genevalidator 1.6.2 → 1.6.3

data/lib/genevalidator/validation_length_cluster.rb

@@ -97,8 +97,7 @@ module GeneValidator
     # +LengthClusterValidationOutput+ object
     def run
       fail NotEnoughHitsError unless hits.length >= 5
-      fail Exception unless prediction.is_a?(Sequence) &&
-                            hits[0].is_a?(Sequence)
+      fail unless prediction.is_a?(Query) && hits[0].is_a?(Query)
 
       start = Time.now
       # get [clusters, max_density_cluster_idx]
@@ -125,7 +124,7 @@ module GeneValidator
       @validation_report = ValidationReport.new('Not enough evidence', :warning,
                                                 @short_header, @header,
                                                 @description)
-    rescue Exception
+    rescue
       @validation_report = ValidationReport.new('Unexpected error', :error,
                                                 @short_header, @header,
                                                 @description)
@@ -136,16 +135,15 @@ module GeneValidator
     # Clusterization by length from a list of sequences
     # Params:
     # +debug+ (optional):: true to display debug information, false by default
-    # +lst+:: array of +Sequence+ objects
-    # +predicted_seq+:: +Sequence+ objetc
+    # +lst+:: array of +Query+ objects
+    # +predicted_seq+:: +Query+ objetc
     # Output
     # output 1:: array of Cluster objects
     # output 2:: the index of the most dense cluster
     def clusterization_by_length(_debug = false,
                                  lst = @hits,
                                  predicted_seq = @prediction)
-      fail TypeError unless lst[0].is_a?(Sequence) &&
-                            predicted_seq.is_a?(Sequence)
+      fail TypeError unless lst[0].is_a?(Query) && predicted_seq.is_a?(Query)
 
       contents = lst.map { |x| x.length_protein.to_i }.sort { |a, b| a <=> b }
 
@@ -179,10 +177,9 @@ module GeneValidator
     # +prediction+: +Sequence+ object
     # Output:
     # +Plot+ object
-    def plot_histo_clusters(output = "#{@plot_path}_len_clusters.json",
-                          clusters = @clusters,
-                          max_density_cluster = @max_density_cluster,
-                          prediction = @prediction)
+    def plot_histo_clusters(clusters = @clusters,
+                            max_density_cluster = @max_density_cluster,
+                            prediction = @prediction)
 
       data = clusters.each_with_index.map { |cluster, i|
         cluster.lengths.collect { |k, v|

data/lib/genevalidator/validation_length_rank.rb

@@ -44,7 +44,7 @@ module GeneValidator
     end
 
     def explain
-      diff = (@query_length < @median) ? 'longer' : 'shorter'
+      diff = (@query_length > @median) ? 'longer' : 'shorter'
       exp1 = "The query sequence is  #{@query_length} amino-acids long. BLAST" \
              " identified #{@no_of_hits} hit sequences with lengths from" \
              " #{@smallest_hit} to #{@largest_hit} amino-acids (median:" \
@@ -105,11 +105,12 @@ module GeneValidator
     # +LengthRankValidationOutput+ object
     def run(hits = @hits, prediction = @prediction)
       fail NotEnoughHitsError unless hits.length >= 5
-      fail Exception unless prediction.is_a?(Sequence) && hits[0].is_a?(Sequence)
+      fail unless prediction.is_a?(Query) && hits[0].is_a?(Query)
 
       start = Time.now
 
-      hits_lengths = hits.map { |x| x.length_protein.to_i }.sort { |a, b| a <=> b }
+      hits_lengths = hits.map { |x| x.length_protein.to_i }
+                     .sort { |a, b| a <=> b }
 
       no_of_hits   = hits_lengths.length
       median       = hits_lengths.median.round
@@ -151,7 +152,7 @@ module GeneValidator
       @validation_report = ValidationReport.new('Not enough evidence', :warning,
                                                 @short_header, @header,
                                                 @description)
-    rescue Exception
+    rescue
       @validation_report = ValidationReport.new('Unexpected error', :error,
                                                 @short_header, @header,
                                                 @description)

data/lib/genevalidator/validation_open_reading_frame.rb

@@ -91,7 +91,7 @@ module GeneValidator
         return @validation_report
       end
 
-      fail Exception unless prediction.is_a?(Sequence)
+      fail unless prediction.is_a?(Query)
 
       start = Time.new
       orfs = get_orfs
@@ -109,7 +109,7 @@ module GeneValidator
 
       @validation_report.plot_files.push(plot1)
       @validation_report
-    rescue Exception
+    rescue
       @validation_report = ValidationReport.new('Unexpected error', :error,
                                                 @short_header, @header,
                                                 @description)
@@ -160,7 +160,7 @@ module GeneValidator
     # +orfs+: +Hash+ containing the open reading frame
     # +output+: location where the plot will be saved in jped file format
     # +prediction+: Sequence objects
-    def plot_orfs(orfs, translated_length, output = "#{@plot_path}_orfs.json")
+    def plot_orfs(orfs, translated_length)
       fail QueryError unless orfs.is_a? Hash
 
       data = []
@@ -169,13 +169,13 @@ module GeneValidator
       (-3..3).each do |frame|
         next if frame == 0
         data << { 'y' => frame, 'start' => 1, 'stop' => translated_length,
-                     'color' => 'gray' }
+                  'color' => 'gray' }
       end
 
       # Create the hashes for the ORFs...
       orfs.each do |_key, h|
         data << { 'y' => h[:frame], 'start' => h[:orf_start],
-                     'stop' => h[:orf_end], 'color' => 'red' }
+                  'stop' => h[:orf_end], 'color' => 'red' }
       end
 
