scaffolder-annotation-locator 0.0.1
This diff represents the content of publicly available package versions that have been released to one of the supported registries. The information contained in this diff is provided for informational purposes only and reflects changes between package versions as they appear in their respective public registries.
- data/.document +5 -0
- data/Gemfile +17 -0
- data/LICENSE.txt +20 -0
- data/README.rdoc +19 -0
- data/Rakefile +42 -0
- data/VERSION +1 -0
- data/features/gff3.feature +317 -0
- data/features/step_definitions/scaffolder-annotation-locator_steps.rb +13 -0
- data/features/support/env.rb +14 -0
- data/lib/scaffolder/annotation_locator.rb +62 -0
- data/scaffolder-annotation-locator.gemspec +80 -0
- data/spec/scaffolder/annotation_locator_spec.rb +218 -0
- data/spec/spec_helper.rb +30 -0
- data/spec/support/gff_attribute_matcher.rb +34 -0
- metadata +203 -0
data/.document
ADDED
data/Gemfile
ADDED
|
@@ -0,0 +1,17 @@
|
|
|
1
|
+
source "http://rubygems.org"
|
|
2
|
+
|
|
3
|
+
group :default do
|
|
4
|
+
gem "scaffolder", "~> 0.4"
|
|
5
|
+
end
|
|
6
|
+
|
|
7
|
+
group :development do
|
|
8
|
+
gem "bundler", "~> 1.0"
|
|
9
|
+
gem "jeweler", "~> 1.5"
|
|
10
|
+
|
|
11
|
+
gem "rspec", "~> 2.4"
|
|
12
|
+
gem "scaffolder-test-helpers", "0.2.2"
|
|
13
|
+
gem "cucumber", "~> 0.9"
|
|
14
|
+
gem "aruba", "~> 0.2"
|
|
15
|
+
|
|
16
|
+
gem "yard", "~> 0.6"
|
|
17
|
+
end
|
data/LICENSE.txt
ADDED
|
@@ -0,0 +1,20 @@
|
|
|
1
|
+
Copyright (c) 2010 Michael Barton
|
|
2
|
+
|
|
3
|
+
Permission is hereby granted, free of charge, to any person obtaining
|
|
4
|
+
a copy of this software and associated documentation files (the
|
|
5
|
+
"Software"), to deal in the Software without restriction, including
|
|
6
|
+
without limitation the rights to use, copy, modify, merge, publish,
|
|
7
|
+
distribute, sublicense, and/or sell copies of the Software, and to
|
|
8
|
+
permit persons to whom the Software is furnished to do so, subject to
|
|
9
|
+
the following conditions:
|
|
10
|
+
|
|
11
|
+
The above copyright notice and this permission notice shall be
|
|
12
|
+
included in all copies or substantial portions of the Software.
|
|
13
|
+
|
|
14
|
+
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
|
15
|
+
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
|
16
|
+
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
|
17
|
+
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE
|
|
18
|
+
LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION
|
|
19
|
+
OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION
|
|
20
|
+
WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
|
data/README.rdoc
ADDED
|
@@ -0,0 +1,19 @@
|
|
|
1
|
+
= scaffolder-annotation-locator
|
|
2
|
+
|
|
3
|
+
Description goes here.
|
|
4
|
+
|
|
5
|
+
== Contributing to scaffolder-annotation-locator
|
|
6
|
+
|
|
7
|
+
* Check out the latest master to make sure the feature hasn't been implemented or the bug hasn't been fixed yet
|
|
8
|
+
* Check out the issue tracker to make sure someone already hasn't requested it and/or contributed it
|
|
9
|
+
* Fork the project
|
|
10
|
+
* Start a feature/bugfix branch
|
|
11
|
+
* Commit and push until you are happy with your contribution
|
|
12
|
+
* Make sure to add tests for it. This is important so I don't break it in a future version unintentionally.
|
|
13
|
+
* Please try not to mess with the Rakefile, version, or history. If you want to have your own version, or is otherwise necessary, that is fine, but please isolate to its own commit so I can cherry-pick around it.
|
|
14
|
+
|
|
15
|
+
== Copyright
|
|
16
|
+
|
|
17
|
+
Copyright (c) 2010 Michael Barton. See LICENSE.txt for
|
|
18
|
+
further details.
|
|
19
|
+
|
data/Rakefile
ADDED
|
@@ -0,0 +1,42 @@
|
|
|
1
|
+
require 'rubygems'
|
|
2
|
+
require 'bundler'
|
|
3
|
+
begin
|
|
4
|
+
Bundler.setup(:default, :development)
|
|
5
|
+
rescue Bundler::BundlerError => e
|
|
6
|
+
$stderr.puts e.message
|
|
7
|
+
$stderr.puts "Run `bundle install` to install missing gems"
|
|
8
|
+
exit e.status_code
|
|
9
|
+
end
|
|
10
|
+
require 'rake'
|
|
11
|
+
|
|
12
|
+
require 'jeweler'
|
|
13
|
+
Jeweler::Tasks.new do |gem|
|
|
14
|
+
# gem is a Gem::Specification... see http://docs.rubygems.org/read/chapter/20 for more options
|
|
15
|
+
gem.name = "scaffolder-annotation-locator"
|
|
16
|
+
gem.homepage = "http://next.gs"
|
|
17
|
+
gem.license = "MIT"
|
|
18
|
+
gem.summary = %Q{Update locations of gff3 annotations from a scaffolder template}
|
|
19
|
+
gem.description = %Q{Build a genome scaffold using scaffolder and a set of annotated contigs. This tool updates the locations of the contig annotations using the scaffolder tempalte as a base.}
|
|
20
|
+
gem.email = "mail@michaelbarton.me.uk"
|
|
21
|
+
gem.authors = ["Michael Barton"]
|
|
22
|
+
end
|
|
23
|
+
Jeweler::RubygemsDotOrgTasks.new
|
|
24
|
+
|
|
25
|
+
require 'rspec/core'
|
|
26
|
+
require 'rspec/core/rake_task'
|
|
27
|
+
RSpec::Core::RakeTask.new(:spec) do |spec|
|
|
28
|
+
spec.pattern = FileList['spec/**/*_spec.rb']
|
|
29
|
+
end
|
|
30
|
+
|
|
31
|
+
RSpec::Core::RakeTask.new(:rcov) do |spec|
