bioroebe 0.10.80 → 0.11.12

data/lib/bioroebe/siRNA/siRNA.rb

@@ -16,6 +16,16 @@
 #       of the antisense strand
 #   (4) the absence of any GC stretch of more than 9 nt in length
 #
+# Reference: Kumiko Ui-Tei et al. "Guidelines for the selection of highly
+# effective siRNA sequences for mammalian and chick RNA interference."
+#
+#   Nucleic Acids Res. 2004 32: 936-948.
+#
+# The other paper is from:
+#
+# Angela Reynolds et al.  Rational siRNA design for RNA interference.
+# Nat. Biotechnol. 2004 22: 326-330.
+#
 # =========================================================================== #
 # require 'bioroebe/siRNA/siRNA.rb'
 # =========================================================================== #
@@ -40,7 +50,8 @@ class SiRNA # === Bioroebe::SiRNA
   # === uitei?
   # ========================================================================= #
   def uitei?(
-      i = @sequence, be_verbose = true
+      i          = @sequence,
+      be_verbose = true
     )
     unless i.size == 23 # 21 nt target + 2 nt overhang
       if be_verbose
@@ -84,10 +95,79 @@ class SiRNA # === Bioroebe::SiRNA
     return true # This is then the new default return value here.
   end; alias uitei_rule? uitei? # === uitei_rule?
 
+  # ========================================================================= #
+  # === reynolds?
+  #
+  # This method implements the reynolds' rule.
+  #
+  # The Reynolds' rule does not require to fulfill all the
+  # criteria simultaneously.
+  #
+  # See: https://www.nature.com/articles/nbt936
+  # ========================================================================= #
+  def reynolds?(
+      i          = @sequence,
+      be_verbose = true
+    )
+    unless i.size == 23 # 21 nt target + 2 nt overhang
+      if be_verbose
+        puts 'The size should be 23; it is '+i.to_s.size.to_s+'.'
+      end
+      return false
+    end
+    score = 0
+    seq19 = i[2 .. 20] # 19 nt double-stranded region of siRNA
+    complement_to_seq19 = ::Bioroebe.reverse_complement(seq19) # This is actually the reverse complement.
+    # ======================================================================= #
+    # === criterium 1
+    # ======================================================================= #
+    gc_number = seq19.scan(/[GC]/i).size
+    if (7 <= gc_number and gc_number <= 10)
+      score += 1
+    end
+    # ======================================================================= #
+    # === criterium 2
+    # ======================================================================= #
+    au_number = seq19[14..18].scan(/[AU]/i).size
+    score += au_number
+    # ======================================================================= #
+    # === criterium 3
+    #
+    # This is not yet implemented: Tm
+    # ======================================================================= #
+    # ======================================================================= #
+    # === criterium 4
+    # ======================================================================= #
+    score += 1 if seq19[18..18].match(/A/i)
+    # ======================================================================= #
+    # === criterium 5
+    # ======================================================================= #
+    score += 1 if seq19[2..2].match(/A/i)
+    # ======================================================================= #
+    # === criterium 6
+    # ======================================================================= #
+    score += 1 if seq19[9..9].match(/[U]/i)
+    # ======================================================================= #
+    # === criterium 7
+    # ======================================================================= #
+    score -= 1 if seq19[18..18].match(/[GC]/i)
+    # ======================================================================= #
+    # === criterium V8
+    # ======================================================================= #
+    score -= 1 if seq19[12..12].match(/G/i)
+    if score >= 6
+      return score
+    else
+      return false
+    end
+  end; alias reynolds_rule? reynolds? # === reynolds_rule?
+
 end; end
 
 if __FILE__ == $PROGRAM_NAME
   alias e puts
   e Bioroebe::SiRNA.new('GAGAAAATCATGCATGCATTTAT').uitei_rule?
   e Bioroebe::SiRNA.new('GAAAAAAAAATGCATGCAAAAAA').uitei_rule?
+  e Bioroebe::SiRNA.new('GAGAAAATCATGCATGCATTTAT').reynolds_rule?
+  e Bioroebe::SiRNA.new('GAAAAAAAAATGCATGCAAAAAA').reynolds_rule?
 end # siRNA.rb

