genevalidatorapp 1.4.13 → 1.5.0

data/lib/genevalidatorapp/routes.rb

@@ -0,0 +1,81 @@
+require 'sinatra/base'
+require 'sinatra/cross_origin'
+require 'genevalidator/version'
+require 'genevalidatorapp/version'
+require 'slim'
+
+module GeneValidatorApp
+  # The Sinatra Routes
+  class Routes < Sinatra::Base
+    register Sinatra::CrossOrigin
+
+    configure do
+      # We don't need Rack::MethodOverride. Let's avoid the overhead.
+      disable :method_override
+
+      # Ensure exceptions never leak out of the app. Exceptions raised within
+      # the app must be handled by the app. We do this by attaching error
+      # blocks to exceptions we know how to handle and attaching to Exception
+      # as fallback.
+      disable :show_exceptions, :raise_errors
+
+      # Make it a policy to dump to 'rack.errors' any exception raised by the
+      # app so that error handlers don't have to do it themselves. But for it
+      # to always work, Exceptions defined by us should not respond to `code`
+      # or http_status` methods. Error blocks errors must explicitly set http
+      # status, if needed, by calling `status` method.
+      enable :dump_errors
+
+      # We don't want Sinatra do setup any loggers for us. We will use our own.
+      set :logging, nil
+
+      # This is the app root...
+      set :root,          lambda { GeneValidatorApp.root }
+
+      # This is the full path to the public folder...
+      set :public_folder, lambda { GeneValidatorApp.public_dir }
+    end
+
+    # Set up global variables for the templates...
+    before '/' do
+      @default_db         = Database.default_db
+      @non_default_dbs    = Database.non_default_dbs
+      @max_characters     = GeneValidatorApp.config[:max_characters]
+      @current_gv_version = GeneValidator::VERSION
+    end
+
+    get '/' do
+      slim :index
+    end
+
+    post '/' do
+      cross_origin # Required for the API to work...
+      RunGeneValidator.init(request.url, params)
+      @json_results = RunGeneValidator.run
+      slim :results, layout: false
+    end
+
+    # This error block will only ever be hit if the user gives us a funny
+    # sequence or incorrect advanced parameter. Well, we could hit this block
+    # if someone is playing around with our HTTP API too.
+    error RunGeneValidator::ArgumentError do
+      status 400
+      slim :"500", layout: false
+    end
+
+    # This will catch any unhandled error and some very special errors. Ideally
+    # we will never hit this block. If we do, there's a bug in GeneValidatorApp
+    # or something really weird going on.
+    # TODO: If we hit this error block we show the stacktrace to the user
+    # requesting them to post the same to our Google Group.
+    error Exception, RunGeneValidator::RuntimeError do
+      status 500
+      slim :"500", layout: false
+    end
+
+    not_found do
+      status 404
+      slim :"500" # TODO: Create another Template
+    end
+  end
+end

data/lib/genevalidatorapp/server.rb

@@ -0,0 +1,63 @@
+require 'rack/handler/webrick'
+
+module GeneValidatorApp
+  # Simple wrapper around WEBrick and Rack::Handler::WEBrick to host
+  # GeneValidatorApp standalone.
+  class Server
+    class << self
+      def run(*args)
+        new(*args).start
+      end
+    end
+
+    def initialize(app)
+      @app = app
+    end
+
+    attr_reader :app
+
+    # Start server. Raises Errno::EADDRINUSE if port is in use by another
+    # process. Raises Errno::EACCES if binding to the port requires root
+    # privilege.
+    def start
+      setup_signal_handlers
+      @server = WEBrick::HTTPServer.new(options)
+      @server.mount '/', Rack::Handler::WEBrick, app
+      @server.start
+    end
+
+    # Stop server.
+    def stop
+      @server.shutdown
+    end
+
+    # Options Hash passed to WEBrick::HTTPServer.
+    # rubocop:disable Metrics/AbcSize
+    def options
+      @options ||= {
+        :BindAddress      => app.config[:host],
+        :Port             => app.config[:port],
+        :StartCallback    => proc { app.on_start },
+        :StopCallback     => proc { app.on_stop  },
+        :OutputBufferSize => 5,
+        :AccessLog        => [[logdev, WEBrick::AccessLog::COMMON_LOG_FORMAT]],
+        :Logger           => WEBrick::Log.new(logdev)
+      }
+    end
+    # rubocop:enable Metrics/AbcSize
+
+    private
+
+    def setup_signal_handlers
+      [:INT, :TERM].each do |sig|
+        trap sig do
+          stop
+        end
+      end
+    end
+
+    def logdev
+      @logdev ||= app.verbose? ? STDERR : '/dev/null'
+    end
+  end
+end