|
|
32
|
+
spec.pattern = 'spec/**/*_spec.rb'
|
|
33
|
+
spec.rcov = true
|
|
34
|
+
end
|
|
35
|
+
|
|
36
|
+
require 'cucumber/rake/task'
|
|
37
|
+
Cucumber::Rake::Task.new(:features)
|
|
38
|
+
|
|
39
|
+
task :default => :spec
|
|
40
|
+
|
|
41
|
+
require 'yard'
|
|
42
|
+
YARD::Rake::YardocTask.new
|
data/VERSION
ADDED
|
@@ -0,0 +1 @@
|
|
|
1
|
+
0.0.1
|
|
@@ -0,0 +1,317 @@
|
|
|
1
|
+
Feature: Locating gff3 annotations on a scaffold
|
|
2
|
+
In order to add gff3 annotations to a scaffold
|
|
3
|
+
A user can use scaffold-annotation-locator
|
|
4
|
+
to return the updated coordinates of scaffold annotations
|
|
5
|
+
|
|
6
|
+
Scenario: One annotation on a contig
|
|
7
|
+
Given a file named "scaf.yml" with:
|
|
8
|
+
"""
|
|
9
|
+
---
|
|
10
|
+
- sequence:
|
|
11
|
+
source: contig1
|
|
12
|
+
"""
|
|
13
|
+
Given a file named "seq.fna" with:
|
|
14
|
+
"""
|
|
15
|
+
> contig1
|
|
16
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
17
|
+
"""
|
|
18
|
+
Given a file named "anno.gff" with:
|
|
19
|
+
"""
|
|
20
|
+
##gff-version 3
|
|
21
|
+
contig1 . CDS 4 13 . + 1 ID=gene1
|
|
22
|
+
"""
|
|
23
|
+
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff"
|
|
24
|
+
Then the result should be:
|
|
25
|
+
"""
|
|
26
|
+
##gff-version 3
|
|
27
|
+
scaffold . CDS 4 13 . + 1 ID=gene1
|
|
28
|
+
"""
|
|
29
|
+
|
|
30
|
+
Scenario: One annotation on a trimmed contig
|
|
31
|
+
Given a file named "scaf.yml" with:
|
|
32
|
+
"""
|
|
33
|
+
---
|
|
34
|
+
- sequence:
|
|
35
|
+
source: contig1
|
|
36
|
+
start: 4
|
|
37
|
+
"""
|
|
38
|
+
Given a file named "seq.fna" with:
|
|
39
|
+
"""
|
|
40
|
+
> contig1
|
|
41
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
42
|
+
"""
|
|
43
|
+
Given a file named "anno.gff" with:
|
|
44
|
+
"""
|
|
45
|
+
##gff-version 3
|
|
46
|
+
contig1 . CDS 4 13 . + 1 ID=gene1
|
|
47
|
+
"""
|
|
48
|
+
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff"
|
|
49
|
+
Then the result should be:
|
|
50
|
+
"""
|
|
51
|
+
##gff-version 3
|
|
52
|
+
scaffold . CDS 1 10 . + 1 ID=gene1
|
|
53
|
+
"""
|
|
54
|
+
|
|
55
|
+
Scenario: One annotation on a reversed contig
|
|
56
|
+
Given a file named "scaf.yml" with:
|
|
57
|
+
"""
|
|
58
|
+
---
|
|
59
|
+
- sequence:
|
|
60
|
+
source: contig1
|
|
61
|
+
reverse: true
|
|
62
|
+
"""
|
|
63
|
+
Given a file named "seq.fna" with:
|
|
64
|
+
"""
|
|
65
|
+
> contig1
|
|
66
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
67
|
+
"""
|
|
68
|
+
Given a file named "anno.gff" with:
|
|
69
|
+
"""
|
|
70
|
+
##gff-version 3
|
|
71
|
+
contig1 . CDS 1 6 . + 1 ID=gene1
|
|
72
|
+
"""
|
|
73
|
+
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff"
|
|
74
|
+
Then the result should be:
|
|
75
|
+
"""
|
|
76
|
+
##gff-version 3
|
|
77
|
+
scaffold . CDS 15 20 . - 1 ID=gene1
|
|
78
|
+
"""
|
|
79
|
+
|
|
80
|
+
Scenario: Three annotations on three contigs
|
|
81
|
+
Given a file named "scaf.yml" with:
|
|
82
|
+
"""
|
|
83
|
+
---
|
|
84
|
+
- sequence:
|
|
85
|
+
source: contig1
|
|
86
|
+
- sequence:
|
|
87
|
+
source: contig2
|
|
88
|
+
- sequence:
|
|
89
|
+
source: contig3
|
|
90
|
+
"""
|
|
91
|
+
Given a file named "seq.fna" with:
|
|
92
|
+
"""
|
|
93
|
+
> contig1
|
|
94
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
95
|
+
> contig2
|
|
96
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
97
|
+
> contig3
|
|
98
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
99
|
+
"""
|
|
100
|
+
Given a file named "anno.gff" with:
|
|
101
|
+
"""
|
|
102
|
+
##gff-version 3
|
|
103
|
+
contig1 . CDS 1 10 . + 1 ID=gene1
|
|
104
|
+
contig2 . CDS 1 6 . + 1 ID=gene2
|
|
105
|
+
contig3 . CDS 1 6 . + 1 ID=gene2
|
|
106
|
+
"""
|
|
107
|
+
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff"
|
|
108
|
+
Then the result should be:
|
|
109
|
+
"""
|
|
110
|
+
##gff-version 3
|
|
111
|
+
scaffold . CDS 1 10 . + 1 ID=gene1
|
|
112
|
+
scaffold . CDS 21 26 . + 1 ID=gene2
|
|
113
|
+
scaffold . CDS 41 46 . + 1 ID=gene2
|
|
114
|
+
"""
|
|
115
|
+
|
|
116
|
+
Scenario: Unordered Annotations on multiple contigs
|
|
117
|
+
Given a file named "scaf.yml" with:
|
|
118
|
+
"""
|
|
119
|
+
---
|
|
120
|
+
- sequence:
|
|
121
|
+
source: contig1
|
|
122
|
+
- sequence:
|
|
123
|
+
source: contig2
|
|
124
|
+
"""
|
|
125
|
+
Given a file named "seq.fna" with:
|
|
126
|
+
"""
|
|
127
|
+
> contig1
|
|
128
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
129
|
+
> contig2
|
|
130
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
131
|
+
"""
|
|
132
|
+
Given a file named "anno.gff" with:
|
|
133
|
+
"""
|
|
134
|
+
##gff-version 3
|
|
135
|
+
contig2 . CDS 1 6 . + 1 ID=gene2
|
|
136
|
+
contig1 . CDS 1 10 . + 1 ID=gene1
|
|
137
|
+
"""
|
|
138
|
+
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff"
|
|
139
|
+
Then the result should be:
|
|
140
|
+
"""
|
|
141
|
+
##gff-version 3
|
|
142
|
+
scaffold . CDS 1 10 . + 1 ID=gene1
|
|
143
|
+
scaffold . CDS 21 26 . + 1 ID=gene2
|
|
144
|
+
"""
|
|
145
|
+
|
|
146
|
+
Scenario: Annotations on trimmed contigs
|
|
147
|
+
Given a file named "scaf.yml" with:
|
|
148
|
+
"""
|
|
149
|
+
---
|
|
150
|
+
- sequence:
|
|
151
|
+
source: contig1
|
|
152
|
+
stop: 17
|
|
153
|
+
- sequence:
|
|
154
|
+
source: contig2
|
|
155
|
+
start: 4
|
|
156
|
+
stop: 9
|
|
157
|
+
- sequence:
|
|
158
|
+
source: contig3
|
|
159
|
+
"""
|
|
160
|
+
Given a file named "seq.fna" with:
|
|
161
|
+
"""
|
|
162
|
+
> contig1
|
|
163
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
164
|
+
> contig2
|
|
165
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
166
|
+
> contig3
|
|
167
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
168
|
+
"""
|
|
169
|
+
Given a file named "anno.gff" with:
|
|
170
|
+
"""
|
|
171
|
+
##gff-version 3
|
|
172
|
+
contig1 . CDS 1 10 . + 1 ID=gene1
|
|
173
|
+
contig2 . CDS 4 6 . + 1 ID=gene2
|
|
174
|
+
contig3 . CDS 1 6 . + 1 ID=gene3
|
|
175
|
+
"""
|
|
176
|
+
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff"
|
|
177
|
+
Then the result should be:
|
|
178
|
+
"""
|
|
179
|
+
##gff-version 3
|
|
180
|
+
scaffold . CDS 1 10 . + 1 ID=gene1
|
|
181
|
+
scaffold . CDS 18 20 . + 1 ID=gene2
|
|
182
|
+
scaffold . CDS 24 29 . + 1 ID=gene3
|
|
183
|
+
"""
|
|
184
|
+
|
|
185
|
+
Scenario: Annotations on reversed and trimmed contigs
|
|
186
|
+
Given a file named "scaf.yml" with:
|
|
187
|
+
"""
|
|
188
|
+
---
|
|
189
|
+
- sequence:
|
|
190
|
+
source: contig1
|
|
191
|
+
stop: 17
|
|
192
|
+
- sequence:
|
|
193
|
+
source: contig2
|
|
194
|
+
start: 4
|
|
195
|
+
stop: 9
|
|
196
|
+
reverse: true
|
|
197
|
+
- sequence:
|
|
198
|
+
source: contig3
|
|
199
|
+
reverse: true
|
|
200
|
+
"""
|
|
201
|
+
Given a file named "seq.fna" with:
|
|
202
|
+
"""
|
|
203
|
+
> contig1
|
|
204
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
205
|
+
> contig2
|
|
206
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
207
|
+
> contig3
|
|
208
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
209
|
+
"""
|
|
210
|
+
Given a file named "anno.gff" with:
|
|
211
|
+
"""
|
|
212
|
+
##gff-version 3
|
|
213
|
+
contig1 . CDS 1 10 . + 1 ID=gene1
|
|
214
|
+
contig2 . CDS 4 6 . + 1 ID=gene2
|
|
215
|
+
contig3 . CDS 1 6 . + 1 ID=gene3
|
|
216
|
+
"""
|
|
217
|
+
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff"
|
|
218
|
+
Then the result should be:
|
|
219
|
+
"""
|
|
220
|
+
##gff-version 3
|
|
221
|
+
scaffold . CDS 1 10 . + 1 ID=gene1
|
|
222
|
+
scaffold . CDS 21 23 . - 1 ID=gene2
|
|
223
|
+
scaffold . CDS 38 43 . - 1 ID=gene3
|
|
224
|
+
"""
|
|
225
|
+
|
|
226
|
+
Scenario: Annotations on two contigs separated by an unannotated contig
|
|
227
|
+
Given a file named "scaf.yml" with:
|
|
228
|
+
"""
|
|
229
|
+
---
|
|
230
|
+
- sequence:
|
|
231
|
+
source: contig1
|
|
232
|
+
- sequence:
|
|
233
|
+
source: contig2
|
|
234
|
+
- sequence:
|
|
235
|
+
source: contig3
|
|
236
|
+
"""
|
|
237
|
+
Given a file named "seq.fna" with:
|
|
238
|
+
"""
|
|
239
|
+
> contig1
|
|
240
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
241
|
+
> contig2
|
|
242
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
243
|
+
> contig3
|
|
244
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
245
|
+
"""
|
|
246
|
+
Given a file named "anno.gff" with:
|
|
247
|
+
"""
|
|
248
|
+
##gff-version 3
|
|
249
|
+
contig1 . CDS 1 6 . + 1 ID=gene1
|
|
250
|
+
contig3 . CDS 1 6 . + 1 ID=gene2
|
|
251
|
+
"""
|
|
252
|
+
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff"
|
|
253
|
+
Then the result should be:
|
|
254
|
+
"""
|
|
255
|
+
##gff-version 3
|
|
256
|
+
scaffold . CDS 1 6 . + 1 ID=gene1
|
|
257
|
+
scaffold . CDS 41 46 . + 1 ID=gene2
|
|
258
|
+
"""
|
|
259
|
+
|
|
260
|
+
Scenario: Annotations on two contigs separated by an unresolved region
|
|
261
|
+
Given a file named "scaf.yml" with:
|
|
262
|
+
"""
|
|
263
|
+
---
|
|
264
|
+
- sequence:
|
|
265
|
+
source: contig1
|
|
266
|
+
- unresolved:
|
|
267
|
+
length: 10
|
|
268
|
+
- sequence:
|
|
269
|
+
source: contig2
|
|
270
|
+
"""
|
|
271
|
+
Given a file named "seq.fna" with:
|
|
272
|
+
"""
|
|
273
|
+
> contig1
|
|
274
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
275
|
+
> contig2
|
|
276
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
277
|
+
"""
|
|
278
|
+
Given a file named "anno.gff" with:
|
|
279
|
+
"""
|
|
280
|
+
##gff-version 3
|
|
281
|
+
contig1 . CDS 1 6 . + 1 ID=gene1
|
|
282
|
+
contig2 . CDS 1 6 . + 1 ID=gene2
|
|
283
|
+
"""
|
|
284
|
+
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff"
|
|
285
|
+
Then the result should be:
|
|
286
|
+
"""
|
|
287
|
+
##gff-version 3
|
|
288
|
+
scaffold . CDS 1 6 . + 1 ID=gene1
|
|
289
|
+
scaffold . CDS 31 36 . + 1 ID=gene2
|
|
290
|
+
"""
|
|
291
|
+
|
|
292
|
+
Scenario: Annotations on a single duplicated contig
|
|
293
|
+
Given a file named "scaf.yml" with:
|
|
294
|
+
"""
|
|
295
|
+
---
|
|
296
|
+
- sequence:
|
|
297
|
+
source: contig1
|
|
298
|
+
- sequence:
|
|
299
|
+
source: contig1
|
|
300
|
+
"""
|
|
301
|
+
Given a file named "seq.fna" with:
|
|
302
|
+
"""
|
|
303
|
+
> contig1
|
|
304
|
+
AAAAAGGGGGCCCCCTTTTT
|
|
305
|
+
"""
|
|
306
|
+
Given a file named "anno.gff" with:
|
|
307
|
+
"""
|
|
308
|
+
##gff-version 3
|
|
309
|
+
contig1 . CDS 1 6 . + 1 ID=gene1
|
|
310
|
+
"""
|
|
311