data/lib/bioroebe/string_matching/find_longest_substring.rb

@@ -109,7 +109,8 @@ class FindLongestSubstring < ::Bioroebe::CommandlineApplication # === Bioroebe::
   # === record
   # ========================================================================= #
   def record(
-      i = @_, start_position = nil
+      i              = @_,
+      start_position = nil
     )
     if i.size > @longest_substring.size
       @longest_substring = i
@@ -148,7 +149,7 @@ class FindLongestSubstring < ::Bioroebe::CommandlineApplication # === Bioroebe::
         @_ << entry
         record(@_, index)
       else
-        @_ = ''
+        @_ = ''.dup
       end
     }
     report_longest_substring

data/lib/bioroebe/toplevel_methods/aminoacids_and_proteins.rb

@@ -129,29 +129,6 @@ module Bioroebe
     return _
   end
 
-  # ========================================================================= #
-  # === Bioroebe.remove_invalid_aminoacids
-  #
-  # This method will filter away invalid aminoacids such as "U".
-  # "U" is not a valid aminoacid.
-  #
-  # Usage example:
-  #
-  #   Bioroebe.remove_invalid_aminoacids('LKLSUSURZZZ')
-  #
-  # ========================================================================= #
-  def self.remove_invalid_aminoacids(from_this_string)
-    if from_this_string.is_a? Array
-      from_this_string = from_this_string.first
-    end
-    all_valid_aminoacids = YAML.load_file(Bioroebe.file_amino_acids).keys
-    new_result = ''.dup
-    from_this_string.chars.each {|entry|
-      new_result << entry if all_valid_aminoacids.include?(entry)
-    }
-    return new_result
-  end
-
   # ========================================================================= #
   # === Bioroebe.colourize_aa
   #
@@ -664,6 +641,36 @@ module Bioroebe
     end
   end
 
+  # ========================================================================= #
+  # === Bioroebe.remove_invalid_aminoacids
+  #
+  # This method will filter away invalid aminoacids such as "U".
+  # "U" is not a valid aminoacid. It requires the data stored
+  # in the yaml file at:
+  # 
+  #    "/home/Programs/Ruby/3.1.2/lib/ruby/site_ruby/3.1.0/bioroebe/yaml/aminoacids/amino_acids.yml"
+  #
+  # Note that U is a valid aminoacid - it is selenocysteine.
+  #
+  # Usage example:
+  #
+  #   Bioroebe.remove_invalid_aminoacids('LKLSUSURZZZ')
+  #
+  # ========================================================================= #
+  def self.remove_invalid_aminoacids(
+      from_this_string
+    )
+    if from_this_string.is_a? Array
+      from_this_string = from_this_string.first
+    end
+    all_valid_aminoacids = YAML.load_file(Bioroebe.file_amino_acids).keys
+    new_result = ''.dup
+    from_this_string.chars.each {|entry|
+      new_result << entry if all_valid_aminoacids.include?(entry)
+    }
+    return new_result
+  end
+
 end
 
 if __FILE__ == $PROGRAM_NAME
@@ -682,7 +689,7 @@ if __FILE__ == $PROGRAM_NAME
     input = ARGV.join(' ').strip
   end
 