data/lib/{GeneValidatorApp → genevalidatorapp}/version.rb

@@ -1,3 +1,3 @@
 module GeneValidatorApp
-  VERSION = '1.4.13'
+  VERSION = '1.5.0'
 end

data/public/{web_files → src}/css/custom.css

@@ -6,7 +6,7 @@ html {
 }
 
 body {
-  margin: 0; 
+  margin: 0;
   margin-top: 60px;
   background-color:#F5F5F5;
 }
@@ -175,7 +175,7 @@ table .danger,
 .table .danger,
 table .info,
 .table .info {
-  color: #333;  
+  color: #333;
 }
 
 .table-bordered {
@@ -245,11 +245,11 @@ table .info,
 .table-bordered>tbody>tr>td,
 .table-bordered>tfoot>tr>td {
   border:none;
-} 
+}
 
 .table-bordered>tbody>tr {
   border-bottom: 2px solid #DDD;
-} 
+}
 
 .error_header {
   margin-top: 10px;
@@ -291,11 +291,6 @@ tr {
   text-align: center;
 }
 
-/* table striped backgrounds ___________*/
-
-/*tbody > tr:nth-child(4n+1), tbody > tr:nth-child(4n+2) {
-}
-*/
 /* table sorter ___________*/
 
 
@@ -337,7 +332,7 @@ tr {
 .table tbody td.success,
 .table tbody td.danger,
 .table tbody td.warning {
-  padding-left:30px !important; 
+  padding-left:30px !important;
   position:relative;
 }
 
@@ -390,7 +385,7 @@ ___________________________*/
     border-right:5px solid transparent;
     border-top:5px solid #CCC
 }
-  
+
 /* D3Js & Axis
 ___________________________*/
 .axis path,
@@ -490,7 +485,7 @@ ___________________________*/
     float:right !important;
     margin-top: -43px;
   }
-  
+
   .show_examples_text {
     text-align: left;
   }
@@ -501,7 +496,7 @@ ___________________________*/
 }
 
 
-/* Browser Specific 
+/* Browser Specific
 ___________________________*/
 
 /* Border on Stars ________*/

data/public/{web_files → src}/js/genevalidator.js

@@ -4,6 +4,7 @@ $(document).ready(function() {
   keepFooterFixedToBottom();
   addSeqValidation();
   inputValidation();
+  bindTdClicks();
 
   $(document).bind('keydown', function (e) {
     if (e.ctrlKey && e.keyCode === 13 ) {
@@ -12,9 +13,9 @@ $(document).ready(function() {
   });
 });
 
-// Looks for a cookie (called 'GeneValidator_adv_params_status') to check the state of the adv_params box when it was last closed. 
-//  This function is called upon as soon as the website is loaded;  
-function checkCollapseState() {
+// Looks for a cookie (called 'GeneValidator_adv_params_status') to check the state of the adv_params box when it was last closed.
+//  This function is called upon as soon as the website is loaded;
+var checkCollapseState = function () {
   'use strict';
   if ($.cookie('GeneValidator_adv_params_status')){
     var adv_params_status = $.cookie('GeneValidator_adv_params_status');
@@ -24,25 +25,26 @@ function checkCollapseState() {
       $('#adv_params').addClass('in');
     }
   }
-}
+};
 