|
+
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff"
|
|
312
|
+
Then the result should be:
|
|
313
|
+
"""
|
|
314
|
+
##gff-version 3
|
|
315
|
+
scaffold . CDS 1 6 . + 1 ID=gene1
|
|
316
|
+
scaffold . CDS 21 26 . + 1 ID=gene1
|
|
317
|
+
"""
|
|
@@ -0,0 +1,13 @@
|
|
|
1
|
+
When /^I relocate the annotations using "([^"]*)", "([^"]*)" and "([^"]*)"$/ do |scaffold, sequence, annotations|
|
|
2
|
+
gff3 = Bio::GFF::GFF3.new
|
|
3
|
+
|
|
4
|
+
gff3.records = Scaffolder::AnnotationLocator.new(
|
|
5
|
+
'tmp/aruba/' + scaffold,
|
|
6
|
+
'tmp/aruba/' + sequence,
|
|
7
|
+
'tmp/aruba/' + annotations)
|
|
8
|
+
@result = gff3.to_s.strip
|
|
9
|
+
end
|
|
10
|
+
|
|
11
|
+
Then /^the result should be:$/ do |result|
|
|
12
|
+
@result.should == result
|
|
13
|
+
end
|
|
@@ -0,0 +1,14 @@
|
|
|
1
|
+
require 'bundler'
|
|
2
|
+
begin
|
|
3
|
+
Bundler.setup(:default, :development)
|
|
4
|
+
rescue Bundler::BundlerError => e
|
|
5
|
+
$stderr.puts e.message
|
|
6
|
+
$stderr.puts "Run `bundle install` to install missing gems"
|
|
7
|
+
exit e.status_code
|
|
8
|
+
end
|
|
9
|
+
|
|
10
|
+
$LOAD_PATH.unshift(File.dirname(__FILE__) + '/../../lib')
|
|
11
|
+
require 'scaffolder/annotation_locator'
|
|
12
|
+
|
|
13
|
+
require 'rspec/expectations'
|
|
14
|
+
require 'aruba/cucumber'
|
|
@@ -0,0 +1,62 @@
|
|
|
1
|
+
require 'delegate'
|
|
2
|
+
require 'scaffolder'
|
|
3
|
+
require 'bio'
|
|
4
|
+
|
|
5
|
+
class Scaffolder::AnnotationLocator < DelegateClass(Array)
|
|
6
|
+
|
|
7
|
+
def initialize(scaffold_file,sequence_file,gff_file)
|
|
8
|
+
@scaffold_file = scaffold_file
|
|
9
|
+
@sequence_file = sequence_file
|
|
10
|
+
@gff_file = gff_file
|
|
11
|
+
|
|
12
|
+
updated_records = Array.new
|
|
13
|
+
scaffold.inject(0) do |length,entry|
|
|
14
|
+
|
|
15
|
+
if entry.entry_type == :sequence
|
|
16
|
+
updated_records << records[entry.source].map do |record|
|
|
17
|
+
update_record(record,entry,length)
|
|
18
|
+
end
|
|
19
|
+
end
|
|
20
|
+
|
|
21
|
+
length + entry.sequence.length
|
|
22
|
+
end
|
|
23
|
+
|
|
24
|
+
super updated_records.flatten
|
|
25
|
+
end
|
|
26
|
+
|
|
27
|
+
def update_record(record,scaffold_entry,prior_length)
|
|
28
|
+
record.start -= scaffold_entry.start - 1
|
|
29
|
+
record.end -= scaffold_entry.start - 1
|
|
30
|
+
|
|
31
|
+
if scaffold_entry.reverse
|
|
32
|
+
record.end = scaffold_entry.sequence.length - (record.end - 1)
|
|
33
|
+
record.start = scaffold_entry.sequence.length - (record.start - 1)
|
|
34
|
+
|
|
35
|
+
record.end, record.start = record.start, record.end
|
|
36
|
+
record.strand = self.class.flip_strand(record.strand)
|
|
37
|
+
end
|
|
38
|
+
|
|
39
|
+
record.start += prior_length
|
|
40
|
+
record.end += prior_length
|
|
41
|
+
|
|
42
|
+
record.seqname = "scaffold"
|
|
43
|
+
record
|
|
44
|
+
end
|
|
45
|
+
|
|
46
|
+
def scaffold
|
|
47
|
+
Scaffolder.new(YAML.load(File.read(@scaffold_file)),@sequence_file)
|
|
48
|
+
end
|
|
49
|
+
|
|
50
|
+
def records
|
|
51
|
+
gff3 = Bio::GFF::GFF3.new(File.read(@gff_file)).records
|
|
52
|
+
gff3.inject(Hash.new{|h,k| h[k] = Array.new }) do |hash,record|
|
|
53
|
+
hash[record.seqname] << record
|
|
54
|
+
hash
|
|
55
|
+
end
|
|
56
|
+
end
|
|
57
|
+
|
|
58
|
+
def self.flip_strand(strand)
|
|
59
|
+
strand == '+' ? '-' : '+'
|
|
60
|
+
end
|
|
61
|
+
|
|
62
|
+
end
|
|
@@ -0,0 +1,80 @@
|
|
|
1
|
+
# Generated by jeweler
|
|
2
|
+
# DO NOT EDIT THIS FILE DIRECTLY
|
|
3
|
+
# Instead, edit Jeweler::Tasks in Rakefile, and run 'rake gemspec'
|
|
4
|
+
# -*- encoding: utf-8 -*-
|
|
5
|
+
|
|
6
|
+
Gem::Specification.new do |s|
|
|
7
|
+
s.name = %q{scaffolder-annotation-locator}
|
|
8
|
+
s.version = "0.0.1"
|
|
9
|
+
|
|
10
|
+
s.required_rubygems_version = Gem::Requirement.new(">= 0") if s.respond_to? :required_rubygems_version=
|
|
11
|
+
s.authors = ["Michael Barton"]
|
|
12
|
+
s.date = %q{2011-04-05}
|
|
13
|
+
s.description = %q{Build a genome scaffold using scaffolder and a set of annotated contigs. This tool updates the locations of the contig annotations using the scaffolder tempalte as a base.}
|
|
14
|
+
s.email = %q{mail@michaelbarton.me.uk}
|
|
15
|
+
s.extra_rdoc_files = [
|
|
16
|
+
"LICENSE.txt",
|
|
17
|
+
"README.rdoc"
|
|
18
|
+
]
|
|
19
|
+
s.files = [
|
|
20
|
+
".document",
|
|
21
|
+
"Gemfile",
|
|
22
|
+
"LICENSE.txt",
|
|
23
|
+
"README.rdoc",
|
|
24
|
+
"Rakefile",
|
|
25
|
+
"VERSION",
|
|
26
|
+
"features/gff3.feature",
|
|
27
|
+
"features/step_definitions/scaffolder-annotation-locator_steps.rb",
|
|
28
|
+
"features/support/env.rb",
|
|
29
|
+
"lib/scaffolder/annotation_locator.rb",
|
|
30
|
+
"scaffolder-annotation-locator.gemspec",
|
|
31
|
+
"spec/scaffolder/annotation_locator_spec.rb",
|
|
32
|
+
"spec/spec_helper.rb",
|
|
33
|
+
"spec/support/gff_attribute_matcher.rb"
|
|
34
|
+
]
|
|
35
|
+
s.homepage = %q{http://next.gs}
|
|
36
|
+
s.licenses = ["MIT"]
|
|
37
|
+
s.require_paths = ["lib"]
|
|
38
|
+
s.rubygems_version = %q{1.3.7}
|
|
39
|
+
s.summary = %q{Update locations of gff3 annotations from a scaffolder template}
|
|
40
|
+
s.test_files = [
|
|
41
|
+
"spec/scaffolder/annotation_locator_spec.rb",
|
|
42
|
+