       Plot.new(data,

data/lib/genevalidator/version.rb

@@ -1,3 +1,3 @@
 module GeneValidator
-  VERSION = '1.6.2'
+  VERSION = '1.6.3'
 end

data/test/test_all_validations.rb

@@ -1,7 +1,8 @@
 require_relative 'test_helper'
 require 'minitest/autorun'
-require 'yaml'
 require 'fileutils'
+require 'yaml'
+
 require 'genevalidator'
 
 module GeneValidator

data/test/test_blast.rb

@@ -1,6 +1,7 @@
 require_relative 'test_helper'
 require 'minitest/autorun'
 require 'fileutils'
+
 require 'genevalidator'
 require 'genevalidator/blast'
 require 'genevalidator/tabular_parser'
@@ -202,7 +203,7 @@ module GeneValidator
 
         GeneValidator.init(default_opt)
 
-        prediction = Sequence.new
+        prediction = Query.new
         prediction.length_protein = 1808
         tabular_headers      = 'qseqid sseqid sacc slen qstart qend sstart' \
                                ' send pident length qframe evalue'
@@ -241,7 +242,7 @@ module GeneValidator
 
         GeneValidator.init(default_opt)
 
-        prediction = Sequence.new
+        prediction = Query.new
         prediction.length_protein = 219 / 3
         tabular_headers      = 'qseqid sseqid pident length mismatch gapopen' \
                                ' qstart qend sstart send evalue bitscore'
@@ -275,7 +276,7 @@ module GeneValidator
 
         GeneValidator.init(default_opt)
 
-        prediction = Sequence.new
+        prediction = Query.new
         prediction.length_protein = 219 / 3
         output = File.open(ncbi_mrna_xml20, 'rb').read
         iterator = Bio::BlastXMLParser::NokogiriBlastXml.new(output).to_enum

data/test/test_extended_array_methods.rb

@@ -1,9 +1,10 @@
 require_relative 'test_helper'
 require 'genevalidator/ext/array'
 require 'minitest/autorun'
+
 module GeneValidator
   # Test the Enumerable extension class
-  class TestEnumerable < Minitest::Test
+  class TestArray < Minitest::Test
     describe 'Array Class' do
       it 'test1' do
         v = [1, 2, 3, 4, 5, 6]

data/test/{test_sequences.rb → test_query.rb}

@@ -1,36 +1,18 @@
 require_relative 'test_helper'
 require 'minitest/autorun'
-require 'genevalidator/sequences'
+
 require 'genevalidator/hsp'
+require 'genevalidator/query'
+
 module GeneValidator
   # Test the Sequence class
-  class TestSequenceClass < Minitest::Test
+  class TestQueryClass < Minitest::Test
     describe 'Test Sequence Class' do
-      it 'should get sequence by accession for mrna' do
-        seq_mrna = Sequence.new
-        seq_mrna.get_sequence_by_accession_no('EF100000', 'nucleotide',
-                                              'swissprot -remote')
-        assert_equal('AGAGTTTGAT', seq_mrna.raw_sequence[0..9])
-        start_idx = seq_mrna.raw_sequence.length - 10
-        end_idx   = seq_mrna.raw_sequence.length - 1
-        assert_equal('GCCCGTCAAG', seq_mrna.raw_sequence[start_idx..end_idx])
-      end
-
-      it 'should get sequence by accession for protein' do
-        seq_prot = Sequence.new
-        seq_prot.get_sequence_by_accession_no('F8WCM5', 'protein',
-                                              'swissprot -remote')
-        assert_equal('MALWMRLLPL', seq_prot.raw_sequence[0..9])
-        start_idx = seq_prot.raw_sequence.length - 10
-        end_idx   = seq_prot.raw_sequence.length - 1
-        assert_equal('WPRRPQRSQN', seq_prot.raw_sequence[start_idx..end_idx])
-      end
-
       it 'should initialize seq tabular attributes' do
         identifier   = 'sp|Q8N302|AGGF1_HUMAN'
         accession_no = 'Q8N302'
         slen         = 714
-        seq          = Sequence.new
+        seq          = Query.new
         hash = { 'qseqid' => 'GB10034-PA',
                  'sseqid' => identifier,
                  'sacc'   => accession_no,

data/test/test_validation_open_reading_frame.rb

@@ -1,10 +1,10 @@
 require_relative 'test_helper'
 require 'minitest/autorun'
 
-require 'genevalidator/validation_test'
-require 'genevalidator/validation_open_reading_frame'
-require 'genevalidator/sequences'
 require 'genevalidator'
+require 'genevalidator/query'
+require 'genevalidator/validation_open_reading_frame'
+require 'genevalidator/validation_test'
 
 module GeneValidator
   # Classs to test the ORF validation
@@ -13,7 +13,7 @@ module GeneValidator
       it 'should find ORFs - test 1 ' do
         GeneValidator.config = {}
         GeneValidator.config[:type] = :nucleotide
-        prediction = Sequence.new
+        prediction = Query.new
         prediction.raw_sequence = 'ATGGCTCTCTGGATCCGGTCGCTGCCTCTCCTGGCCCTTCTT' \
                                   'GCTCTTTCTGGCCCTGGGATCAGCCACGCAGCTGCCAACCAG' \
                                   'CACCTCTGTGGCTCCCACTTGGTTGAGGCTCTCTACCTGGTG' \
@@ -69,7 +69,7 @@ module GeneValidator
       it 'should find - test 2 ' do
         GeneValidator.config = {}
         GeneValidator.config[:type] = :nucleotide
-        prediction = Sequence.new
+        prediction = Query.new
         prediction.raw_sequence = 'ATGGCTCTCTGGATCCGGTCGCTGCCTCTCCTGGCCCTTCTT' \
                                   'GCTCTTTCTGGCCCTGGGATCAGCCACGCAGCTGCCAACCAG' \
                                   'CACCTCTGTGGCTCCCACTTGGTTGAGGCTCTCTACCTGGTG' \
@@ -144,8 +144,8 @@ module GeneValidator
 