 // This function simply ensures that the footer stays to fixed to the bottom of the window
-function keepFooterFixedToBottom() {
+var keepFooterFixedToBottom = function () {
   'use strict';
   $('#mainbody').css({'margin-bottom': (($('#footer').height()) + 15)+'px'});
   $(window).resize(function(){
       $('#mainbody').css({'margin-bottom': (($('#footer').height()) + 15)+'px'});
   });
-}
+};
 
 // Creates a custom Validation for Jquery Validation plugin...
 // It ensures that sequences are either protein or DNA data...
 // If there are multiple sequences, ensures that they are of the same type
 // It utilises the checkType function (further below)...
-function addSeqValidation() {
+var addSeqValidation = function () {
   'use strict';
   jQuery.validator.addMethod('checkInputType', function(value, element) {
-    var types = [];
+    var types = [],
+        type  = '';
     if (value.charAt(0) === '>') {
       var seqs_array = value.split('>');
       for (var i = 1; i < seqs_array.length; i++) {
@@ -52,13 +54,13 @@ function addSeqValidation() {
           if (clean_lines.length !== 0){
             clean_lines.shift();
             var seq = clean_lines.join('');
-            var type = checkType(seq, 0.9);
+            type = checkType(seq, 0.9);
             types.push(type);
             if ((type !== 'protein') && (type !== 'dna') && (type !== 'rna')) {
               return false;
             }
           }
-        } 
+        }
       }
       var firstType = types[0];
       for (var j = 0; j < types.length; j++) {
@@ -68,7 +70,7 @@ function addSeqValidation() {
       }
       return true;
     } else {
-      var type = checkType(value, 0.9);
+      type = checkType(value, 0.9);
       if ((type !== 'protein') && (type !== 'dna') && (type !== 'rna')) {
         return false;
       } else {
@@ -76,11 +78,11 @@ function addSeqValidation() {
       }
     }
   }, '* The Input must be either DNA or protein sequence(s). Please ensure that your sequences do not contains any non-letter character(s). If there are multiple sequences, ensure that they are all of one type. ');
-}
+};
 
 
 // A function that validates the input - Utilises Jquery.Validator.js
-function inputValidation() {
+var inputValidation = function () {
   'use strict';
   var maxCharacters = $('#seq').attr('data-maxCharacters'); // returns a number or undefined
   $('#input').validate({
@@ -123,10 +125,22 @@ function inputValidation() {
       ajaxFunction();
     }
   });
-}
+};
+
+var bindTdClicks = function () {
+  $( document ).on( "click", "td, .plot_btn", function( event ) {
+      if ($(this).hasClass('success') || $(this).hasClass('danger')){
+        var title = $(this).attr('title');
+        var val = title.replace(/[ \/]/g, '');
+        GV.addData(this, val);
+      } else if ($(this).hasClass('plot_btn')){
+        GV.addData(this, 'all');
+      }
+  });
+};
 
 // Sends the data within the form to the Server
-function ajaxFunction() {
+var ajaxFunction = function () {
   'use strict';
   $.ajax({
     type: 'POST',
@@ -135,15 +149,15 @@ function ajaxFunction() {
     success: function(response){
       $('#results_box').show();
       $('#output').html(response);
+      GV.toggleOverviewBtn(); // add overview info from JSON
       initTableSorter(); // initiate the table sorter
       $("[data-toggle='tooltip']").tooltip(); // Initiate the tooltips
-      removeEmptyColumns(); // Remove Unwanted Columns
 
       $('#mainbody').css({'background-color': '#fff'});
       $('#search').css({'background-color': '#F5F5F5'});
       $('#results').css({'border-top': '3px solid #DBDBDB'});
       $('#search').css({'margin-bottom': '0'});
-      
+
       $('#spinner').modal('hide'); // remove progress notification
     },
     error: function (e, status) {
@@ -161,11 +175,11 @@ function ajaxFunction() {
       }
     }
   });
-}
+};
 