-  puts 'From '+input+' to: '+Bioroebe.three_to_one(input) # => "TRH"
+  e 'From '+input+' to: '+Bioroebe.three_to_one(input) # => "TRH"
   # And more tests:
   #   p Bioroebe.is_aminoacid? 'Tryptophan' # => true
   #   p Bioroebe.is_aminoacid? 'Glycine'    # => true

data/lib/bioroebe/toplevel_methods/nucleotides.rb

@@ -270,12 +270,19 @@ module Bioroebe
   #   Bioroebe.random_dna 15 # => "TTGGTAAGCTCTTTA"
   #   Bioroebe.random_dna 25 # => "TTAGCACAAGCATGGACGGACCAGA"
   #   Bioroebe.random_dna(50, { A: 10, T: 10, C: 10, G: 70}) # => "GGGGTGGGGAGGGTATGCGGAGGAAGGGCGGGAAGGGCGGGGGCTGGGCG"
+  #   Bioroebe.random_dna(20, 'ATGGGGGGGG') # => "TGAGGGGGGGGGTGGGAGGG"
+  #   Bioroebe.random_dna(20, 'ATGGGGGGGG') # => "GGTAGGGGGGGGTAGGGGGG"
   #
   # ========================================================================= #
   def self.generate_random_dna_sequence(
-      i = ARGV,
-      optional_hash_with_the_frequencies = {}
+      i                                  = ARGV,
+      optional_hash_with_the_frequencies = {} # ← This may be a String too, mind you.
     )
+    # ======================================================================= #
+    # First define our result-String. This one will be returned by this
+    # method.
+    # ======================================================================= #
+    result = ''.dup
     _ = Bioroebe::DNA_NUCLEOTIDES # Get a handle to the four DNA nucleotides.
     if i.is_a? Array
       i = i.join.strip
@@ -284,9 +291,19 @@ module Bioroebe
     when :default
       i = 250
     end
-    i = i.to_i
-    result = ''.dup
-    if optional_hash_with_the_frequencies.empty?
+    i = i.to_i # This is "n times".
+    # ======================================================================= #
+    # First handle the case where the user passed a String:
+    # ======================================================================= #
+    if optional_hash_with_the_frequencies.is_a? String
+      pool = optional_hash_with_the_frequencies.dup.chars.shuffle
+      i.times {
+        if pool.size == 0
+          pool = optional_hash_with_the_frequencies.dup.chars.shuffle
+        end
+        result << pool.pop
+      }
+    elsif optional_hash_with_the_frequencies.empty?
       # ===================================================================== #
       # This is the default clause.
       # ===================================================================== #

data/lib/bioroebe/toplevel_methods/open_in_browser.rb

@@ -18,6 +18,8 @@ module Bioroebe
   # This constant specifies the default browser to use for the
   # bioroebe-project.
   # ========================================================================= #
+  # /home/x/programming/ruby/src/bioroebe/lib/bioroebe/yaml/configuration/browser.yml
+  # ========================================================================= #
   if File.exist? "#{project_yaml_directory?}browser.yml"
     USE_THIS_BROWSER = YAML.load_file(FILE_BROWSER)
   elsif ENV['BROWSER']

data/lib/bioroebe/toplevel_methods/to_camelcase.rb

@@ -11,6 +11,11 @@ module Bioroebe
   # === Bioroebe.to_camelcase
   #
   # Convert the given String (the input) into a camelcased variant.
+  #
+  # Usage example:
+  #
+  #   Bioroebe.to_camelcase('foo_bar') # => "FooBar"
+  #
   # ========================================================================= #
   def self.to_camelcase(i)
     if i.is_a? Array

data/lib/bioroebe/version/version.rb

@@ -9,7 +9,7 @@ module Bioroebe
   # ========================================================================= #
   # === VERSION
   # ========================================================================= #
-  VERSION = '0.10.80'
+  VERSION = '0.11.12'
 
   # ========================================================================= #
   # === LAST_UPDATE
@@ -17,7 +17,7 @@ module Bioroebe
   # This variable keeps track as to when the bioroebe project was last
   # updated. The notation is: DD.MM.YYYY
   # ========================================================================= #
-  LAST_UPDATE = '24.06.2022'
+  LAST_UPDATE = '05.07.2022'
 