"spec/spec_helper.rb",
|
|
43
|
+
"spec/support/gff_attribute_matcher.rb"
|
|
44
|
+
]
|
|
45
|
+
|
|
46
|
+
if s.respond_to? :specification_version then
|
|
47
|
+
current_version = Gem::Specification::CURRENT_SPECIFICATION_VERSION
|
|
48
|
+
s.specification_version = 3
|
|
49
|
+
|
|
50
|
+
if Gem::Version.new(Gem::VERSION) >= Gem::Version.new('1.2.0') then
|
|
51
|
+
s.add_runtime_dependency(%q<scaffolder>, ["~> 0.4"])
|
|
52
|
+
s.add_development_dependency(%q<bundler>, ["~> 1.0"])
|
|
53
|
+
s.add_development_dependency(%q<jeweler>, ["~> 1.5"])
|
|
54
|
+
s.add_development_dependency(%q<rspec>, ["~> 2.4"])
|
|
55
|
+
s.add_development_dependency(%q<scaffolder-test-helpers>, ["= 0.2.2"])
|
|
56
|
+
s.add_development_dependency(%q<cucumber>, ["~> 0.9"])
|
|
57
|
+
s.add_development_dependency(%q<aruba>, ["~> 0.2"])
|
|
58
|
+
s.add_development_dependency(%q<yard>, ["~> 0.6"])
|
|
59
|
+
else
|
|
60
|
+
s.add_dependency(%q<scaffolder>, ["~> 0.4"])
|
|
61
|
+
s.add_dependency(%q<bundler>, ["~> 1.0"])
|
|
62
|
+
s.add_dependency(%q<jeweler>, ["~> 1.5"])
|
|
63
|
+
s.add_dependency(%q<rspec>, ["~> 2.4"])
|
|
64
|
+
s.add_dependency(%q<scaffolder-test-helpers>, ["= 0.2.2"])
|
|
65
|
+
s.add_dependency(%q<cucumber>, ["~> 0.9"])
|
|
66
|
+
s.add_dependency(%q<aruba>, ["~> 0.2"])
|
|
67
|
+
s.add_dependency(%q<yard>, ["~> 0.6"])
|
|
68
|
+
end
|
|
69
|
+
else
|
|
70
|
+
s.add_dependency(%q<scaffolder>, ["~> 0.4"])
|
|
71
|
+
s.add_dependency(%q<bundler>, ["~> 1.0"])
|
|
72
|
+
s.add_dependency(%q<jeweler>, ["~> 1.5"])
|
|
73
|
+
s.add_dependency(%q<rspec>, ["~> 2.4"])
|
|
74
|
+
s.add_dependency(%q<scaffolder-test-helpers>, ["= 0.2.2"])
|
|
75
|
+
s.add_dependency(%q<cucumber>, ["~> 0.9"])
|
|
76
|
+
s.add_dependency(%q<aruba>, ["~> 0.2"])
|
|
77
|
+
s.add_dependency(%q<yard>, ["~> 0.6"])
|
|
78
|
+
end
|
|
79
|
+
end
|
|
80
|
+
|
|
@@ -0,0 +1,218 @@
|
|
|
1
|
+
require File.expand_path(File.join(File.dirname(__FILE__), '..', 'spec_helper'))
|
|
2
|
+
|
|
3
|
+
describe Scaffolder::AnnotationLocator do
|
|
4
|
+
|
|
5
|
+
def relocate(scaffold,records)
|
|
6
|
+
@scaffold_file, @sequence_file = generate_scaffold_files(scaffold)
|
|
7
|
+
described_class.new(@scaffold_file.path, @sequence_file.path,
|
|
8
|
+
generate_gff3_file(records))
|
|
9
|
+
end
|
|
10
|
+
|
|
11
|
+
before do
|
|
12
|
+
@contig = Sequence.new(:name => 'c1',:sequence => 'ATGCCC')
|
|
13
|
+
@record = {:seqname => 'c1',
|
|
14
|
+
:start => 4, :end => 6, :strand => '+',:phase => 1}
|
|
15
|
+
end
|
|
16
|
+
|
|
17
|
+
describe "relocating a single contig" do
|
|
18
|
+
|
|
19
|
+
describe "with no annotations" do
|
|
20
|
+
|
|
21
|
+
subject do
|
|
22
|
+
relocate([@contig],[])
|
|
23
|
+
end
|
|
24
|
+
|
|
25
|
+
it "should return an empty annotation array" do
|
|
26
|
+
subject.should be_empty
|
|
27
|
+
end
|
|
28
|
+
|
|
29
|
+
end
|
|
30
|
+
|
|
31
|
+
describe "with a single annotation" do
|
|
32
|
+
|
|
33
|
+
subject do
|
|
34
|
+
relocate([@contig],[@record])
|
|
35
|
+
end
|
|
36
|
+
|
|
37
|
+
it{ should set_the_attribute(:seqname => 'scaffold') }
|
|
38
|
+
it{ should set_the_attribute(:phase => 1) }
|
|
39
|
+
it{ should set_the_attribute(:strand => '+') }
|
|
40
|
+
|
|
41
|
+
it{ should set_the_attribute(:start => 4).only_for_the(:first) }
|
|
42
|
+
it{ should set_the_attribute(:end => 6).only_for_the(:first) }
|
|
43
|
+
|
|
44
|
+
end
|
|
45
|
+
|
|
46
|
+
describe "reversed with a single annotation" do
|
|
47
|
+
|
|
48
|
+
subject do
|
|
49
|
+
relocate([@contig.clone.reverse(true)],[@record])
|
|
50
|
+
end
|
|
51
|
+
|
|
52
|
+
it{ should set_the_attribute(:seqname => 'scaffold') }
|
|
53
|
+
it{ should set_the_attribute(:phase => 1) }
|
|
54
|
+
it{ should set_the_attribute(:strand => '-') }
|
|
55
|
+
|
|
56
|
+
it{ should set_the_attribute(:start => 1).only_for_the(:first) }
|
|
57
|
+
it{ should set_the_attribute(:end => 3).only_for_the(:first) }
|
|
58
|
+
|
|
59
|
+
end
|
|
60
|
+
|
|
61
|
+
describe "start trimmed with a single annotation" do
|
|
62
|
+
|
|
63
|
+
subject do
|
|
64
|
+
relocate([@contig.clone.start(4)],[@record])
|
|
65
|
+
end
|
|
66
|
+
|
|
67
|
+
it{ should set_the_attribute(:seqname => 'scaffold') }
|
|
68
|
+
it{ should set_the_attribute(:phase => 1) }
|
|
69
|
+
it{ should set_the_attribute(:strand => '+') }
|
|
70
|
+
|
|
71
|
+
it{ should set_the_attribute(:start => 1).only_for_the(:first) }
|
|
72
|
+
it{ should set_the_attribute(:end => 3).only_for_the(:first) }
|
|
73
|
+
|
|
74
|
+
end
|
|
75
|
+
|
|
76
|
+
end
|
|
77
|
+
|
|
78
|
+
describe "relocating two contigs" do
|
|
79
|
+
|
|
80
|
+
describe "with an annotation on each contig" do
|
|
81
|
+
|
|
82
|
+
subject do
|
|
83
|
+
second = @record.clone
|
|
84
|
+
second[:seqname] = 'c2'
|
|
85
|
+
relocate([@contig, @contig.clone.name('c2')],[@record,second])
|
|
86
|
+
end
|
|
87
|
+
|
|
88
|
+
it{ should set_the_attribute(:seqname => 'scaffold') }
|
|
89
|
+
it{ should set_the_attribute(:phase => 1) }
|
|
90
|
+
it{ should set_the_attribute(:strand => '+') }
|
|
91
|
+
|
|
92
|
+
it{ should set_the_attribute(:start => 4).only_for_the(:first) }
|
|
93
|
+
