bioroebe 0.10.80 → 0.12.24

data/lib/bioroebe/fasta_and_fastq/parse_fasta/constants.rb

@@ -1,50 +0,0 @@
-#!/usr/bin/ruby -w
-# Encoding: UTF-8
-# frozen_string_literal: true
-# =========================================================================== #
-# require 'bioroebe/fasta_and_fastq/parse_fasta/constants.rb' 
-# =========================================================================== #
-require 'bioroebe/base/commandline_application/commandline_application.rb'
-
-module Bioroebe
-
-class ParseFasta < ::Bioroebe::CommandlineApplication # === Bioroebe::ParseFasta
-
-  # ========================================================================= #
-  # === NAMESPACE
-  # ========================================================================= #
-  NAMESPACE = inspect
-
-  # ========================================================================= #
-  # === REGEX_NON_NUCLEOTIDES
-  #
-  # All non-nucleotides will be handled here via this regex.
-  #
-  # N is excluded because it may stand for "any" nucleotide too, at
-  # the least for a purine.
-  # ========================================================================= #
-  REGEX_NON_NUCLEOTIDES =
-    /BDEFHIJKLMOPQRSVWXYZ/
-
-  # ========================================================================= #
-  # === DEFAULT_FASTA
-  #
-  # This String can be used to quickly test code depending on FASTA
-  # entries.
-  # ========================================================================= #
-  DEFAULT_FASTA = '>Rosalind_6404
-CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
-TCCCACTAATAATTCTGAGG
->Rosalind_5959
-CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
-ATATCCATTTGTCAGCAGACACGC
->Rosalind_0808
-CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
-TGGGAACCTGCGGGCAGTAGGTGGAAT'
-
-  # ========================================================================= #
-  # === DEFAULT_ROUND_TO
-  # ========================================================================= #
-  DEFAULT_ROUND_TO = 2
-
-end; end

data/lib/bioroebe/fasta_and_fastq/parse_fasta/initialize.rb

@@ -1,86 +0,0 @@
-#!/usr/bin/ruby -w
-# Encoding: UTF-8
-# frozen_string_literal: true
-# =========================================================================== #
-# require 'bioroebe/fasta_and_fastq/parse_fasta/initialize.rb'
-# =========================================================================== #
-module Bioroebe
-
-class ParseFasta < ::Bioroebe::CommandlineApplication # === Bioroebe::ParseFasta
-
-  # ========================================================================= #
-  # === initialize
-  # ========================================================================= #
-  def initialize(
-      i           = DEFAULT_FASTA,
-      run_already = true,
-      &block
-    )
-    reset
-    # ======================================================================= #
-    # === Handle blocks next
-    # ======================================================================= #
-    if block_given?
-      yielded = yield
-      # ===================================================================== #
-      # First handle Symbols.
-      # ===================================================================== #
-      case yielded
-      # ===================================================================== #
-      # === :be_verbose
-      # ===================================================================== #
-      when :be_verbose,
-           :verbose
-        set_be_verbose_and_report_the_sequence
-      # ===================================================================== #
-      # === :be_quiet
-      # ===================================================================== #
-      when :be_quiet,
-           :be_silent
-        be_quiet
-      # ===================================================================== #
-      # === :sizeseq
-      # ===================================================================== #
-      when :sizeseq
-        @sort_by_size = true
-      end
-      # ===================================================================== #
-      # === Handle Hashes next
-      # ===================================================================== #
-      if yielded.is_a? Hash
-        # =================================================================== #
-        # === :be_verbose
-        # =================================================================== #
-        if yielded.has_key? :be_verbose
-          set_be_verbose(yielded.delete(:be_verbose))
-          @internal_hash[:report_the_sequence] = true
-        end
-        # =================================================================== #
-        # === :use_colours
-        # =================================================================== #
-        if yielded.has_key? :use_colours
-          set_use_colours(
-            yielded.delete(:use_colours)
-          )
-        end
-        # =================================================================== #
-        # === :sizeseq
-        # =================================================================== #
-        if yielded.has_key? :sizeseq
-          @sort_by_size = true
-        end
-      end
-    end
-    set_commandline_arguments(i)
-    case run_already
-    # ======================================================================= #
-    # === :dont_run_yet
-    # ======================================================================= #
-    when :dont_run_yet,
-         :do_not_run_yet
-      run_already = false
-    end
-    run if run_already
-  end
-
-end; end