       it 'should find - test 3 ' do
         GeneValidator.config = {}
-        GeneValidator.config[:type] = :nucleotide 
-        prediction = Sequence.new
+        GeneValidator.config[:type] = :nucleotide
+        prediction = Query.new
         prediction.raw_sequence = 'GGCGGGGCGGGAGGGCGGCGCGGAGTGCGCCGGCGCGTCGTC' \
                                   'GGGGACGCCGGGTCCAGGATCTTGCTAGGGAACCAGTGTTGT' \
                                   'CGCGTCGTCCCGCCCCCTCGGGGCTTTTGCTCCCGTTAACTG' \

data/test/test_validations.rb

@@ -2,6 +2,7 @@ require_relative 'test_helper'
 require 'minitest/autorun'
 require 'yaml'
 require 'fileutils'
+
 require 'genevalidator'
 require 'genevalidator/blast'
 require 'genevalidator/validation_length_cluster'
@@ -14,9 +15,10 @@ require 'genevalidator/validation_alignment'
 require 'genevalidator/validation'
 
 module GeneValidator
+  # Class that initalises a separate Validate.new() instance for each query.
   class Validate
     # Extend Validate Class with an alternative validate method that
-    #   doesn't produce the output and returns the output instance
+    # doesn't produce the output and returns the output instance
     def validate_without_output(prediction, hits, current_idx)
       hits = remove_identical_hits(prediction, hits)
       vals = create_validation_tests(prediction, hits)
@@ -50,7 +52,7 @@ module GeneValidator
 
     describe 'Detailed Validation of normal Insulin Query' do
       hits     = BlastUtils.parse_next(iterator, :nucleotide)
-      prediction              = Sequence.new
+      prediction              = Query.new
       prediction.definition   = ''
       prediction.identifier   = ''
       prediction.type         = :nucleotide
@@ -153,7 +155,7 @@ module GeneValidator
 
     describe 'Validate a trancated sequence' do
       hits = BlastUtils.parse_next(iterator, :nucleotide)
-      prediction              = Sequence.new
+      prediction              = Query.new
       prediction.definition   = ''
       prediction.identifier   = ''
       prediction.type         = :nucleotide
@@ -186,7 +188,7 @@ module GeneValidator
 
     describe 'Validate a duplicated sequence' do
       hits = BlastUtils.parse_next(iterator, :nucleotide)
-      prediction              = Sequence.new
+      prediction              = Query.new
       prediction.definition   = ''
       prediction.identifier   = ''
       prediction.type         = :nucleotide
@@ -230,7 +232,7 @@ module GeneValidator
     describe 'Validate a merged sequence' do
       hits = BlastUtils.parse_next(iterator, :nucleotide)
 
-      prediction              = Sequence.new
+      prediction              = Query.new
       prediction.definition   = ''
       prediction.identifier   = ''
       prediction.type         = :nucleotide
@@ -272,7 +274,7 @@ module GeneValidator
     describe 'Validate a sequence with a frameshift' do
       hits = BlastUtils.parse_next(iterator, :nucleotide)
 
-      prediction              = Sequence.new
+      prediction              = Query.new
       prediction.definition   = ''
       prediction.identifier   = ''
       prediction.type         = :nucleotide

metadata

@@ -1,7 +1,7 @@
 --- !ruby/object:Gem::Specification
 name: genevalidator
 version: !ruby/object:Gem::Version
-  version: 1.6.2
+  version: 1.6.3
 platform: ruby
 authors:
 - Monica Dragan
@@ -11,7 +11,7 @@ authors:
 autorequire: 
 bindir: bin
 cert_chain: []
-date: 2015-07-18 00:00:00.000000000 Z
+date: 2015-07-28 00:00:00.000000000 Z
 dependencies:
 - !ruby/object:Gem::Dependency
   name: bundler
@@ -146,23 +146,23 @@ files:
 - LICENCE.txt
 - README.md
 - Rakefile
-- aux/app_template_footer.erb
-- aux/app_template_header.erb
-- aux/files/css/bootstrap.min.css
-- aux/files/css/font-awesome.min.css
-- aux/files/css/style.css
+- aux/files/css/genevalidator.compiled.min.css
+- aux/files/css/src/bootstrap.min.css
+- aux/files/css/src/font-awesome.min.css
+- aux/files/css/src/style.css
 - aux/files/fonts/FontAwesome.otf
 - aux/files/fonts/fontawesome-webfont.eot
 - aux/files/fonts/fontawesome-webfont.svg
 - aux/files/fonts/fontawesome-webfont.ttf
 - aux/files/fonts/fontawesome-webfont.woff
 - aux/files/img/gene.png
-- aux/files/js/bootstrap.min.js
-- aux/files/js/d3.v3.min.js
-- aux/files/js/jquery-2.1.1.min.js
-- aux/files/js/jquery.tablesorter.min.js
-- aux/files/js/plots.js
-- aux/files/js/script.js
+- aux/files/js/genevalidator.compiled.min.js
+- aux/files/js/src/bootstrap.min.js
+- aux/files/js/src/d3.v3.min.js
+- aux/files/js/src/jquery-2.1.1.min.js
+- aux/files/js/src/jquery.tablesorter.min.js
+- aux/files/js/src/plots.js
+- aux/files/js/src/script.js
 - aux/files/json/.gitkeep
 - aux/json_footer.erb
 - aux/json_header.erb
@@ -190,7 +190,7 @@ files:
 - lib/genevalidator/json_to_gv_results.rb
 - lib/genevalidator/output.rb
 - lib/genevalidator/pool.rb
-- lib/genevalidator/sequences.rb
+- lib/genevalidator/query.rb
 - lib/genevalidator/tabular_parser.rb
 - lib/genevalidator/validation.rb
 - lib/genevalidator/validation_alignment.rb
@@ -237,7 +237,7 @@ files:
 - test/test_files/test_sequences.fasta.blast_xml.raw_seq.idx
 - test/test_files/test_validations.fasta
 - test/test_helper.rb
-- test/test_sequences.rb
+- test/test_query.rb
 - test/test_validation_open_reading_frame.rb
 - test/test_validations.rb
 homepage: https://github.com/wurmlab/GeneValidator
@@ -310,7 +310,7 @@ test_files:
 - test/test_files/test_sequences.fasta.blast_xml.raw_seq.idx
 - test/test_files/test_validations.fasta
 - test/test_helper.rb
-- test/test_sequences.rb
+- test/test_query.rb
 - test/test_validation_open_reading_frame.rb
 - test/test_validations.rb
 has_rdoc: 

