libssw 0.0.2 → 0.0.3

checksums.yaml

@@ -1,7 +1,7 @@
 ---
 SHA256:
-  metadata.gz: 182b0d30cdf3d9a93b100b05f96d469d612b09bcfcfd2afc3cb63a4c93501d17
-  data.tar.gz: 99ec370125c707acff3a99664706ce8691f2e66e48d22a49af0362894b2c6b72
+  metadata.gz: 010f0923d209dc9f0d3fde047c5cfbbb176e57239ff79e236a1f69f3b634573f
+  data.tar.gz: 9e08dc3fb6b03405eaa97ac6a65743bd61fc49d8fc28de6a32b737243a365236
 SHA512:
-  metadata.gz: 8a49bf4924da5d12310b691f9f9335d96cdce0ef4b82ac1a38aeb6293c92d939cd17e4b0e6e99a4c427a0f4074f94db1cca91ca6c26b76a0551e558371b4aee7
-  data.tar.gz: 5af24c2124cd53f8aa54dc905172eb6f9b3d7c57b33fb87d1884ca2ab1a90acf0cb1f2ca73cb88eecda223e3f723836cca2dbae9cb0c1ac665d097993645ee19
+  metadata.gz: 9cf4524856aba84e141dd6b6e727e671a01ac907c1d1ad4b33907a16385a499024f235b7f982e66244af07af42e60b1efe0c093281bb433147fb594f887930e7
+  data.tar.gz: 275a528ded7a99cfac5d8d45487e27f290bd7b252cac7ddb141d1a03218b72042e0b6c54c92a7c39ee1ff276fd3cb1575772ae3b9b74316ea9a7a7e2e48ffe9a

data/README.md

@@ -3,11 +3,10 @@
 ![test](https://github.com/kojix2/ruby-libssw/workflows/CI/badge.svg)
 [![Gem Version](https://img.shields.io/gem/v/libssw?color=brightgreen)](https://rubygems.org/gems/libssw)
 [![Docs Latest](https://img.shields.io/badge/docs-latest-blue.svg)](https://rubydoc.info/gems/libssw)
+[![DOI](https://zenodo.org/badge/328163622.svg)](https://zenodo.org/badge/latestdoi/328163622)
 
 :checkered_flag: [libssw](https://github.com/mengyao/Complete-Striped-Smith-Waterman-Library) - fast SIMD parallelized implementation of the Smith-Waterman algorithm - for Ruby
 
-:construction: Under development.
-
 ## Installation
 
 ```ssh
@@ -24,41 +23,42 @@ export LIBSSWDIR=/usr/lib/x86_64-linux-gnu/ # libssw.so
 
 ### Installing from source
 
-When installing from source code using the following steps, the shared library `libssw.so` will be packed in the Ruby gem. In this case, the environment variable LIBSSWDIR is not required. (Only tested on Ubuntu)
+When installing from source code using the following steps, the shared library `libssw.so` or `libssw.dylib` will be packed in the Ruby gem. In this case, the environment variable `LIBSSWDIR` is not required. 
 
 ```sh
 git clone --recurse-submodules https://github.com/kojix2/ruby-libssw
-bundle exec rake libssw:compile
+bundle exec rake libssw:build
 bundle exec rake install
 ```
 
+ruby-libssw does not support Windows.
+
 ## Usage
 
 ```ruby
 require 'libssw'
 
-SSW = LibSSW
-
 ref_str  = "AAAAAAAAACGTTAAAAAAAAAA"
-ref_int  = SSW.dna_to_int_array(ref_str) 
+ref_int  = SSW::DNA.to_int_array(ref_str) 
 # [0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 2, 3, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]
 
 read_str1 = "ACGTT"
-read_str2 = SSW.dna_complement(read_str1)
-read_int1 = SSW.dna_to_int_array(read_str1)
+read_str2 = SSW::DNA.revcomp(read_str1)
+# "AACGT"
+read_int1 = SSW::DNA.to_int_array(read_str1)
 # [0, 1, 2, 3, 3]
-read_int2 = SSW.dna_to_int_array(read_str2)
+read_int2 = SSW::DNA.to_int_array(read_str2)
 # [0, 0, 1, 2, 3]
 
