genomer-plugin-validate 0.0.1

data/.gitignore

@@ -0,0 +1,4 @@
+*.gem
+.bundle
+Gemfile.lock
+pkg/*

data/Gemfile

@@ -0,0 +1,4 @@
+source "http://rubygems.org"
+
+# Specify your gem's dependencies in genomer-plugin-validate.gemspec
+gemspec

data/Rakefile

@@ -0,0 +1,9 @@
+require "bundler/gem_tasks"
+
+require 'rspec/core'
+require 'rspec/core/rake_task'
+RSpec::Core::RakeTask.new(:spec) do |spec|
+  spec.pattern = FileList['spec/**/*_spec.rb']
+end
+
+task :default => :spec

data/VERSION

@@ -0,0 +1 @@
+0.0.1

data/features/annotations/bad-product-field.feature

@@ -0,0 +1,91 @@
+Feature: Validating annotation files for bad product fields
+  In order to submit genome annotations
+  A user can use the "annotation" command to find bad product fields
+  to ensure that their annotation file contains valid product information
+
+  Scenario Outline: Validating an annotations file with bad product fields
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAA
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	3	4	.	+	1	ID=gene1;product=<product>
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations`
+     Then the exit status should be 0
+      And the output should contain:
+     """
+     Bad product field for 'gene1:' <correction>
+     """
+    Examples:
+       | product              | correction                                        |
+       | hypothetical thing   | start with 'putative' instead of 'hypothetical.'  |
+       | Hypothetical thing   | start with 'putative' instead of 'hypothetical.'  |
+       | something like       | products ending with 'like' are not allowed.      |
+       | something like.      | products ending with 'like' are not allowed.      |
+       | something-like       | products ending with 'like' are not allowed.      |
+       | something Like       | products ending with 'like' are not allowed.      |
+       | something domain     | products ending with 'domain' are not allowed.    |
+       | something-domain     | products ending with 'domain' are not allowed.    |
+       | something domain.    | products ending with 'domain' are not allowed.    |
+       | something Domain     | products ending with 'domain' are not allowed.    |
+       | something-related    | products ending with 'related' are not allowed.   |
+       | something related    | products ending with 'related' are not allowed.   |
+       | something related.   | products ending with 'related' are not allowed.   |
+       | something Related    | products ending with 'related' are not allowed.   |
+       | something n-term     | 'N-terminal' or variations are not allowed.       |
+       | something N-term     | 'N-terminal' or variations are not allowed.       | 
+       | something N-terminal | 'N-terminal' or variations are not allowed.       |
+       | something n-terminal | 'N-terminal' or variations are not allowed.       |
+       | SOMETHING            | all caps product fields are not allowed.          |
+       | SOMETHING PROTEIN    | all caps product fields are not allowed.          |
+       | SOMETHING-PROTEIN    | all caps product fields are not allowed.          |
+
+  Scenario Outline: Validating an annotations file with acceptable product fields
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAA
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	3	4	.	+	1	ID=gene1;product=<product>
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations`
+     Then the exit status should be 0
+      And the output should not contain "gene1"
+    Examples:
+       | product                   |
+       | hypothetical protein      |
+       | hypothetical protein.     |
+       | Hypothetical protein      |
+       | Hypothetical protein.     |
+       | transcription termination |

data/features/annotations/command-line-interface.feature

@@ -0,0 +1,19 @@
+Feature: The validate annotations command line interface
+  In order to generate correct genome annotation files
+  A user can use the "validator" plugin at the command line
+  to validate their annotations
+
+  @disable-bundler
+  Scenario: Running with just the 'validate' command
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate`
+     Then the exit status should be 0
+      And the output should contain:
+      """
+        annotations    Validate GFF3 annotations file
+      """