data/aux/app_template_footer.erb

@@ -1 +0,0 @@
-</tbody></table><script>var evaluation_div = document.getElementById('report_1');evaluation_div.innerHTML = "<%= less %>";</script>

data/aux/app_template_header.erb

@@ -1,12 +0,0 @@
-<h4>Overview</h4><div id="report"><div id="report_1"></div></div><hr><h4 id="results_header">Results</h4><table id="sortable_table" class="table table-bordered table-condensed tablesorter"><thead><tr id="header"><th>#</th><th>Ranking</th><th>Sequence Definition<span data-toggle="tooltip" title="Query definition as it apears in the input fasta file." data-placement="top"><i class="fa fa-question-circle"></i></span></th><th>No. Hits<span data-toggle="tooltip" title="Number of non-identical hits found by BLAST." data-placement="top"><i class="fa fa-question-circle"></i></span></th> 
-<% @validations.each do |item| %>
-  <th class="sorter-false">
-  <b><%= item.header %></b>
-  <% if item.short_header == "LengthCluster" || item.short_header == "Gene_Merge" || item.short_header == "ORF" || item.short_header == "MA" %>
-    <span data-toggle="tooltip" title="Charts available for this validation" data-placement="top"><i class="fa fa-bar-chart-o chartIcon"></i></span>&nbsp;<span data-toggle="tooltip" title="<%=item.description%>" data-placement="top"><i class="fa fa-question-circle"></i></span>
-  <% else %>
-    <span data-toggle="tooltip" title="<%=item.description%>" data-placement="top"><i class="fa fa-question-circle"></i></span>
-  <% end %>
-</th>
-<% end %>
-<th class="sorter-false chart-column"></th></tr></thead><tbody>