it{ should set_the_attribute(:end => 6).only_for_the(:first) }
|
|
94
|
+
|
|
95
|
+
it{ should set_the_attribute(:start => 10).only_for_the(:second) }
|
|
96
|
+
it{ should set_the_attribute(:end => 12).only_for_the(:second) }
|
|
97
|
+
|
|
98
|
+
end
|
|
99
|
+
|
|
100
|
+
describe "where the two annotations are unordered annotations" do
|
|
101
|
+
|
|
102
|
+
subject do
|
|
103
|
+
second = @record.merge({:seqname => 'c2', :strand => '-'})
|
|
104
|
+
relocate([@contig, @contig.clone.name('c2')],[second,@record])
|
|
105
|
+
end
|
|
106
|
+
|
|
107
|
+
it{ should set_the_attribute(:seqname => 'scaffold') }
|
|
108
|
+
it{ should set_the_attribute(:phase => 1) }
|
|
109
|
+
|
|
110
|
+
it{ should set_the_attribute(:start => 4).only_for_the(:first) }
|
|
111
|
+
it{ should set_the_attribute(:end => 6).only_for_the(:first) }
|
|
112
|
+
it{ should set_the_attribute(:strand => '+').only_for_the(:first) }
|
|
113
|
+
|
|
114
|
+
it{ should set_the_attribute(:start => 10).only_for_the(:second) }
|
|
115
|
+
it{ should set_the_attribute(:end => 12).only_for_the(:second) }
|
|
116
|
+
it{ should set_the_attribute(:strand => '-').only_for_the(:second) }
|
|
117
|
+
|
|
118
|
+
end
|
|
119
|
+
|
|
120
|
+
describe "where the first of the two contigs is start trimmed" do
|
|
121
|
+
|
|
122
|
+
subject do
|
|
123
|
+
second = @record.clone
|
|
124
|
+
second[:seqname] = 'c2'
|
|
125
|
+
|
|
126
|
+
relocate([@contig.clone.start(4),@contig.clone.name('c2')],[@record,second])
|
|
127
|
+
end
|
|
128
|
+
|
|
129
|
+
it{ should set_the_attribute(:seqname => 'scaffold') }
|
|
130
|
+
it{ should set_the_attribute(:phase => 1) }
|
|
131
|
+
it{ should set_the_attribute(:strand => '+') }
|
|
132
|
+
|
|
133
|
+
it{ should set_the_attribute(:start => 1).only_for_the(:first) }
|
|
134
|
+
it{ should set_the_attribute(:end => 3).only_for_the(:first) }
|
|
135
|
+
|
|
136
|
+
it{ should set_the_attribute(:start => 7).only_for_the(:second) }
|
|
137
|
+
it{ should set_the_attribute(:end => 9).only_for_the(:second) }
|
|
138
|
+
|
|
139
|
+
end
|
|
140
|
+
|
|
141
|
+
describe "where the first of two contigs is stop trimmed" do
|
|
142
|
+
|
|
143
|
+
subject do
|
|
144
|
+
first = @record.clone
|
|
145
|
+
first[:start] = 1
|
|
146
|
+
first[:end] = 3
|
|
147
|
+
|
|
148
|
+
second = @record.clone
|
|
149
|
+
second[:seqname] = 'c2'
|
|
150
|
+
|
|
151
|
+
relocate([@contig.clone.stop(3),@contig.clone.name('c2')],[first,second])
|
|
152
|
+
end
|
|
153
|
+
|
|
154
|
+
it{ should set_the_attribute(:seqname => 'scaffold') }
|
|
155
|
+
it{ should set_the_attribute(:phase => 1) }
|
|
156
|
+
it{ should set_the_attribute(:strand => '+') }
|
|
157
|
+
|
|
158
|
+
it{ should set_the_attribute(:start => 1).only_for_the(:first) }
|
|
159
|
+
it{ should set_the_attribute(:end => 3).only_for_the(:first) }
|
|
160
|
+
|
|
161
|
+
it{ should set_the_attribute(:start => 7).only_for_the(:second) }
|
|
162
|
+
it{ should set_the_attribute(:end => 9).only_for_the(:second) }
|
|
163
|
+
|
|
164
|
+
end
|
|
165
|
+
|
|
166
|
+
describe "separated by an unresolved region" do
|
|
167
|
+
|
|
168
|
+
subject do
|
|
169
|
+
second = @record.clone
|
|
170
|
+
second[:seqname] = 'c2'
|
|
171
|
+
|
|
172
|
+
unresolved = Unresolved.new(:length => 10)
|
|
173
|
+
relocate([@contig,unresolved,@contig.clone.name('c2')],[@record,second])
|
|
174
|
+
end
|
|
175
|
+
|
|
176
|
+
it{ should set_the_attribute(:seqname => 'scaffold') }
|
|
177
|
+
it{ should set_the_attribute(:phase => 1) }
|
|
178
|
+
it{ should set_the_attribute(:strand => '+') }
|
|
179
|
+
|
|
180
|
+
it{ should set_the_attribute(:start => 4).only_for_the(:first) }
|
|
181
|
+
it{ should set_the_attribute(:end => 6).only_for_the(:first) }
|
|
182
|
+
|
|
183
|
+
it{ should set_the_attribute(:start => 20).only_for_the(:second) }
|
|
184
|
+
it{ should set_the_attribute(:end => 22).only_for_the(:second) }
|
|
185
|
+
|
|
186
|
+
end
|
|
187
|
+
|
|
188
|
+
end
|
|
189
|
+
|
|
190
|
+
describe "#records" do
|
|
191
|
+
|
|
192
|
+
subject do
|
|
193
|
+
second = @record.clone
|
|
194
|
+
second[:seqname] = 'c2'
|
|
195
|
+
|
|
196
|
+
relocate([@contig,@contig.clone.name('c2')],[@record,second]).records
|
|
197
|
+
end
|
|
198
|
+
|
|
199
|
+
it "should return the gff records grouped by sequence" do
|
|
200
|
+
subject['c1'].length.should == 1
|
|
201
|
+
subject['c2'].length.should == 1
|
|
202
|
+
end
|
|
203
|
+
|
|
204
|
+
end
|
|
205
|
+
|
|
206
|
+
describe "#flip_strand" do
|
|
207
|
+
|
|
208
|
+
it "should return '+' when passed '-'" do
|
|
209
|
+
described_class.flip_strand('+').should == '-'
|
|
210
|
+
end
|
|
211
|
+
|
|
212
|
+
it "should return '-' when passed '+'" do
|
|
213
|
+
described_class.flip_strand('-').should == '+'
|
|
214
|
+
end
|
|
215
|
+
|
|
216
|
+
end
|
|
217
|
+
|
|
218
|
+
end
|
data/spec/spec_helper.rb
ADDED
|
@@ -0,0 +1,30 @@
|
|
|
1
|
+
$LOAD_PATH.unshift(File.join(File.dirname(__FILE__), '..', 'lib'))
|
|
2
|
+
$LOAD_PATH.unshift(File.dirname(__FILE__))
|
|
3
|
+
|
|
4
|
+
require 'tempfile'
|
|
5
|
+
|
|
6
|
+
require 'rspec'
|
|
7
|
+
require 'scaffolder/test/helpers'
|
|
8
|
+
require 'scaffolder/annotation_locator'