-//  Table sortert Initialiser 
-//   Contains a custom parser that allows the Stars to be sorted. 
-function initTableSorter() {
+//  Table sortert Initialiser
+//   Contains a custom parser that allows the Stars to be sorted.
+var initTableSorter = function () {
   'use strict';
   $.tablesorter.addParser({
     id: 'star_scores',
@@ -174,7 +188,7 @@ function initTableSorter() {
       var $cell = $(cell);
       if (cellIndex === 1) {
         return $cell.attr('data-score') || s;
-      } 
+      }
       return s;
     },
     parsed: false,
@@ -187,29 +201,10 @@ function initTableSorter() {
     },
     sortList: [[0,0]],
   });
-}
-
-// Remove empty colums that are not used for that type of input data...
-function removeEmptyColumns() {
-  'use strict';
-  $('#sortable_table tr th').each(function(i) {
-    var tds = $(this).parents('table') // Select all tds in column
-    .find('tr td:nth-child(' + (i + 1) + ')');
-    // Check if all cells in the column are empty
-    if ($(this).hasClass( 'chart-column' )) {
-    } else {
-      if ($(this).text().trim() == '') { 
-        //hide header
-        $(this).hide();
-        //hide cells
-        tds.hide();
-      }
-    }
-  });
-}
+};
 
 // Function is called each time the Adv. Params button is pressed...
-function changeAdvParamsBtnText() {
+var changeAdvParamsBtnText = function () {
   'use strict';
   var btn = document.getElementById('adv_params_btn');
   if (btn.innerHTML === '<i class="fa fa-pencil-square-o"></i>&nbsp;&nbsp;Show Advanced Parameters') {
@@ -222,10 +217,10 @@ function changeAdvParamsBtnText() {
     $('#adv_params').collapse('hide');
     $.cookie('GeneValidator_adv_params_status', 'closed');
   }
-}
+};
 
 // Changes the input to an examplar dna or protein sequence...
-function examplarSequence(type){
+var examplarSequence = function (type){
   'use strict';
   var dna = '>Insulin\n' +
                 'ATGGCTCTCTGGATCCGGTCGCTGCCTCTCCTGGCCCTTCTTGCTCTTTCTGGCCCTGGGATCAGCCACGCAGCTGCCAACCAGCACCTCTGTGGCTCCCACTTGGTTGAGGCTCTCTACCTGGTGTGTGGGGAGCGGGGTTTCTTCTACTCCCCCAAAACACGGCGGGACGTTGAGCAGCCTCTAGTGAACGGTCCCCTGCATGGCGAGGTGGGAGAGCTGCCGTTCCAGCATGAGGAATACCAGAAAGTCAAGCGAGGCATCGTTGAGCAATGCTGTGAAAACCCGTGCTCCCTCTACCAACTGGAAAACTACTGCAACTAG\n' +
@@ -241,11 +236,11 @@ function examplarSequence(type){
   } else if (type === 'protein') {
     document.getElementById('seq').value = protein;
   }
-}
+};
 
 // FROM BIONODE-Seq - See https://github.com/bionode/bionode-seq
 // Checks whether a sequence is a protein or dna sequence...
-function checkType(sequence, threshold, length, index) {
+var checkType = function (sequence, threshold, length, index) {
   'use strict';
   if (threshold === undefined) {
     threshold = 0.9;
@@ -263,7 +258,7 @@ function checkType(sequence, threshold, length, index) {
   var acgMatch = ((dnaSeq.match(/[ACG]/gi) || []).length) / dnaTotal;
   var tMatch = ((dnaSeq.match(/[T]/gi) || []).length) / dnaTotal;
   var uMatch = ((dnaSeq.match(/[U]/gi) || []).length) / dnaTotal;
-  
+
   var proteinSeq = seq.replace(/X/gi,'');
   var proteinTotal = proteinSeq.length;
   var proteinMatch = ((seq.match(/[ARNDCQEGHILKMFPSTWYV\*]/gi) || []).length) / proteinTotal;
@@ -279,4 +274,4 @@ function checkType(sequence, threshold, length, index) {
   } else if (proteinMatch >= threshold) {
     return 'protein';
   }
-}
+};