   # ========================================================================= #
   # === URL_TO_THE_DOCUMENTATION

data/lib/bioroebe/yaml/configuration/browser.yml

@@ -1 +1 @@
-firefox # palemoon
+chromium # firefox # palemoon

data/lib/bioroebe/yaml/restriction_enzymes/restriction_enzymes.yml

@@ -49,7 +49,7 @@ AccII:     CGCG         2
 AccIII:    TCCGGA       1
 Acc16I:    TGCGCA       3
 Acc65I:    GGTACC       1
-Acc113I:   AGTACT       3
+Acc113I:   AGTACT       3 # blunt end
 AccB1I:    GGYRCC       1
 AccB7I:    CCANNNNNTGG  7
 AclI:      AACGTT       2
@@ -108,11 +108,11 @@ BalI:      TGGCCA 3
 BamHI:     GGATCC 1
 BanI:      GGYRCC 1
 BanII:     GRGCYC 5
-BanIII:    ATCGAT 2
+BanIII:    ATCGAT 2     # At CG.
 BbeI:      GGCGCC 5
 BbrPI:     CACGTG 3
 BbuI:      GCATGC 5
-Bbv12I:    GWGCWC 5
+Bbv12I:    GWGCWC      5
 BclI:      TGATCA      1
 BcnI:      CCSGG       2
 BcoI:      CYCGRG      1