-mat = SSW.create_scoring_matrix(SSW::DNAElements, 2, -2)
+mat = SSW.create_scoring_matrix(SSW::DNA::Elements, 2, -2)
 # mat = [2, -2, -2, -2,  0,
 #       -2,  2, -2, -2,  0,
 #       -2, -2,  2, -2,  0,
 #       -2, -2, -2,  2,  0,
 #        0,  0,  0,  0,  0]
 
-profile1 = LibSSW.ssw_init(read_int1, mat)
-align1   = LibSSW.ssw_align(profile1, ref_int, 3, 1, 1, 0, 0, 15)
+profile1 = SSW.init(read_int1, mat)
+align1   = SSW.align(profile1, ref_int, 3, 1, 1, 0, 0)
 pp align1.to_h
 # {
 #  :score1       => 10,
@@ -73,8 +73,8 @@ pp align1.to_h
 #  :cigar_string => "5M"
 # }
 
-profile2 = LibSSW.ssw_init(read_int2, mat)
-align2     = LibSSW.ssw_align(profile2, ref_int, 3, 1, 1, 0, 0, 15)
+profile2 = SSW.init(read_int2, mat)
+align2   = SSW.align(profile2, ref_int, 3, 1, 1, 0, 0)
 pp align2.to_h
 # {
 #  :score1       => 10,
@@ -88,24 +88,65 @@ pp align2.to_h
 #  :cigar_len    => 1,
 #  :cigar_string => "5M"
 # }
-```
 
+puts SSW.build_path(read_str1, ref_str, align1)
+# 5M
+# ACGTT
+# |||||
+# ACGTT
+```
 
-## Documentation
-
-* [API Documentation](https://rubydoc.info/gems/libssw)
+## APIs
+
+See [API Documentation](https://rubydoc.info/gems/libssw).
+
+```markdown
+* SSW module
+  * SSW.init
+  * SSW.init_destroy
+  * SSW.align
+  * SSW.align_destroy
+  * SSW.mark_mismatch
+  * SSW.create_scoring_matrix
+  * SSW.build_path
+  
+  * Profile class
+    * attributes
+      * read, mat, read_len, n, bias
+
+  * Align class
+    * attributes
+      * score1, score2, ref_begin1, ref_end1, read_begin1, read_end1, ref_end2
+        cigar, cigar_len, cigar_string
+  
+  * DNA module
+    * DNA.to_int_array
+    * DNA.from_int_array
+    * revcomp
+
+  * AASeq module
+    * AASeq.to_int_array
+    * AASeq.from_int_array
+
+  * BLOSUM62
+  * BLOSUM50
+```
 
 ## Development
 
 ```sh
 git clone --recurse-submodules https://github.com/kojix2/ruby-libssw
-bundle exec rake libssw:compile
+bundle exec rake libssw:build
 bundle exec rake test
 ```
 
 ## Contributing
 
-Bug reports and pull requests are welcome on GitHub at https://github.com/kojix2/ruby-libssw.
+* [Report bugs](https://github.com/kojix2/ruby-libssw/issues)
+* Fix bugs and [submit pull requests](https://github.com/kojix2/ruby-libssw/pulls)
+* Write, clarify, or fix documentation
+* English corrections are welcome
+* Suggest or add new features
 
 ## License
 

data/lib/libssw.rb

@@ -1,10 +1,12 @@
 # frozen_string_literal: true
 
-require_relative 'libssw/version'
-require_relative 'libssw/BLOSUM50'
-require_relative 'libssw/BLOSUM62'
+require_relative 'ssw/version'
+require_relative 'ssw/BLOSUM50'
+require_relative 'ssw/BLOSUM62'
+require_relative 'ssw/dna'
+require_relative 'ssw/aaseq'
 