data/features/annotations/duplicate_id.feature

@@ -0,0 +1,144 @@
+Feature: Validating annotation files for duplicate IDs
+  In order to submit genome annotations
+  A user can use the "annotation" command to detect duplicate IDs
+  to ensure that their annotation file contains no errors
+
+  @disable-bundler
+  Scenario: No duplicate IDs
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAATTTTTGGGGGCCCCC
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	1	3	.	+	1	ID=gene1
+        contig1	.	gene	4	6	.	+	1	ID=gene2
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations`
+     Then the exit status should be 0
+      And the output should not contain:
+        """
+        Duplicate ID
+        """
+
+  @disable-bundler
+  Scenario: Two duplicate IDs
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAATTTTTGGGGGCCCCC
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	1	3	.	+	1	ID=gene1
+        contig1	.	gene	4	6	.	+	1	ID=gene1
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations`
+     Then the exit status should be 0
+      And the output should contain:
+        """
+        Duplicate ID 'gene1'
+        """
+
+  @disable-bundler
+  Scenario: Multiple duplicate IDs
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAATTTTTGGGGGCCCCC
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	1	3	.	+	1	ID=gene1;Name=abc
+        contig1	.	gene	4	6	.	+	1	ID=gene1;Name=abc
+        contig1	.	gene	7	9	.	+	1	ID=gene2;Name=abc
+        contig1	.	gene	10	12	.	+	1	ID=gene2;Name=abc
+        contig1	.	gene	13	15	.	+	1	ID=gene3;Name=abc
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations`
+     Then the exit status should be 0
+      And the output should not contain "gene3"
+      And the output should contain:
+        """
+        Duplicate ID 'gene1'
+        Duplicate ID 'gene2'
+        """
+
+  @disable-bundler
+  Scenario: Two duplicate IDs and a annotations with missing IDs
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAATTTTTGGGGGCCCCC
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	1	3	.	+	1	ID=gene1
+        contig1	.	gene	4	6	.	+	1	ID=gene1
+        contig1	.	gene	7	9	.	+	1	
+        contig1	.	gene	10	12	.	+	1	
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations`
+     Then the exit status should be 0
+      And the output should contain:
+        """
+        Duplicate ID 'gene1'
+        """
+      And the output should not contain:
+        """
+        Duplicate ID ''
+        """
+

data/features/annotations/identical_locations.feature

@@ -0,0 +1,74 @@
+Feature: Validating annotation files for identical locations
+  In order to submit genome annotations
+  A user can use the "annotation" command to detect identical locations
+  to ensure that their annotation file contains no errors
+
+  @disable-bundler
+  Scenario: Validating an annotations file with two identical locations
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAATTTTTGGGGGCCCCC
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	1	3	.	+	1	ID=gene1
+        contig1	.	gene	1	3	.	+	1	ID=gene2
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations`
+     Then the exit status should be 0
+      And the output should contain:
+        """
+        Identical locations for 'gene1', 'gene2'
+
+        """
+
+  @disable-bundler
+  Scenario: Validating an annotations file with two sets of identical locations
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAATTTTTGGGGGCCCCC
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	1	3	.	+	1	ID=gene1
+        contig1	.	gene	1	3	.	+	1	ID=gene2
+        contig1	.	gene	4	6	.	+	1	ID=gene3
+        contig1	.	gene	4	6	.	+	1	ID=gene4
+        contig1	.	gene	7	9	.	+	1	ID=gene5
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations`
+     Then the exit status should be 0
+      And the output should contain:
+        """
+        Identical locations for 'gene1', 'gene2'
+        Identical locations for 'gene3', 'gene4'
+
+        """

data/features/annotations/incorrect-attributes.feature

@@ -0,0 +1,135 @@
+Feature: Validating annotation files for incorrect attributes
+  In order to submit genome annotations
+  A user can use the "annotation" command to detect incorrect attributes
+  to ensure that their annotation file contains no errors
+
+  Scenario Outline: Validating an annotations file with known GFF attributes
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAATTTTTGGGGGCCCCCAAAAATTTTTGGGGGCCCCC
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	3	4	.	+	1	ID=gene1;Name=gene1;<attribute>=abc
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations`
+     Then the exit status should be 0
+      And the output should not contain "gene1"
+    Examples:
+       | attribute     |
+       | Alias         |
+       | Parent        |
+       | Target        |
+       | Gap           |
+       | Derives_from  |
+       | Note          |
+       | Dbxref        |
+       | Ontology_term |
+       | Is_circular   |
+
+  Scenario Outline: Validating an annotations file with known genomer-plugin-view attributes
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAATTTTTGGGGGCCCCCAAAAATTTTTGGGGGCCCCC
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	3	4	.	+	1	ID=gene1;Name=gene1;<attribute>=abc
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations`
+     Then the exit status should be 0
+      And the output should not contain "gene1"
+    Examples:
+        | attribute    |
+        | product      |
+        | function     |
+        | ec_number    |
+        | feature_type |
+
+  Scenario: Validating an annotations file with unknown GFF3 attributes
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAATTTTTGGGGGCCCCCAAAAATTTTTGGGGGCCCCC
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	3	4	.	+	1	ID=gene1;Name=abc;Unknown_term=something
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations`
+     Then the exit status should be 0
+      And the output should contain:
+        """
+        Illegal GFF3 attribute 'Unknown_term' for 'gene1'
+        """
+
+  Scenario: Validating an annotations file with unknown genomer-plugin-view attributes
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAATTTTTGGGGGCCCCCAAAAATTTTTGGGGGCCCCC
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+        contig1	.	gene	3	4	.	+	1	ID=gene1;Name=abc;unknown_lowercase_term=something
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-validate', :path => '../../../'
+        """
+     When I run `genomer validate annotations --validate_for_view`
+     Then the exit status should be 0
+      And the output should contain:
+        """
+        Illegal view attribute 'unknown_lowercase_term' for 'gene1'
+        """