metadata

@@ -1,14 +1,14 @@
 --- !ruby/object:Gem::Specification
 name: bioroebe
 version: !ruby/object:Gem::Version
-  version: 0.10.80
+  version: 0.11.12
 platform: ruby
 authors:
 - Robert A. Heiler
 autorequire:
 bindir: bin
 cert_chain: []
-date: 2022-06-24 00:00:00.000000000 Z
+date: 2022-07-05 00:00:00.000000000 Z
 dependencies:
 - !ruby/object:Gem::Dependency
   name: chemistry_paradise
@@ -94,8 +94,8 @@ dependencies:
     - - ">="
       - !ruby/object:Gem::Version
         version: '0'
-description: "\nWelcome to the bioroebe-0.10.x release series! It is recommended to\nuse
-  ruby 3.x for this series, as it is the most tested version of \nruby in regards
+description: "\nWelcome to the bioroebe-0.11.x release series! It is recommended\nto
+  use ruby 3.x for this series, as it is the most tested version\nof ruby in regards
   to this project.\n\nThe bioroebe-project is a software suite focusing on bio-related\nlife
   sciences in general - in particular molecular biology, molecular\ngenetics, bioinformatics,
   biotechnology, system biology, synthetic\nbiology and related topics close to the
@@ -294,7 +294,6 @@ files:
 - doc/quality_control/README.md
 - doc/quality_control/commandline_applications.md
 - doc/resources.md
-- doc/setup.rb
 - doc/statistics/statistics.md
 - doc/todo/README.md
 - doc/todo/bioroebe_GUI_todo.md
@@ -519,7 +518,6 @@ files:
 - lib/bioroebe/fasta_and_fastq/split_this_fasta_file_into_chromosomes/split_this_fasta_file_into_chromosomes.rb
 - lib/bioroebe/genbank/README.md
 - lib/bioroebe/genbank/genbank_flat_file_format_generator.rb
-- lib/bioroebe/genbank/genbank_parser.rb
 - lib/bioroebe/gene/gene.rb
 - lib/bioroebe/genomes/genome_pattern.rb
 - lib/bioroebe/genomes/genome_retriever.rb
@@ -677,6 +675,14 @@ files:
 - lib/bioroebe/project/project.rb
 - lib/bioroebe/protein_structure/alpha_helix.rb
 - lib/bioroebe/protein_structure/helical_wheel.rb
+- lib/bioroebe/python/README.md
+- lib/bioroebe/python/__pycache__/mymodule.cpython-39.pyc
+- lib/bioroebe/python/gui/gtk3/widget1.py
+- lib/bioroebe/python/mymodule.py
+- lib/bioroebe/python/protein_to_dna.py
+- lib/bioroebe/python/shell/shell.py
+- lib/bioroebe/python/to_rna.py
+- lib/bioroebe/python/toplevel_methods/to_camelcase.py
 - lib/bioroebe/raw_sequence/README.md
 - lib/bioroebe/raw_sequence/raw_sequence.rb
 - lib/bioroebe/readline/README.md
@@ -719,41 +725,16 @@ files:
 - lib/bioroebe/sequence/protein.rb
 - lib/bioroebe/sequence/reverse_complement.rb
 - lib/bioroebe/sequence/sequence.rb
-- lib/bioroebe/shell/add.rb
-- lib/bioroebe/shell/assign.rb
-- lib/bioroebe/shell/chop_and_cut.rb
 - lib/bioroebe/shell/colours/colours.rb
 - lib/bioroebe/shell/configuration/additionally_set_xorg_buffer.yml
 - lib/bioroebe/shell/configuration/may_we_show_the_startup_information.yml
 - lib/bioroebe/shell/configuration/upcase_nucleotides.yml
 - lib/bioroebe/shell/configuration/use_silent_startup.yml
-- lib/bioroebe/shell/constants.rb
-- lib/bioroebe/shell/download.rb
-- lib/bioroebe/shell/enable_and_disable.rb
-- lib/bioroebe/shell/enzymes.rb
-- lib/bioroebe/shell/fasta.rb
-- lib/bioroebe/shell/gtk.rb
 - lib/bioroebe/shell/help/class.rb
 - lib/bioroebe/shell/help/help.rb
-- lib/bioroebe/shell/history.rb
-- lib/bioroebe/shell/initialize.rb
-- lib/bioroebe/shell/loop.rb
 - lib/bioroebe/shell/menu.rb
-- lib/bioroebe/shell/misc.rb
-- lib/bioroebe/shell/prompt.rb
-- lib/bioroebe/shell/random.rb
 - lib/bioroebe/shell/readline/readline.rb
-- lib/bioroebe/shell/reset.rb
-- lib/bioroebe/shell/scan_and_parse.rb
-- lib/bioroebe/shell/search.rb
-- lib/bioroebe/shell/sequences.rb
 - lib/bioroebe/shell/shell.rb
-- lib/bioroebe/shell/show_report_and_display.rb
-- lib/bioroebe/shell/startup.rb
-- lib/bioroebe/shell/taxonomy.rb
-- lib/bioroebe/shell/tk.rb
-- lib/bioroebe/shell/user_input.rb
-- lib/bioroebe/shell/xorg.rb
 - lib/bioroebe/siRNA/README.md
 - lib/bioroebe/siRNA/siRNA.rb
 - lib/bioroebe/string_matching/README.md
@@ -1025,7 +1006,7 @@ post_install_message: |2+
 
   For more documentation, have a look at:
 
-    https://www.rubydoc.info/gems/bioroebe/0.10.80
+    https://www.rubydoc.info/gems/bioroebe/0.11.12
 
 rdoc_options: []
 require_paths:
@@ -1039,13 +1020,13 @@ required_rubygems_version: !ruby/object:Gem::Requirement
   requirements:
   - - ">="
     - !ruby/object:Gem::Version
-      version: 3.3.16
+      version: 3.3.17
 requirements: []
-rubygems_version: 3.3.16
+rubygems_version: 3.3.17
 signing_key:
 specification_version: 4
-summary: 'Welcome to the bioroebe-0.10.x release series! It is recommended to use
-  ruby 3.x for this series, as it is the most tested version of  ruby in regards to
+summary: 'Welcome to the bioroebe-0.11.x release series! It is recommended to use
+  ruby 3.x for this series, as it is the most tested version of ruby in regards to
   this project.  The bioroebe-project is a software suite focusing on bio-related
   life sciences in general - in particular molecular biology, molecular genetics,
   bioinformatics, biotechnology, system biology, synthetic biology and related topics