-module LibSSW
+module SSW
   class Error < StandardError; end
 
   class << self
@@ -26,67 +28,9 @@ module LibSSW
                    File.expand_path("../vendor/#{lib_name}", __dir__)
                  end
 
-  require_relative 'libssw/ffi'
-  require_relative 'libssw/profile'
-  require_relative 'libssw/align'
-
-  AAELEMENTS = ['A', 'R', 'N', 'D', 'C', 'Q', 'E', 'G',
-                'H', 'I', 'L', 'K', 'M', 'F', 'P', 'S',
-                'T', 'W', 'Y', 'V', 'B', 'Z', 'X', '*']
-
-  AA2INT = { 'A' => 0,  'a' => 0,
-             'R' => 1,  'r' => 1,
-             'N' => 2,  'n' => 2,
-             'D' => 3,  'd' => 3,
-             'C' => 4,  'c' => 4,
-             'Q' => 5,  'q' => 5,
-             'E' => 6,  'e' => 6,
-             'G' => 7,  'g' => 7,
-             'H' => 8,  'h' => 8,
-             'I' => 9,  'i' => 9,
-             'L' => 10, 'l' => 10,
-             'K' => 11, 'k' => 11,
-             'M' => 12, 'm' => 12,
-             'F' => 13, 'f' => 13,
-             'P' => 14, 'p' => 14,
-             'S' => 15, 's' => 15,
-             'T' => 16, 't' => 16,
-             'W' => 17, 'w' => 17,
-             'Y' => 18, 'y' => 18,
-             'V' => 19, 'v' => 19,
-             'B' => 20, 'b' => 20,
-             'Z' => 21, 'z' => 21,
-             'X' => 22, 'x' => 22,
-             '*' => 23 }
-
-  INT2AA = { 0 => 'A', 1 => 'R', 2 => 'N', 3 => 'D',
-             4 => 'C', 5 => 'Q', 6 => 'E', 7 => 'G',
-             8 => 'H', 9 => 'I', 10 => 'L', 11 => 'K',
-             12 => 'M', 13 => 'F', 14 => 'P', 15 => 'S',
-             16 => 'T', 17 => 'W', 18 => 'Y', 19 => 'V',
-             20 => 'B', 21 => 'Z', 22 => 'X', 23 => '*' }
-
-  DNAElements = %w[A C G T N]
-
-  DNA2INT = { 'A' => 0, 'a' => 0,
-              'C' => 1, 'c' => 1,
-              'G' => 2, 'g' => 2,
-              'T' => 3, 't' => 3,
-              'N' => 4, 'n' => 4 }
-
-  INT2DNA = { 0 => 'A', 1 => 'C', 2 => 'G', 3 => 'T', 4 => 'N' }
-
-  # reverse complement
-  DNARC = { 'A' => 'T',
-            'C' => 'G',
-            'G' => 'C',
-            'T' => 'A',
-            'N' => 'N',
-            'a' => 'T',
-            'c' => 'G',
-            'g' => 'C',
-            't' => 'A',
-            'n' => 'N' }
+  require_relative 'ssw/ffi'
+  require_relative 'ssw/profile'
+  require_relative 'ssw/align'
 
   class << self
     # Create the query profile using the query sequence.
@@ -99,10 +43,14 @@ module LibSSW
     #   * if your estimated best alignment score is surely < 255 please set 0;
     #   * if your estimated best alignment score >= 255, please set 1;
     #   * if you don't know, please set 2
-    def ssw_init(read, mat, n = nil, score_size: 2)
+    def init(read, mat, n = nil, score_size: 2)
+      read = read.to_a
+      mat = mat.to_a.flatten
+      raise ArgumentError, 'Expect class of read to be Array' unless read.is_a?(Array)
+      raise ArgumentError, 'Expect class of mat to be Array' unless mat.is_a?(Array)
+
       read_str = read.pack('c*')
       read_len = read.size
-      mat = mat.to_a.flatten
       n = Math.sqrt(mat.size) if n.nil?
       raise "Not a square matrix. size: #{mat.size}, n: #{n}" if mat.size != n * n
 