data/aux/files/js/plots.js

@@ -1,828 +0,0 @@
-function show_all_plots(button){
-  'use strict';
-  var plotBtns = $('.plot_btn');
-  if (plotBtns.length > 30){
-    $('#alert').modal();
-  } else {
-    if (window.chrome && (window.location.protocol === 'file:') ) {
-      createChromeModal();
-    } else {
-
-      // show activity spinner
-      $('#spinner1').modal({ backdrop: 'static', keyboard: 'false' });
-
-      if (button.status !== 'pressed'){
-        button.status = 'pressed';
-        button.innerHTML = '<i class="fa fa-2x fa-bar-chart-o"></i><br>Hide All Charts';
-        button.onclick = function() {
-          hide_all_plots(button);
-        };
-      }
-
-      remove_all_plots();       // remove all plots
-
-      //iterate over the plot_btns and add data to each childRow
-      $('.plot_btn').each (function(){
-        addData(this, 'all');
-      });
-
-      $('#spinner1').modal('hide');      // remove activity spinner
-    }
-  }
-}
-
-function createChromeModal() {
-  if (($('#browser-alert').length) === 0) {
-    $('#browseralertText').html('<stong>Sorry, this feature is not supported in your browser.');
-    $('#browseralert').modal();
-  }
-}
-
-function remove_all_plots() {
-  'use strict';
-  $('.tablesorter-childRow').each (function(){
-    $(this).remove();
-  });
-
-  $('.plot_btn').each (function(){
-    this.status = 'released';
-  });
-}
-
-function hide_all_plots(button){
-  'use strict';
-  button.status = 'released';
-  button.innerHTML = '<i class="fa fa-2x fa-bar-chart-o"></i><br>Show All Charts';
-  button.onclick = function() {
-    show_all_plots(button);
-  };
-  remove_all_plots();
-}
-
-function addData(source, val){
-  'use strict';
-  if (window.chrome && (window.location.protocol === 'file:') ) {
-    createChromeModal();
-    return true;
-  }
-  var graphs      = '',
-      graphData   = '',
-      $currentRow = $(source).closest('tr'),
-      target      = $currentRow.attr("data-target"),
-      $childRow   = $('#mainrow' + target);
-  
-  if ($childRow.length && source.status !== 'pressed') {
-    // if you click on another td...
-    emptyChildRow($currentRow, target, source);
-    addDataToChildRow($currentRow, target, val);
-  } else if ($childRow.length === 0){
-    createChildRow($currentRow, target, source);
-    addDataToChildRow($currentRow, target, val);
-  } else if ($childRow.length) {
-    removeChildRow($currentRow, $childRow, source);
-  }
-
-  $('table').trigger('update');
-
-}
-
-function addOverallPlot(file){
-  $.getJSON(file, function( json ) {
-    addPlot(json.data, 'report_1', json.type, json.title, json.footer, json.xtitle, json.ytitle);
-  });
-}
-
-function createChildRow($currentRow, target, source){
-  var childRowHTML = '<tr class="tablesorter-childRow" id="mainrow' + target + '"><td colspan="12" id="row' +
-                     target + '"><div id="' + target + '" class="expanded-child"></div></td></tr>';
-  $currentRow.addClass('tablesorter-hasChildRow');
-  $currentRow.after(childRowHTML);
-  source.status = 'pressed';
-}
-
-function removeChildRow($currentRow, $childRow, source){
-  $currentRow.removeClass('tablesorter-hasChildRow');
-  $childRow.remove();
-  source.status = 'released';
-}
-
-function emptyChildRow($currentRow, target, source){
-  var targetId = '#' + target;
-  var explanationId = '#' + target + 'explanation';
-  $(targetId).empty();
-  $(explanationId).remove();
-  resetStatusOfOtherButtons($currentRow);
-  source.status = 'pressed';
-}
-
-function resetStatusOfOtherButtons($currentRow){
-  $currentRow.find('td').each (function(){
-    if (this.status == 'pressed') { this.status = 'released'; }
-  });
-  $currentRow.find('.plot_btn').each (function(){
-    if (this.status == 'pressed') { this.status = 'released'; }
-  });
-}
-
-function addDataToChildRow($currentRow, target, val){
-  var file = $currentRow.attr("data-jsonFile");
-
-  $.getJSON(file, function( json ) {
-    if (val === 'all'){
-      for (var i in json.validations){
-        if (json.validations[i].graphs !== undefined) {
-          generatePlotCommands(json.validations[i].graphs, target);
-        }
-      }
-    } else {
-      addExplanation(target, json.validations[val]);
-      if (json.validations[val].graphs !== undefined) {
-        generatePlotCommands(json.validations[val].graphs, target);
-      }
-    }
-  });
-}
-
-function generatePlotCommands(graphs, target) {
-  for (var g = 0; g < graphs.length; g++) {
-    var graphData = graphs[g];
-    addPlot(graphData.data, target, graphData.type, graphData.title,
-            graphData.footer, graphData.xtitle, graphData.ytitle,
-            graphData.aux1, graphData.aux2);
-  }
-}
-
-function addExplanation(target, jsonData){
-  'use strict';
-  var row = '#row' + target;
-  var approach_html = '<p><b>Approach:</b> ' + jsonData.approach + '</p>';
-  var explanation_html = '<p><b>Explanation:</b> ' + jsonData.explanation + '</p>';
-  var conclusion_html = '<p><b>Conclusion:</b> ' + jsonData.conclusion + '</p>';
-
-  var explain = $('<div id="' + target + 'explanation" class="alert alert-info explanation_alert" role="alert">' +
-                approach_html + explanation_html + conclusion_html + '</div>');
-  $(row).prepend(explain);
-}
-
-function addPlot(jsonData, target, type, title, footer, xtitle, ytitle, aux1, aux2){
-  'use strict';
-  var legend;
-  if (footer === '') {
-    legend = [];
-  } else {
-    legend = footer.split(';');
-  }
-
-  switch(type) {
-    case 'scatter':
-      plot_scatter(jsonData, target, title, footer, xtitle, ytitle, aux1, aux2);
-      break;
-    case 'bars':
-      plot_bars(jsonData, target, title, legend, xtitle, ytitle, aux1);
-      break;
-    case 'simplebars':
-      plot_simple_bars(jsonData, target, title, legend, xtitle, ytitle);
-      break;
-    case 'lines':
-      if (aux2 !== null) {
-        aux2 = aux2.split(',');
-      }
-      plot_lines(jsonData, target, title, legend, xtitle, ytitle, aux1, aux2);
-      break;
-    case 'align':
-      if (aux2 !== null) {
-        aux2 = aux2.split(',');
-      }
-      plot_align(jsonData, target, title, legend, xtitle, ytitle, aux1, aux2);
-      break;
-    default:
-      break;
-  }
-}
-
-function color_beautification(color){
-  'use strict';
-  switch(color){
-    case 'red':
-      return d3.rgb(189,54,47);
-    case 'blue':
-      return d3.rgb(58,135,173);