data/lib/bioroebe/fasta_and_fastq/parse_fasta/menu.rb

@@ -1,117 +0,0 @@
-#!/usr/bin/ruby -w
-# Encoding: UTF-8
-# frozen_string_literal: true
-# =========================================================================== #
-# require 'bioroebe/fasta_and_fastq/parse_fasta/menu.rb'
-# =========================================================================== #
-module Bioroebe
-
-class ParseFasta < ::Bioroebe::CommandlineApplication # === Bioroebe::ParseFasta
-
-  # ========================================================================= #
-  # === menu                                                       (menu tag)
-  # ========================================================================= #
-  def menu(
-      i = return_commandline_arguments_that_are_not_files
-    )
-    if i.is_a? Array
-      i.each {|entry| menu(entry) }
-    else
-      case i # case tag
-      # ===================================================================== #
-      # === --to-protein
-      #
-      # Invocation example:
-      #
-      #   pfasta *.fasta --toprotein
-      #
-      # ===================================================================== #
-      when /^-?-?to(-|_)?protein/i
-        @internal_hash[:show_the_translated_protein_sequence] = true
-      # ===================================================================== #
-      # === --one-line
-      #
-      # Invocation example:
-      #
-      #   pfasta rpoS_NC_000913.3.fasta --one-line
-      #
-      # ===================================================================== #
-      when /^-?-?one(-|_)?liner?/i
-        @internal_hash[:condense_the_sequence_onto_a_single_line] = true
-      # ===================================================================== #
-      # === --limit=1000
-      #
-      # Invocation example:
-      #
-      #   pfasta --limit=1000
-      #
-      # ===================================================================== #
-      when /^-?-?limit=(\d+)$/i
-        @internal_hash[:limit_the_display_to_n_nucleotides] = $1.to_s.dup.to_i
-      # ===================================================================== #
-      # === --overwrite
-      # ===================================================================== #
-      when /^-?-?overwrite/i
-        @internal_hash[:overwrite_the_original_file] = true
-      # ===================================================================== #
-      # === --help
-      #
-      # Usage example:
-      #
-      #   parse_fasta --help
-      #
-      # ===================================================================== #
-      when /^-?-?help/i
-        show_help
-        exit
-      # ===================================================================== #
-      # === --save-file
-      # ===================================================================== #
-      when /^-?-?save(-|_)?file/i
-        @internal_hash[:save_the_file] = true
-      # ===================================================================== #
-      # === --also-show-the-sequence
-      #
-      # To invoke this method try:
-      #
-      #   parsefasta /Depot/Bioroebe/NP_013521.3_289_aa.fasta --show
-      #
-      # ===================================================================== #
-      when /^-?-?also(-|_)?show(-|_)?the(-|_)?sequence$/i,
-           /^-?-?report$/i,
-           /^-?-?show$/i
-        @internal_hash[:report_the_sequence] = true
-      # ===================================================================== #
-      # === --header
-      # ===================================================================== #
-      when /^-?-?header/i
-        do_show_the_header
-      # ===================================================================== #
-      # === --short
-      #
-      # This entry point can be used to show 300 nucleotides and not
-      # more, by simply using the --short commandline flag.
-      # ===================================================================== #
-      when /^-?-?short/i
-        @internal_hash[:limit_the_display_to_n_nucleotides] = 300
-      # ===================================================================== #
-      # === --size
-      #
-      # This will simply tell us how many nucleotides the given sequence 
-      # has, then exit.
-      #
-      # To invoke this method try:
-      #
-      #   parsefasta /Depot/Bioroebe/NP_013521.3_289_aa.fasta --size
-      #
-      # ===================================================================== #
-      when /^-?-?size$/i
-        set_be_quiet
-        do_process_the_commandline_arguments_that_are_files
-        erev size? # Report the size here.
-        exit
-      end
-    end
-  end
-
-end; end