@@ -126,20 +74,24 @@ module LibSSW
       ptr.instance_variable_set(:@n,          n)
       ptr.instance_variable_set(:@score_size, score_size)
 
-      LibSSW::Profile.new(ptr)
+      SSW::Profile.new(ptr)
     end
 
     # Release the memory allocated by function ssw_init.
-    # @param p [Fiddle::Pointer, LibSSW::Profile, LibSSW::FFI::Profile]
+    # @param p [Fiddle::Pointer, SSW::Profile, SSW::FFI::Profile]
     #   pointer to the query profile structure
     # @note Ruby has garbage collection, so there is not much reason to call
     #   this method.
     def init_destroy(profile)
+      unless profile.is_a?(Fiddle::Pointer) || prof.is_a?(Profile) || prof.respond_to?(:to_ptr)
+        raise ArgumentError, 'Expect class of filename to be Profile or Pointer'
+      end
+
       FFI.init_destroy(profile)
     end
 
     # Do Striped Smith-Waterman alignment.
-    # @param prof [Fiddle::Pointer, LibSSW::Profile, LibSSW::FFI::Profile]
+    # @param prof [Fiddle::Pointer, SSW::Profile, SSW::FFI::Profile]
     #   pointer to the query profile structure
     # @param ref [Array]
     #   target sequence;
@@ -181,9 +133,15 @@ module LibSSW
     #   SSW C library masks the reference loci nearby (mask length = maskLen)
     #   the best alignment ending position and locates the second largest score
     #   from the unmasked elements.
-    def ssw_align(prof, ref, weight_gap0, weight_gapE, flag, filters, filterd, mask_len)
+    def align(prof, ref, weight_gap0, weight_gapE, flag, filters, filterd, mask_len = nil)
+      unless prof.is_a?(Fiddle::Pointer) || prof.is_a?(Profile) || prof.respond_to?(:to_ptr)
+        raise ArgumentError, 'Expect class of filename to be Profile or Pointer'
+      end
+      raise ArgumentError, 'Expect class of ref to be Array' unless ref.is_a?(Array)
+
       ref_str = ref.pack('c*')
       ref_len = ref.size
+      mask_len ||= [ref_len / 2, 15].max
       ptr = FFI.ssw_align(
         prof, ref_str, ref_len, weight_gap0, weight_gapE, flag, filters, filterd, mask_len
       )
@@ -192,14 +150,21 @@ module LibSSW
       # For example: instance_variable_set(:@ref_str, ref_str)
       #
       # ptr.free = FFI.instance_variable_get(:@func_map)['align_destroy']
-      LibSSW::Align.new(ptr)
+      SSW::Align.new(ptr)
     end
 
     # Release the memory allocated by function ssw_align.
-    # @param a [Fiddle::Pointer, LibSSW::Align, LibSSW::FFI::Align]
+    # @param a [Fiddle::Pointer, SSW::Align, SSW::FFI::Align]
     #   pointer to the alignment result structure
     def align_destroy(align)
-      FFI.align_destroy(align)
+      if align.is_a?(Align)
+        warn "You don't need to call this method for Ruby's Align class."
+        nil
+      elsif align.is_a?(Fiddle::Pointer) || align.respond_to?(:to_ptr)
+        FFI.align_destroy(align)
+      else
+        raise ArgumentError, 'Expect class of filename to be Pointer'
+      end
     end
 
     # 1. Calculate the number of mismatches.
@@ -231,17 +196,6 @@ module LibSSW
       )
     end
 
-    def array_to_cigar_string(arr)
-      cigar_string = String.new
-      arr.each do |x|
-        n = x >> 4
-        m = x & 15
-        c = m > 8 ? 'M' : 'MIDNSHP=X'[m]
-        cigar_string << n.to_s << c
-      end
-      cigar_string
-    end
-
     # Create scoring matrix of Smith-Waterman algrithum.
     # @param [Array] elements
     # @param [Integer] match_score
@@ -258,44 +212,37 @@ module LibSSW
       score
     end
 