-    case 'green':
-      return d3.rgb(70,136,71);
-    case 'yellow':
-      return d3.rgb(255,255,51);
-    case 'orange':
-      return d3.rgb(248,148,6);
-    case 'violet':
-      return d3.rgb(153,0,153);
-    case 'gray':
-      return d3.rgb(160,160,160);
-    default:
-      return color;
-  }
-}
-
-// bars plot
-function plot_bars(alldata, target, title, footer, xTitle, yTitle, bar){
-  var margin = {top: 70, right: 50, bottom: 75, left: 50},
-    width = 600 - margin.left - margin.right,
-    height = 500 - margin.top - margin.bottom;
-  var legend_width = 15;
-
-  var svg = d3.select("#".concat(target)).append("svg")
-    .attr("width", width + margin.left + margin.right)
-    .attr("height", height + margin.top + margin.bottom)
-    .append("g")
-    .attr("transform", "translate(" + margin.left + "," + margin.top + ")");
-
-  svg.append("text")
-    .attr("x", (width / 2))
-    .attr("y", -45)
-    .attr("text-anchor", "middle")
-    .style("font-size", "16px")
-    .text(title);
-
-  var colors = new Array("orange", "blue", "green", "yellow", "brown");
-  var no_colors = colors.length;
-
-  var padding = 100;
-
-  flattened_data = [].concat.apply([], alldata);
-  var yMax = d3.max(flattened_data, function(d) { return d.value; }) + 3;
-  var y = d3.scale.linear()
-    .domain([0, yMax + yMax/10])
-    .range([height, 0]);
-
-  var xMin = d3.min(flattened_data, function(d) { return d.key; });
-  if (bar!=undefined){
-    var xMin = Math.min(xMin, bar);
-  }
-
-  var xMax = d3.max(flattened_data, function(d) { return d.key; });
-  if (bar!=undefined){
-    var xMax = Math.max(xMax, bar);
-  }
-
-  var x = d3.scale.linear()
-    .domain([xMin-padding, xMax+padding])
-    .range([13, width]);
-
-  var xAxis = d3.svg.axis()
-    .scale(x)
-    .orient("bottom")
-    .ticks(8);
-
-  var yAxis = d3.svg.axis()
-    .scale(y)
-    .orient("left")
-    .tickFormat(d3.format("d"))
-    .ticks(8);
-
-  svg.append("g")
-      .attr("class", "x axis")
-      .attr("transform", "translate(0," + height + ")")
-      .call(xAxis)
-    .append("text")
-      .attr("class", "label")
-      .attr("x", (width-xTitle.length)/2-50)
-      .attr("y", 35)
-      .style("text-anchor", "start")
-      .text(xTitle);
-
-   svg.append("g")
-       .attr("class", "y axis")
-      .call(yAxis)
-    .append("text")
-      .attr("class", "label")
-      .attr("transform", "rotate(-90)")
-      .attr("x", -(height+yTitle.length)/2-50)
-      .attr("y", -40)
-      .style("text-anchor", "start")
-      .text(yTitle);
-
-    alldata.map( function(data, i) {
-
-      color = colors[i % (no_colors - 1)];
-      svg.selectAll(".bar")
-        .data(data)
-        .enter().append("rect")
-          .attr("x", function(d) { return x(d.key); })
-          .attr("width", 6)
-          .attr("y", function(d) { return y(d.value); })
-          .attr("height", function(d) { return height - y(d.value); })
-          .attr("fill", function(d) { if (d.main == true) return color_beautification("red"); return color_beautification("blue");});
-    });
-
-    if (bar!=undefined){
-      svg.append("rect")
-        .attr("x", x(bar))
-        .attr("width", 4)
-        .attr("y", y(yMax + yMax/10))
-        .style("opacity",0.6)
-        .attr("height", height - y(yMax + yMax/8))
-        .attr("fill", color_beautification("black"));
-
-      svg.append("text")
-        .attr("transform", "rotate(-90)")
-        .attr("x", -yMax/10 - 35)
-        .attr("y", x(bar) - 5)
-          .text("query");
-        }
-
-  var offset = 0;
-  var total_len = 0;
-  for (var i = 0; i < footer.length; i++) {
-  var array = footer[i].split(",");
-  total_len = total_len + array[0].length*8 + 15;
-  }
-
-  for (var i = 0; i < footer.length; i++) {
-
-  var array = footer[i].split(",");
-  svg.append("rect")
-      .attr("x", (width-total_len)/2 + offset)
-      .attr("y", -30)
-      .attr("width", 10)
-      .attr("height", 10)
-      .style("fill", color_beautification(array[1].replace(/\s+/g, '')));
-
-  svg.append("text")
-      .attr("x", (width-total_len)/2 + offset + 15)
-      .attr("y", -20)
-      .text(array[0]);
-    offset = offset + array[0].length*8 + 15;
-  }
-}
-
-// bars plot
-function plot_simple_bars(alldata, target, title, footer, xTitle, yTitle){
-  'use strict';
-
-  var margin = {top: 70, right: 50, bottom: 75, left: 50},
-    width = 600 - margin.left - margin.right,
-    height = 500 - margin.top - margin.bottom;
-  var legend_width = 15;
-
-  var svg = d3.select("#".concat(target)).append("svg")
-    .attr("width", width + margin.left + margin.right)
-    .attr("height", height + margin.top + margin.bottom)
-    .append("g")
-      .attr("transform", "translate(" + margin.left + "," + margin.top + ")");
-
-  svg.append("text")
-    .attr("x", (width / 2))
-    .attr("y", -45)
-    .attr("text-anchor", "middle")
-    .style("font-size", "16px")
-    .text(title);
-
-  var colors = new Array("orange", "blue", "green", "yellow", "brown");
-  var no_colors = colors.length;
-
-  var padding = 0;
-
-  var flattened_data = [].concat.apply([], alldata);
-  var yMax = d3.max(flattened_data, function(d) { return d.value; }) + 3;
-  var y = d3.scale.linear()
-         .domain([0, yMax])
-         .range([height, 0]);
-
-  var xMin = d3.min(flattened_data, function(d) { return d.key; });
-  var xMax = d3.max(flattened_data, function(d) { return d.key; });
-
-  var x = d3.scale.linear()
-            .domain([xMin-padding, xMax+padding])
-            .range([13, width]);
-
-  var xAxis = d3.svg.axis()
-                .scale(x)
-                .orient("bottom")
-                .ticks(8);
-
-  var yAxis = d3.svg.axis()
-                .scale(y)
-                .orient("left")
-                .tickFormat(d3.format("d"))
-                .ticks(8);
-
-  svg.append("g")
-       .attr("class", "x axis")
-       .attr("transform", "translate(0," + height + ")")
-       .call(xAxis)
-     .append("text")
-       .attr("class", "label")
-       .attr("x", (width-xTitle.length)/2-50)
-       .attr("y", 35)
-       .style("text-anchor", "start")
-       .text(xTitle);
-
-  svg.append("g")
-       .attr("class", "y axis")
-       .call(yAxis)
-     .append("text")
-       .attr("class", "label")
-       .attr("transform", "rotate(-90)")
-       .attr("x", -(height+yTitle.length)/2-50)
-       .attr("y", -40)