|
|
9
|
+
|
|
10
|
+
# Requires supporting files with custom matchers and macros, etc,
|
|
11
|
+
# in ./support/ and its subdirectories.
|
|
12
|
+
Dir["#{File.dirname(__FILE__)}/support/**/*.rb"].each {|f| require f}
|
|
13
|
+
|
|
14
|
+
RSpec.configure do |config|
|
|
15
|
+
include Scaffolder::Test
|
|
16
|
+
include Scaffolder::Test::Helpers
|
|
17
|
+
|
|
18
|
+
def generate_gff3_file(annotations)
|
|
19
|
+
gff = Bio::GFF::GFF3.new
|
|
20
|
+
gff.records = annotations.map do |a|
|
|
21
|
+
Bio::GFF::GFF3::Record.new(a[:seqname], a[:source], 'CDS', a[:start],
|
|
22
|
+
a[:end], nil, a[:strand], a[:phase])
|
|
23
|
+
end
|
|
24
|
+
|
|
25
|
+
tmp = Tempfile.new("gff").path
|
|
26
|
+
File.open(tmp,'w'){ |out| out.print(gff) }
|
|
27
|
+
tmp
|
|
28
|
+
end
|
|
29
|
+
|
|
30
|
+
end
|
|
@@ -0,0 +1,34 @@
|
|
|
1
|
+
ORDINALS = [:first,:second,:third,:fourth,:fifth]
|
|
2
|
+
|
|
3
|
+
RSpec::Matchers.define :set_the_attribute do |expected|
|
|
4
|
+
match do |annotations|
|
|
5
|
+
@attribute = expected.keys.first
|
|
6
|
+
@value = expected.values.first
|
|
7
|
+
if @ordinal
|
|
8
|
+
@actual = annotations[ORDINALS.index(@ordinal)].send(@attribute)
|
|
9
|
+
@actual == @value
|
|
10
|
+
else
|
|
11
|
+
annotations.all?{|a| a.send(@attribute) == @value }
|
|
12
|
+
end
|
|
13
|
+
end
|
|
14
|
+
|
|
15
|
+
chain :only_for_the do |ordinal|
|
|
16
|
+
@ordinal = ordinal
|
|
17
|
+
end
|
|
18
|
+
|
|
19
|
+
description do
|
|
20
|
+
string = "set the annotation #{@attribute} attribute to \"#{@value}\""
|
|
21
|
+
string << " for the #{@ordinal} annotation" if @ordinal
|
|
22
|
+
string
|
|
23
|
+
end
|
|
24
|
+
|
|
25
|
+
failure_message_for_should do |annotations|
|
|
26
|
+
message = "expected \"#{@attribute}\" to be \"#{@value}\" "
|
|
27
|
+
message + if @ordinal
|
|
28
|
+
"but was \"#{actual}\" for the #{@ordinal} annotation"
|
|
29
|
+
else
|
|
30
|
+
"for all annotations"
|
|
31
|
+
end
|
|
32
|
+
end
|
|
33
|
+
|
|
34
|
+
end
|
metadata
ADDED
|
@@ -0,0 +1,203 @@
|
|
|
1
|
+
--- !ruby/object:Gem::Specification
|
|
2
|
+
name: scaffolder-annotation-locator
|
|
3
|
+
version: !ruby/object:Gem::Version
|
|
4
|
+
hash: 29
|
|
5
|
+
prerelease: false
|
|
6
|
+
segments:
|
|
7
|
+
- 0
|
|
8
|
+
- 0
|
|
9
|
+
- 1
|
|
10
|
+
version: 0.0.1
|
|
11
|
+
platform: ruby
|
|
12
|
+
authors:
|
|
13
|
+
- Michael Barton
|
|
14
|
+
autorequire:
|
|
15
|
+
bindir: bin
|
|
16
|
+
cert_chain: []
|
|
17
|
+
|
|
18
|
+
date: 2011-04-05 00:00:00 -04:00
|
|
19
|
+
default_executable:
|
|
20
|
+
dependencies:
|
|
21
|
+
- !ruby/object:Gem::Dependency
|
|
22
|
+
requirement: &id001 !ruby/object:Gem::Requirement
|
|
23
|
+
none: false
|
|
24
|
+
requirements:
|
|
25
|
+
- - ~>
|
|
26
|
+
- !ruby/object:Gem::Version
|
|
27
|
+
hash: 3
|
|
28
|
+
segments:
|
|
29
|
+
- 0
|
|
30
|
+
- 4
|
|
31
|
+
version: "0.4"
|
|
32
|
+
type: :runtime
|
|
33
|
+
name: scaffolder
|
|
34
|
+
prerelease: false
|
|
35
|
+
version_requirements: *id001
|
|
36
|
+
- !ruby/object:Gem::Dependency
|
|
37
|
+
requirement: &id002 !ruby/object:Gem::Requirement
|
|
38
|
+
none: false
|
|
39
|
+
requirements:
|
|
40
|
+
- - ~>
|
|
41
|
+
- !ruby/object:Gem::Version
|
|
42
|
+
hash: 15
|
|
43
|
+
segments:
|
|
44
|
+
- 1
|
|
45
|
+
- 0
|
|
46
|
+
version: "1.0"
|
|
47
|
+
type: :development
|
|
48
|
+
name: bundler
|
|
49
|
+
prerelease: false
|
|
50
|
+
version_requirements: *id002
|
|
51
|
+
- !ruby/object:Gem::Dependency
|
|
52
|
+
requirement: &id003 !ruby/object:Gem::Requirement
|
|
53
|
+
none: false
|
|
54
|
+
requirements:
|
|
55
|
+
- - ~>
|
|
56
|
+
- !ruby/object:Gem::Version
|
|
57
|
+
hash: 5
|
|
58
|
+
segments:
|
|
59
|
+
- 1
|
|
60
|
+
- 5
|
|
61
|
+
version: "1.5"
|
|
62
|
+
type: :development
|
|
63
|
+
name: jeweler
|
|
64
|
+
prerelease: false
|
|
65
|
+
version_requirements: *id003
|
|
66
|
+
- !ruby/object:Gem::Dependency
|
|
67
|
+
requirement: &id004 !ruby/object:Gem::Requirement
|
|
68
|
+
none: false
|
|
69
|
+
requirements:
|
|
70
|
+
- - ~>
|
|
71
|
+
- !ruby/object:Gem::Version
|
|
72
|
+
hash: 11
|
|
73
|
+
segments:
|
|
74
|
+