-    # @param [String] seq
-    def dna_to_int_array(seq)
-      raise ArgumentError, 'seq must be a string' unless seq.is_a? String
-
-      seq.each_char.map do |base|
-        DNA2INT[base] || DNA2INT['N']
-      end
-    end
-
-    def dna_complement(seq)
-      seq.each_char.map do |base|
-        DNARC[base]
-      end.join.reverse
-    end
-
-    # @param [Array] int array
-    def int_array_to_dna(arr)
-      raise ArgumentError, 'arr must be an Array' unless arr.is_a? Array
-
-      arr.map do |i|
-        INT2DNA[i] || 'N'
-      end.join
-    end
-
-    def aaseq_to_int_array(seq)
-      raise ArgumentError, 'seq must be a string' unless seq.is_a? String
-
-      seq.each_char.map do |base|
-        AA2INT[base] || AA2INT['*']
+    # TODO: fix variable names
+    def build_path(q_seq, r_seq, align)
+      sQ = ''
+      sA = ''
+      sR = ''
+      q_off = align.read_begin1
+      r_off = align.ref_begin1
+      align.cigar.each do |x|
+        n = x >> 4
+        m = x & 15
+        c = m > 8 ? 'M' : 'MIDNSHP=X'[m]
+        case c
+        when 'M'
+          sQ += q_seq[q_off...(q_off + n)]
+          sA += Array.new(n) { |j| q_seq[q_off + j] == r_seq[r_off + j] ? '|' : '*' }.join
+          sR += r_seq[r_off...(r_off + n)]
+          q_off += n
+          r_off += n
+        when 'I'
+          sQ += q_seq[q_off...(q_off + n)]
+          sA += ' ' * n
+          sR += ' ' * n
+          q_off += n
+        when 'D'
+          sQ += ' ' * n
+          sA += ' ' * n
+          sR += r_seq[r_off...(r_off + n)]
+          r_off += n
+        end
       end
-    end
-
-    def int_array_to_aaseq(arr)
-      raise ArgumentError, 'arr must be an Array' unless arr.is_a? Array
-
-      arr.map do |i|
-        INT2AA[i] || '*'
-      end.join
+      [align.cigar_string, sQ, sA, sR]
     end
   end
 end

data/lib/{libssw → ssw}/BLOSUM50.rb

@@ -1,4 +1,4 @@
-module LibSSW
+module SSW
   BLOSUM50 = [
   #  A   R   N   D   C   Q   E   G   H   I   L   K   M   F   P   S   T   W   Y   V   B   Z   X   *
      5, -2, -1, -2, -1, -1, -1,  0, -2, -1, -2, -1, -1, -3, -1,  1,  0, -3, -2,  0, -2, -1, -1, -5, # A

data/lib/{libssw → ssw}/BLOSUM62.rb

@@ -1,4 +1,4 @@
-module LibSSW
+module SSW
   BLOSUM62 = [
   #  A   R   N   D   C   Q   E   G   H   I   L   K   M   F   P   S   T   W   Y   V   B   Z   X   *
      4, -1, -2, -2,  0, -1, -1,  0, -2, -1, -1, -1, -1, -2, -1,  1,  0, -3, -2,  0, -2, -1,  0, -4, # A