-       .style("text-anchor", "start")
-       .text(yTitle);
-
-  alldata.map( function(data, i) {
-
-  var color = colors[i % (no_colors - 1)];
-
-  svg.selectAll(".bar")
-     .data(data)
-     .enter().append("rect")
-             .attr("x", function(d) { return x(d.key); })
-             .attr("width", 6)
-             .attr("y", function(d) { return y(d.value); })
-             .attr("height", function(d) { return height - y(d.value); })
-             .attr("fill", function(d) { if (d.main == true) return color_beautification("red"); return color_beautification("blue");});
-    });
-}
-
-
-// scatter plot
-// ecuation of the line: slope * x + yLine
-function plot_scatter(data, target, title, footer, xTitle, yTitle, yLine, slope){
-  'use strict';
-
-  var margin = {top: 50, right: 30, bottom: 75, left: 50},
-  width = 500 - margin.left - margin.right,
-  height = 500 - margin.top - margin.bottom;
-
-  var x = d3.scale.linear()
-            .range([0, width]);
-  var y = d3.scale.linear()
-            .range([height, 0]);
-
-  var color = d3.scale.category10();
-
-  var xAxis = d3.svg.axis()
-                .scale(x)
-                .orient("bottom")
-                .ticks(8);
-  var yAxis = d3.svg.axis()
-                .scale(y)
-                .orient("left")
-                .tickFormat(d3.format("d"))
-                .ticks(8);
-
-  var svg = d3.select("#".concat(target)).append("svg")
-                .attr("width", width + margin.left + margin.right)
-                .attr("height", height + margin.top + margin.bottom)
-                .append("g")
-                .attr("transform", "translate(" + margin.left + "," + margin.top + ")");
-
-  svg.append("text")
-       .attr("x", (width / 2))
-       .attr("y", -25)
-       .attr("text-anchor", "middle")
-       .style("font-size", "16px")
-       .text(title);
-
-  svg.append("text")
-       .attr("x", (width / 2))
-       .attr("y", height+ 55)
-       .attr("text-anchor", "middle")
-       .style("font-size", "12px")
-       .text(footer);
-
-  var xMax = d3.max(data, function(d) { return d.x; });
-  var xMin = d3.min(data, function(d) { return d.x; });
-  var yMax = d3.max(data, function(d) { return d.y; });
-  var yMin = d3.min(data, function(d) { return d.y; });
-  x.domain(d3.extent(data, function(d) { return d.x; })).nice();
-  y.domain(d3.extent(data, function(d) { return d.y; })).nice();
-
-  svg.append("g")
-       .attr("class", "x axis")
-       .attr("transform", "translate(0," + height + ")")
-       .call(xAxis)
-     .append("text")
-       .attr("class", "label")
-       .attr("x", (width-xTitle.length)/2-50)
-       .attr("y", 35)
-       .style("text-anchor", "start")
-       .text(xTitle);
-
-  svg.append("g")
-       .attr("class", "y axis")
-       .call(yAxis)
-     .append("text")
-       .attr("class", "label")
-       .attr("transform", "rotate(-90)")
-       .attr("x", -(height+yTitle.length)/2-50)
-       .attr("y", -40)
-       .style("text-anchor", "start")
-       .text(yTitle);
-
-  svg.selectAll(".dot")
-       .data(data)
-     .enter().append("circle")
-       .attr("r", 2)
-       .attr("cx", function(d) { return x(d.x); })
-       .attr("cy", function(d) { return y(d.y); })
-       .style("fill", function(d) { return color_beautification("red"); })
-       .style("opacity",0.6);
-
-  if ((slope!=undefined && slope != "") && (yLine!=undefined && yLine != "")){
-    yLine = parseFloat(yLine.replace(",", "."));
-    var xMaxValue = xMax;
-    var yMaxValue = yLine + slope * xMax;
-    if (yMaxValue > yMax){
-      xMaxValue = (yMax-yLine)/slope;
-      yMaxValue = yMax;
-    }
-
-    if (yMaxValue < yMin){
-      xMaxValue = (yMin-yLine)/slope;
-      yMaxValue = yMin;
-    }
-
-    var xMinValue = xMin;
-    var yMinValue = yLine + slope * xMin;
-    if (yMinValue > yMax){
-      xMinValue = (yMax-yLine)/slope;
-      yMinValue = yMin;
-    }
-
-    if (yMinValue < yMin){
-      xMinValue = (yMin-yLine)/slope;
-      yMinValue = yMin;
-    }
-
-    svg.append("line")
-         .attr("x1", x(xMinValue))
-         .attr("y1", y(yMinValue))
-         .attr("x2", x(xMaxValue))
-         .attr("y2", y(yMaxValue))
-         .attr("stroke-width", 2)
-         .attr("stroke", "black");
-  }
-}
-
-// line plot
-// maximum 80 lines
-function plot_lines(data, target, title, footer, xTitle, yTitle, no_lines, yValues){
-  'use strict';
-  var margin = {top: 70, right: 50, bottom: 75, left: 50},
-  width = 600 - margin.left - margin.right,
-  height = 500 - margin.top - margin.bottom;
-  var legend_width = 17;
-
-  var x = d3.scale.linear()
-            .range([0, width]);
-  var y = d3.scale.linear()
-            .range([height, 0]);
-
-  var color = d3.scale.category10();
-
-  if (title === 'Open Reading Frames in all 6 Frames') {
-    var xAxis = d3.svg.axis()
-                  .scale(x)
-                  .orient("bottom")
-                  .ticks(0);
-  } else {
-    var xAxis = d3.svg.axis()
-                  .scale(x)
-                  .orient("bottom")
-                  .ticks(5);
-  }
-
-  var yAxis = d3.svg.axis()
-                .scale(y)
-                .orient("left")
-                .ticks(5);
-
-  var svg = d3.select("#".concat(target)).append("svg")
-              .attr("width", width + margin.left + margin.right)
-              .attr("height", height + margin.top + margin.bottom)
-              .append("g")
-              .attr("transform", "translate(" + margin.left + "," + margin.top + ")");
-
-  svg.append("text")
-       .attr("x", (width / 2))
-       .attr("y", -35)
-       .attr("text-anchor", "middle")
-       .style("font-size", "16px")
-       .text(title);
-
-  var idx = -1;
-
-  x.domain([0, d3.max(data, function(d) { return d.stop; })]);
-  y.domain(d3.extent(data, function(d) { return d.y; })).nice();
-
-  svg.append("g")
-       .attr("class", "x axis")
-       .attr("transform", "translate(0," + (height + height/no_lines) + ")")
-       .call(xAxis)
-     .append("text")
-       .attr("class", "label")
-       .attr("x", (width-xTitle.length)/2-50)
-       .attr("y", 35)
-       .style("text-anchor", "start")
-       .text(xTitle);
-
-  if (yValues !== null){
-    svg.append("g")
-         .attr("class", "y axis")
-         .call(yAxis.ticks(yValues.length)
-         .tickFormat(function (d) {
-            idx = idx + 1;
-            return yValues[idx];
-          }))
