)
-      @command = "#{blast_formatter_path} -archive #{blast_archive_tempfile.path} -html"
-
-      # execute command and capture both stdout, and stderr
-      Open3.popen3(@command) do |stdin, stdout, stderr|
-      @result = stdout.readlines # convert to string?
-      @error  = stderr.readlines
-      end
-    end
-
-    class << self
-      # shortcut method to run blast against a query file
-      def blast_file(method, db, qfile, options = nil)
-        b = Blast.new(method, db, :qfile => qfile, :options => options)
-        b.run!
-        b
-      end
-
-      # shortcut method to run blast against a query string
-      def blast_string(method, db, qstring, options = nil)
-        b = Blast.new(method, db, :qstring => qstring, :options => options)
-        b.run!
-        b
-      end
-
-      # shortcut method to run blast with a query string and return a
-      # blast archive, which can then be further processed into other useful
-      # output forms (e.g. HTML, GFF). If it ran successfully, the blast archive
-      # is a Tempfile accessible as an instance variable of the returned
-      # Blast object.
-      def blast_string_to_blast_archive(method, db, qstring, options = nil)
-        b = Blast.new(method, db, :qstring => qstring, :options => options)
-        b.run_to_blast_archive!
-        b
-      end
-    end
-  end
-end

data/lib/sequenceserver/database_formatter.rb~

@@ -1,190 +0,0 @@
-# copyright yannick . wurm at unil . ch
-# Finds files, reads first char. if its '>', read 500 lines. Guess sequence type, ask user for title to format as blast database.
-
-# TODO: bring it under SequenceServer namespace
-# TODO: move the file to a 'command/' sub-directory (probably makes more sense if we have several subcommands)
-# TODO: needs more love (read refactoring) overall
-
-require 'ptools' # for File.binary?(file)
-require 'find'
-require 'logger'
-require 'optparse'
-require 'sequenceserver'
-require 'sequenceserver/helpers.rb'
-require 'sequenceserver/sequencehelpers.rb'
-
-LOG = Logger.new(STDOUT)
-LOG.level = Logger::INFO
-
-class DatabaseFormatter
-    include SequenceServer
-	include Helpers
-    include SystemHelpers
-    include SequenceHelpers
-    
-    attr_accessor :db_path
-
-    def initialize(db_path = nil)
-      @app = SequenceServer::App
-      @app.config = @app.parse_config
-      @app.binaries = @app.scan_blast_executables(@app.bin).freeze
-
-      @db_path = (db_path or @app.database)
-    end
-
-    def format_databases
-      unless File.directory?(db_path)
-        LOG.fatal("Database directory #{db_path} not found. See './database_formatter --help' for instructions.")
-        exit
-      end
-
-        formatted_dbs = %x|#{@app.binaries['blastdbcmd']} -recursive -list #{db_path} -list_outfmt "%f" 2>&1|.split("\n")
-        commands = []
-        Find.find(db_path) do |file|
-            LOG.debug("Assessing file #{file}..")
-            if File.directory?(file)
-              LOG.debug("Ignoring file #{file} since it is a directory")
-              next
-            end
-            if formatted_dbs.include?(file)
-              LOG.debug("Ignoring file #{file} since it is already a blast database")
-              next
-            end
-            if File.binary?(file)
-              LOG.debug("Ignoring file #{file} since it is a binary file, not plaintext as FASTA files are")
-              next
-            end
-
-                if probably_fasta?(file)
-                    LOG.info("Found #{file}")
-                    ## guess whether protein or nucleotide based on first 500 lines
-                    first_lines = ''
-                    File.open(file, 'r') do |file_stream|
-                        file_stream.each do |line|
-                            first_lines += line
-                            break if file_stream.lineno == 500
-                        end
-                    end
-                    begin
-                        sequence_type = type_of_sequences(first_lines) # returns :protein or :nucleotide
-                    rescue
-                        LOG.warn("Unable to guess sequence type for #{file}. Skipping") 
-                    end
-                    if [ :protein, :nucleotide ].include?(sequence_type)
-                        command = ask_make_db_command(file, sequence_type)
-                        unless command.nil?
-                            commands.push(command)
-                        end
-                    else 
-                        LOG.warn("Unable to guess sequence type for #{file}. Skipping") 
-                    end
-                else
-                  LOG.debug("Ignoring file #{file} since it was not judged to be a FASTA file.")
-                end
-        end
-        LOG.info("Will now create DBs")
-        if commands.empty?
-          puts "", "#{db_path} does not contain any unformatted database."
-          exit
-        end
-        commands.each do |command|
-			LOG.info("Will run: " + command.to_s)
-            system(command)
-        end
-        LOG.info("Done formatting databases. ")
-        db_table(db_path)
-    end
-
-    def db_table(db_path)
-        LOG.info("Summary of formatted blast databases:\n")
-        output = %x|#{@app.binaries['blastdbcmd']} -recursive -list #{db_path} -list_outfmt "%p %f %t" &2>1 |
-        LOG.info(output)
-    end
-
-    def probably_fasta?(file)
-		return FALSE if File.zero?(file)
-        File.open(file, 'r') do |file_stream|
-            first_line = file_stream.readline
-            if first_line.slice(0,1) == '>'
-                return TRUE
-            else 
-                return FALSE
-            end
-        end
-    end
-
-
-    # returns command than needs to be run to make db
-    def ask_make_db_command(file, type)
-        LOG.info("FASTA file: #{file}")
-        LOG.info("Fasta type: " + type.to_s)
-        
-        response = ''
-        until response.match(/^[yn]$/i) do
-            LOG.info("Proceed? [y/n]: ")
-            response = STDIN.gets.chomp
-        end
-
-        if response.match(/y/i)
-            LOG.info("Enter a database title (or will use '#{File.basename(file)})'")
-            title = STDIN.gets.chomp
-			title.gsub!('"', "'")
-            title = File.basename(file)  if title.empty?
-            
-            return make_db_command(file,type,title)
-        end
-    end
-
-    def make_db_command(file,type, title)
-        LOG.info("Will make #{type.to_s} database from #{file} with #{title}")
-        command = %|#{@app.binaries['makeblastdb']} -in #{file} -dbtype #{ type.to_s.slice(0,4)} -title "#{title}" -parse_seqids|
-        LOG.info("Returning: #{command}")
-        return(command)
-    end
-end
-
-OptionParser.new do |opts|
-  opts.banner =<<BANNER
-
-SUMMARY
-
-  prepare BLAST databases for SequenceServer
-
-USAGE
-
-  sequenceserver format-databases [--verbose] [blast_database_directory]
-
-  Example:
-
-    $ sequenceserver format-databases ~/db  # explicitly specify a database directory
-    $ sequenceserver format-databases      # use the database directory in config.yml
-
-DESCRIPTION
-
-  Recursively scan the given 'blast_database_directory' for BLAST databases and
-  formats them for use with SequenceServer.
-
-  It automagically detects the database type, and ignores non-db files and
-  pre-formatted databases. The 'parse_seqids' makeblastdb options is used.
-
-  'blast_database_directory' can be passed as a command line parameter or
-  through a configuration file by setting the 'database' key (the same option
-  used by SequenceServer). Configuration file will be checked only if the
-  command line parameter is missing.
-
-OPTIONS
-
-BANNER
-
-  opts.on_tail('-h', '--help', 'Show this message') do
-    puts opts
-    exit
-  end
-
-  opts.on('-v', '--verbose', 'Print lots of output') do
-    LOG.level = Logger::DEBUG
-  end
-end.parse!
-
-app = DatabaseFormatter.new(ARGV[0])
-app.format_databases