data/lib/ssw/aaseq.rb

@@ -0,0 +1,59 @@
+# frozen_string_literal: true
+
+module SSW
+  module AASeq
+    AAELEMENTS = ['A', 'R', 'N', 'D', 'C', 'Q', 'E', 'G',
+                  'H', 'I', 'L', 'K', 'M', 'F', 'P', 'S',
+                  'T', 'W', 'Y', 'V', 'B', 'Z', 'X', '*'].freeze
+
+    AA2INT = { 'A' => 0,  'a' => 0,
+               'R' => 1,  'r' => 1,
+               'N' => 2,  'n' => 2,
+               'D' => 3,  'd' => 3,
+               'C' => 4,  'c' => 4,
+               'Q' => 5,  'q' => 5,
+               'E' => 6,  'e' => 6,
+               'G' => 7,  'g' => 7,
+               'H' => 8,  'h' => 8,
+               'I' => 9,  'i' => 9,
+               'L' => 10, 'l' => 10,
+               'K' => 11, 'k' => 11,
+               'M' => 12, 'm' => 12,
+               'F' => 13, 'f' => 13,
+               'P' => 14, 'p' => 14,
+               'S' => 15, 's' => 15,
+               'T' => 16, 't' => 16,
+               'W' => 17, 'w' => 17,
+               'Y' => 18, 'y' => 18,
+               'V' => 19, 'v' => 19,
+               'B' => 20, 'b' => 20,
+               'Z' => 21, 'z' => 21,
+               'X' => 22, 'x' => 22,
+               '*' => 23 }.freeze
+
+    INT2AA = { 0 => 'A', 1 => 'R', 2 => 'N', 3 => 'D',
+               4 => 'C', 5 => 'Q', 6 => 'E', 7 => 'G',
+               8 => 'H', 9 => 'I', 10 => 'L', 11 => 'K',
+               12 => 'M', 13 => 'F', 14 => 'P', 15 => 'S',
+               16 => 'T', 17 => 'W', 18 => 'Y', 19 => 'V',
+               20 => 'B', 21 => 'Z', 22 => 'X', 23 => '*' }.freeze
+
+    module_function
+
+    def to_int_array(seq)
+      raise ArgumentError, 'seq must be a string' unless seq.is_a? String
+
+      seq.each_char.map do |base|
+        AA2INT[base] || AA2INT['*']
+      end
+    end
+
+    def from_int_array(arr)
+      raise ArgumentError, 'arr must be an Array' unless arr.is_a? Array
+
+      arr.map do |i|
+        INT2AA[i] || '*'
+      end.join
+    end
+  end
+end

data/lib/{libssw → ssw}/align.rb

@@ -1,6 +1,6 @@
 # frozen_string_literal: true
 
-module LibSSW
+module SSW
   # structure of the alignment result
   # @!attribute score1
   #   @return [Integer] the best alignment score
@@ -28,7 +28,9 @@ module LibSSW
   # @!attribute cigar_len
   #   @return [Integer]
   #     length of the cigar string; cigarLen = 0 when the best alignment path is not available
-  class Align < FFI::Align
+  # @!attribute cigar_string
+  #   @return [String] cigar string
+  class Align
     def self.keys
       %i[score1 score2 ref_begin1 ref_end1
          read_begin1 read_end1 ref_end2 cigar cigar_len cigar_string]
@@ -50,12 +52,25 @@ module LibSSW
       @cigar_len    = align.cigarLen
       @cigar        = cigar_len.positive? ? align.cigar[0, 4 * cigar_len].unpack('L*') : []
       # Attributes for ruby binding only
-      @cigar_string = LibSSW.array_to_cigar_string(@cigar)
-      LibSSW.align_destroy(ptr)
+      @cigar_string = array_to_cigar_string(@cigar)
+      SSW.align_destroy(ptr)
     end
 
     def to_h
       self.class.keys.map { |k| [k, __send__(k)] }.to_h
     end
+
+    private
+
+    def array_to_cigar_string(arr)
+      cigar_string = String.new
+      arr.each do |x|
+        n = x >> 4
+        m = x & 15
+        c = m > 8 ? 'M' : 'MIDNSHP=X'[m]
+        cigar_string << n.to_s << c
+      end
+      cigar_string
+    end
   end
 end