-       .append("text")
-         .attr("class", "label")
-         .attr("transform", "rotate(-90)")
-         .attr("x", -(height+yTitle.length)/2-50)
-         .attr("y", -40)
-         .style("text-anchor", "start")
-         .text(yTitle);
-    } else {
-      svg.append("g")
-           .attr("class", "y axis")
-           .call(yAxis)
-         .append("text")
-           .attr("class", "label")
-           .attr("transform", "rotate(-90)")
-           .attr("x", -(height+yTitle.length)/2)
-           .attr("y", -40)
-           .style("text-anchor", "start")
-           .text(yTitle);
-    }
-
-    svg.selectAll(".dot")
-       .data(data)
-    .enter().append("line")
-            .attr("x1", function(d) { return x(d.start); })
-            .attr("y1", function(d) { return y(d.y); })
-            .attr("x2", function(d) { return x(d.stop); })
-            .attr("x2", function(d) { return x(d.stop); })
-            .attr("y2", function(d) { return y(d.y); })
-            .attr("stroke-width", function(d) {
-              if (d.dotted == undefined) {
-                if (d.color == "red" ) {
-                  return height/no_lines/2.5;
-                } else {
-                  return height/no_lines;
-                }
-              } else {
-                return height/no_lines/5;
-              }
-            })
-            .style("stroke-dasharray", function(d) { if (d.dotted == undefined) return ("0, 0"); return ("2, 6");})
-            .attr("stroke", function(d) { return color_beautification(d.color); });
-
-  // add legend
-  var legend = svg.append("g")
-                  .attr("class", "legend")
-                  .attr("height", 100)
-                  .attr("width", 100)
-                  .attr('transform', 'translate(-20,50)');
-
-  var h = 0;
-
-  var offset = 40;
-  var total_len = 0;
-  for (var i = 0; i < footer.length; i++) {
-    var array = footer[i].split(",");
-    total_len = total_len + array[0].length*8 + 15;
-  }
-
-  for (var i = 0; i < footer.length; i++) {
-    var array = footer[i].split(",");
-    svg.append("rect")
-         .attr("x", (width-total_len)/2 + offset)
-         .attr("y", -30)
-         .attr("width", 10)
-         .attr("height", 10)
-         .style("fill", color_beautification(array[1].replace(/\s+/g, '')));
-
-    svg.append("text")
-         .attr("x", (width-total_len)/2 + offset + 15)
-         .attr("y", -20)
-         .text(array[0]);  
-    offset = offset + array[0].length*8 + 15;
-  }
-}
-
-// line plot
-// maximum 80 lines
-function plot_align(data, target, title, footer, xTitle, yTitle, no_lines, yValues){
-  'use strict';
-
-  var margin = {top: 75, right: 50, bottom: 75, left: 150},
-  width = 600 - margin.left - margin.right,
-  height = 300 - margin.top - margin.bottom;
-  var legend_width = 17;
-
-  var x = d3.scale.linear()
-            .range([0, width]);
-  var y = d3.scale.linear()
-            .range([height, 0]);
-
-  var color = d3.scale.category10();
-
-  var xAxis = d3.svg.axis()
-                    .scale(x)
-                    .orient("bottom")
-                    .ticks(5);
-
-  var yAxis = d3.svg.axis()
-                    .scale(y)
-                    .orient("left")
-                    .ticks(5);
-
-  var svg = d3.select("#".concat(target)).append("svg")
-              .style("vertical-align", "top")
-              .attr("width", width + margin.left + margin.right)
-              .attr("height", height + margin.top + margin.bottom)
-              .append("g")
-              .attr("transform", "translate(" + margin.left + "," + margin.top + ")");
-
-  svg.append("text")
-       .attr("x", (width / 2))
-       .attr("y", -35)
-       .attr("text-anchor", "middle")
-       .style("font-size", "16px")
-       .text(title);
-
-  var idx = -1;
-
-  x.domain([0, d3.max(data, function(d) { return d.stop; })]);
-  y.domain(d3.extent(data, function(d) { return d.y; })).nice();
-
-  svg.append("g")
-       .attr("class", "x axis")
-       .attr("transform", "translate(0," + (height+height/no_lines) + ")")
-       .call(xAxis)
-     .append("text")
-       .attr("class", "label")
-       .attr("x", (width-xTitle.length)/2-50)
-       .attr("y", 35)
-       .style("text-anchor", "start")
-       .text(xTitle);
-
-  if (yValues !== null){
-    svg.append("g")
-         .attr("class", "y axis")
-         .call(yAxis.ticks(yValues.length)
-                    .tickFormat(function (d) {
-                      idx = idx + 1;
-                      return yValues[idx];
-                    }))
-         .append("text")
-         .attr("class", "label")
-         .attr("transform", "rotate(-90)")
-         .attr("x", -(height+yTitle.length)/2-50)
-         .attr("y", -40)
-         .style("text-anchor", "start")
-         .text(yTitle);
-  } else {
-    svg.append("g")
-         .attr("class", "y axis")
-         .call(yAxis)
-       .append("text")
-         .attr("class", "label")
-         .attr("transform", "rotate(-90)")
-         .attr("x", -(height+yTitle.length)/2-50)
-         .attr("y", -40)
-         .style("text-anchor", "start")
-         .text(yTitle);
-  }
-
-  svg.selectAll(".dot")
-     .data(data)
-     .enter().append("line")
-               .attr("x1", function(d) { return x(d.start); })
-               .attr("y1", function(d) { return y(d.y); })
-               .attr("x2", function(d) { return x(d.stop); })
-               .attr("y2", function(d) { return y(d.y); })
-               .attr("stroke-width", function(d) { if (d.height == -1) return height/no_lines; return (height/no_lines * d.height) ; })
-               .attr("stroke", function(d) { return color_beautification(d.color); });
-
-  var offset = 0;
-  var total_len = 0;
-  for (var i = 0; i < footer.length; i++) {
-    var array = footer[i].split(",");
-    total_len = total_len + array[0].length*8 + 15;
-  }
-
-  for (var i = 0; i < footer.length; i++) {
-    var array = footer[i].split(",");
-    svg.append("rect")
-         .attr("x", (width-total_len)/2 + offset)
-         .attr("y", -30)
-         .attr("width", 10)
-         .attr("height", 10)
-         .style("fill", color_beautification(array[1].replace(/\s+/g, '')));
-
-    svg.append("text")
-         .attr("x", (width-total_len)/2 + offset + 15)
-         .attr("y", -20)
-         .text(array[0]);
-    offset = offset + array[0].length*8 + 15;
-  }
-}