- 2
|
|
75
|
+
- 4
|
|
76
|
+
version: "2.4"
|
|
77
|
+
type: :development
|
|
78
|
+
name: rspec
|
|
79
|
+
prerelease: false
|
|
80
|
+
version_requirements: *id004
|
|
81
|
+
- !ruby/object:Gem::Dependency
|
|
82
|
+
requirement: &id005 !ruby/object:Gem::Requirement
|
|
83
|
+
none: false
|
|
84
|
+
requirements:
|
|
85
|
+
- - "="
|
|
86
|
+
- !ruby/object:Gem::Version
|
|
87
|
+
hash: 19
|
|
88
|
+
segments:
|
|
89
|
+
- 0
|
|
90
|
+
- 2
|
|
91
|
+
- 2
|
|
92
|
+
version: 0.2.2
|
|
93
|
+
type: :development
|
|
94
|
+
name: scaffolder-test-helpers
|
|
95
|
+
prerelease: false
|
|
96
|
+
version_requirements: *id005
|
|
97
|
+
- !ruby/object:Gem::Dependency
|
|
98
|
+
requirement: &id006 !ruby/object:Gem::Requirement
|
|
99
|
+
none: false
|
|
100
|
+
requirements:
|
|
101
|
+
- - ~>
|
|
102
|
+
- !ruby/object:Gem::Version
|
|
103
|
+
hash: 25
|
|
104
|
+
segments:
|
|
105
|
+
- 0
|
|
106
|
+
- 9
|
|
107
|
+
version: "0.9"
|
|
108
|
+
type: :development
|
|
109
|
+
name: cucumber
|
|
110
|
+
prerelease: false
|
|
111
|
+
version_requirements: *id006
|
|
112
|
+
- !ruby/object:Gem::Dependency
|
|
113
|
+
requirement: &id007 !ruby/object:Gem::Requirement
|
|
114
|
+
none: false
|
|
115
|
+
requirements:
|
|
116
|
+
- - ~>
|
|
117
|
+
- !ruby/object:Gem::Version
|
|
118
|
+
hash: 15
|
|
119
|
+
segments:
|
|
120
|
+
- 0
|
|
121
|
+
- 2
|
|
122
|
+
version: "0.2"
|
|
123
|
+
type: :development
|
|
124
|
+
name: aruba
|
|
125
|
+
prerelease: false
|
|
126
|
+
version_requirements: *id007
|
|
127
|
+
- !ruby/object:Gem::Dependency
|
|
128
|
+
requirement: &id008 !ruby/object:Gem::Requirement
|
|
129
|
+
none: false
|
|
130
|
+
requirements:
|
|
131
|
+
- - ~>
|
|
132
|
+
- !ruby/object:Gem::Version
|
|
133
|
+
hash: 7
|
|
134
|
+
segments:
|
|
135
|
+
- 0
|
|
136
|
+
- 6
|
|
137
|
+
version: "0.6"
|
|
138
|
+
type: :development
|
|
139
|
+
name: yard
|
|
140
|
+
prerelease: false
|
|
141
|
+
version_requirements: *id008
|
|
142
|
+
description: Build a genome scaffold using scaffolder and a set of annotated contigs. This tool updates the locations of the contig annotations using the scaffolder tempalte as a base.
|
|
143
|
+
email: mail@michaelbarton.me.uk
|
|
144
|
+
executables: []
|
|
145
|
+
|
|
146
|
+
extensions: []
|
|
147
|
+
|
|
148
|
+
extra_rdoc_files:
|
|
149
|
+
- LICENSE.txt
|
|
150
|
+
- README.rdoc
|
|
151
|
+
files:
|
|
152
|
+
- .document
|
|
153
|
+
- Gemfile
|
|
154
|
+
- LICENSE.txt
|
|
155
|
+
- README.rdoc
|
|
156
|
+
- Rakefile
|
|
157
|
+
- VERSION
|
|
158
|
+
- features/gff3.feature
|
|
159
|
+
- features/step_definitions/scaffolder-annotation-locator_steps.rb
|
|
160
|
+
- features/support/env.rb
|
|
161
|
+
- lib/scaffolder/annotation_locator.rb
|
|
162
|
+
- scaffolder-annotation-locator.gemspec
|
|
163
|
+
- spec/scaffolder/annotation_locator_spec.rb
|
|
164
|
+
- spec/spec_helper.rb
|
|
165
|
+
- spec/support/gff_attribute_matcher.rb
|
|
166
|
+
has_rdoc: true
|
|
167
|
+
homepage: http://next.gs
|
|
168
|
+
licenses:
|
|
169
|
+
- MIT
|
|
170
|
+
post_install_message:
|
|
171
|
+
rdoc_options: []
|
|
172
|
+
|
|
173
|
+
require_paths:
|
|
174
|
+
- lib
|
|
175
|
+
required_ruby_version: !ruby/object:Gem::Requirement
|
|
176
|
+
none: false
|
|
177
|
+
requirements:
|
|
178
|
+
- - ">="
|
|
179
|
+
- !ruby/object:Gem::Version
|
|
180
|
+
hash: 3
|
|
181
|
+
segments:
|
|
182
|
+
- 0
|
|
183
|
+
version: "0"
|
|
184
|
+
required_rubygems_version: !ruby/object:Gem::Requirement
|
|
185
|
+
none: false
|
|
186
|
+
requirements:
|
|
187
|
+
- - ">="
|
|
188
|
+
- !ruby/object:Gem::Version
|
|
189
|
+
hash: 3
|
|
190
|
+
segments:
|
|
191
|
+
- 0
|
|
192
|
+
version: "0"
|
|
193
|
+
requirements: []
|
|
194
|
+
|
|
195
|
+
rubyforge_project:
|
|
196
|
+
rubygems_version: 1.3.7
|
|
197
|
+
signing_key:
|
|
198
|
+
specification_version: 3
|
|
199
|
+
summary: Update locations of gff3 annotations from a scaffolder template
|
|
200
|
+
test_files:
|
|
201
|
+
- spec/scaffolder/annotation_locator_spec.rb
|
|
202
|
+
- spec/spec_helper.rb
|
|
203
|
+
- spec/support/gff_attribute_matcher.rb
|