data/lib/ssw/dna.rb

@@ -0,0 +1,53 @@
+# frozen_string_literal: true
+
+module SSW
+  module DNA
+    Elements = %w[A C G T N].freeze
+
+    DNA2INT = { 'A' => 0, 'a' => 0,
+                'C' => 1, 'c' => 1,
+                'G' => 2, 'g' => 2,
+                'T' => 3, 't' => 3,
+                'N' => 4, 'n' => 4 }.freeze
+
+    INT2DNA = { 0 => 'A', 1 => 'C', 2 => 'G', 3 => 'T', 4 => 'N' }.freeze
+
+    # reverse complement
+    DNARC = { 'A' => 'T',
+              'C' => 'G',
+              'G' => 'C',
+              'T' => 'A',
+              'N' => 'N',
+              'a' => 'T',
+              'c' => 'G',
+              'g' => 'C',
+              't' => 'A',
+              'n' => 'N' }.freeze
+
+    module_function
+
+    # @param [String] seq
+    def to_int_array(seq)
+      raise ArgumentError, 'seq must be a string' unless seq.is_a? String
+
+      seq.each_char.map do |base|
+        DNA2INT[base] || DNA2INT['N']
+      end
+    end
+
+    # @param [Array] int array
+    def from_int_array(arr)
+      raise ArgumentError, 'arr must be an Array' unless arr.is_a? Array
+
+      arr.map do |i|
+        INT2DNA[i] || 'N'
+      end.join
+    end
+
+    def revcomp(seq)
+      seq.each_char.map do |base|
+        DNARC[base]
+      end.join.reverse
+    end
+  end
+end

data/lib/{libssw → ssw}/ffi.rb

@@ -2,12 +2,12 @@
 
 require 'fiddle/import'
 
-module LibSSW
+module SSW
   module FFI
     extend Fiddle::Importer
 
     begin
-      dlload LibSSW.ffi_lib
+      dlload SSW.ffi_lib
     rescue LoadError => e
       raise LoadError, "Could not find libssw shared library. \n#{e}"
     end

data/lib/{libssw → ssw}/profile.rb

@@ -1,13 +1,13 @@
 # frozen_string_literal: true
 
-module LibSSW
+module SSW
   # structure of the query profile/usr/lib/x86_64-linux-gnu/
   # @!attribute read
   # @!attribute mat
   # @!attribute read_len
   # @!attribute n
   # @!attribute bias
-  class Profile < FFI::Profile
+  class Profile
     def self.keys
       %i[read mat read_len n bias]
     end
@@ -17,7 +17,7 @@ module LibSSW
 
     def initialize(ptr)
       @ptr      = ptr
-      @cstruct  = profile = LibSSW::FFI::Profile.new(ptr)
+      @cstruct  = profile = SSW::FFI::Profile.new(ptr)
       @read_len = profile.readLen
       @read     = read_len.positive? ? profile.read[0, read_len].unpack('c*') : []
       @n        = profile.n

data/lib/{libssw → ssw}/version.rb

@@ -1,5 +1,5 @@
 # frozen_string_literal: true
 
-module LibSSW
-  VERSION = '0.0.2'
+module SSW
+  VERSION = '0.0.3'
 end

metadata

@@ -1,14 +1,14 @@
 --- !ruby/object:Gem::Specification
 name: libssw
 version: !ruby/object:Gem::Version
-  version: 0.0.2
+  version: 0.0.3
 platform: ruby
 authors:
 - kojix2
 autorequire: 
 bindir: exe
 cert_chain: []
-date: 2021-01-22 00:00:00.000000000 Z
+date: 2021-03-05 00:00:00.000000000 Z
 dependencies:
 - !ruby/object:Gem::Dependency
   name: fiddle
@@ -120,12 +120,15 @@ files:
 - README.md
 - exe/rbssw
 - lib/libssw.rb
-- lib/libssw/BLOSUM50.rb
-- lib/libssw/BLOSUM62.rb
-- lib/libssw/align.rb
-- lib/libssw/ffi.rb
-- lib/libssw/profile.rb
-- lib/libssw/version.rb
+- lib/ssw/BLOSUM50.rb
+- lib/ssw/BLOSUM62.rb
+- lib/ssw/aaseq.rb
+- lib/ssw/align.rb
+- lib/ssw/dna.rb
+- lib/ssw/ffi.rb
+- lib/ssw/profile.rb
+- lib/ssw/version.rb
+- vendor/libssw.so
 homepage: https://github.com/kojix2/ruby-libssw
 licenses:
 - MIT