bio 1.4.0 → 1.4.1

data/test/unit/bio/db/test_aaindex.rb

@@ -162,11 +162,11 @@ module Bio
     end
 
     def test_matrix_1_2
-      assert_equal(nil, @obj.matrix[1, 2])
+      assert_equal(0.0, @obj.matrix[1, 2])
     end
 
     def test_access_A_R
-      assert_equal(nil, @obj['A', 'R'])
+      assert_equal(-2.0, @obj['A', 'R'])
     end
 
     def test_access_R_A
@@ -174,7 +174,7 @@ module Bio
     end
 
     def test_matrix_A_R
-      assert_equal(nil, @obj.matrix('A', 'R'))
+      assert_equal(-2.0, @obj.matrix('A', 'R'))
     end
 
     def test_matrix_R_A
@@ -182,16 +182,17 @@ module Bio
     end
 
     def test_matrix_determinant
-      assert_equal(0, @obj.matrix.determinant)
+      assert_in_delta(27926521998.0, @obj.matrix.determinant, 1e-3)
     end
 
     def test_matrix_rank
-      assert_equal(1, @obj.matrix.rank)
+      assert_equal(20, @obj.matrix.rank)
     end
 
     def test_matrix_transpose
-      ary = Matrix[[2.0, -2.0, 0.0, 0.0, -2.0, 0.0, 0.0, 1.0, -1.0, -1.0, -2.0, -1.0, -1.0, -4.0, 1.0, 1.0, 1.0, -6.0, -3.0, 0.0]]
-      assert_equal(ary, @obj.matrix.transpose)
+      assert_equal(@obj.matrix, @obj.matrix.transpose)
+      ary = Matrix.row_vector([2.0, -2.0, 0.0, 0.0, -2.0, 0.0, 0.0, 1.0, -1.0, -1.0, -2.0, -1.0, -1.0, -4.0, 1.0, 1.0, 1.0, -6.0, -3.0, 0.0]).row(0)
+      assert_equal(ary, @obj.matrix.transpose.row(0))
     end
   end    
 end

data/test/unit/bio/db/test_fastq.rb

@@ -823,6 +823,42 @@ _9_
       ERRORS = [ Bio::Fastq::Error::No_qual.new ]
     end #class TestFastq_error_trunc_at_seq
 
+    # Unit tests for Bio::Fastq#mask.
+    class TestFastq_mask < Test::Unit::TestCase
+      def setup
+        fn = File.join(TestFastqDataDir, 'wrapping_original_sanger.fastq')
+        Bio::FlatFile.open(Bio::Fastq, fn) do |ff|
+          @entry = ff.next_entry
+        end
+        @entry.format = :fastq_sanger
+      end
+
+      def test_mask_60
+        expected = 'n' * 135
+        assert_equal(expected, @entry.mask(60).seq)
+      end
+
+      def test_mask_20
+        expected = "GAAnTTnCAGGnCCACCTTTnnnnnGATAGAATAATGGAGAAnnTTAAAnGCTGTACATATACCAATGAACAATAAnTCAATACATAAAnnnGGAGAAGTnGGAACCGAAnGGnTTnGAnTTCAAnCCnTTnCGn"
+        assert_equal(expected, @entry.mask(20).seq)
+      end
+
+      def test_mask_20_with_x
+        expected = "GAAxTTxCAGGxCCACCTTTxxxxxGATAGAATAATGGAGAAxxTTAAAxGCTGTACATATACCAATGAACAATAAxTCAATACATAAAxxxGGAGAAGTxGGAACCGAAxGGxTTxGAxTTCAAxCCxTTxCGx"
+        assert_equal(expected, @entry.mask(20, 'x').seq)
+      end
+
+      def test_mask_20_with_empty_string
+        expected = "GAATTCAGGCCACCTTTGATAGAATAATGGAGAATTAAAGCTGTACATATACCAATGAACAATAATCAATACATAAAGGAGAAGTGGAACCGAAGGTTGATTCAACCTTCG"
+        assert_equal(expected, @entry.mask(20, '').seq)
+      end
+        
+      def test_mask_20_with_longer_string
+        expected = "GAA-*-TT-*-CAGG-*-CCACCTTT-*--*--*--*--*-GATAGAATAATGGAGAA-*--*-TTAAA-*-GCTGTACATATACCAATGAACAATAA-*-TCAATACATAAA-*--*--*-GGAGAAGT-*-GGAACCGAA-*-GG-*-TT-*-GA-*-TTCAA-*-CC-*-TT-*-CG-*-"
+        assert_equal(expected, @entry.mask(20, '-*-').seq)
+      end
+
+    end #class TestFastq_mask
 
   end #module TestFastq
 end #module Bio

data/test/unit/bio/db/test_go.rb

@@ -0,0 +1,171 @@
+#
+# test/unit/bio/db/test_go.rb - Unit test for Bio::GO
+#
+# Copyright::  Copyright (C) 2010 Kazuhiro Hayashi <k.hayashi.info@gmail.com>
+# License::    The Ruby License
+#
+
+# loading helper routine for testing bioruby
+require 'pathname'
+load Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 3,
+                            'bioruby_test_helper.rb')).cleanpath.to_s
+
+# libraries needed for the tests
+require 'test/unit'
+require 'bio/db/go'
+
+module Bio
+  class TestBioGOOntology < Test::Unit::TestCase
+
+    TestDataFileName = File.join(BioRubyTestDataPath,
+                                 'go', 'selected_component.ontology')
+
+    def setup
+      @obj = Bio::GO::Ontology.new(File.read(TestDataFileName))
+    end
+
+    def test_dag_edit_format_parser
+      obj = Bio::GO::Ontology.new(File.read(TestDataFileName))
+      assert_equal(Bio::GO::Ontology,obj.class)
+    end
+    def test_goid2term
+      assert_equal('cellular_component', @obj.goid2term('0005575'))
+      assert_equal('cellular_component', @obj.goid2term('0008372'))
+    end
+
+    def test_parse_goids
+      actual = Bio::GO::Ontology.parse_goids("<cellular_component ; GO:0005575, GO:0008372 ; synonym:cellular component ; synonym:cellular component unknown")
+      assert_equal(["0005575", "0008372"], actual)
+    end
+  end
+
+  class TestGeneAssociation < Test::Unit::TestCase
+
+    TestDataFileName = File.join(BioRubyTestDataPath,
+                                 'go', "selected_gene_association.sgd")
+
+    def setup
+      @ga = Bio::GO::GeneAssociation.new("SGD\tS000007287\t15S_RRNA\t\tGO:0005763\tSGD_REF:S000073642|PMID:6261980\tISS\t\tC\tRibosomal RNA of the small mitochondrial ribosomal subunit\t15S_rRNA|15S_RRNA_2\tgene\ttaxon:4932\t20040202\tSGD\t\t")
+    end
+
+    def test_parser
+      file = File.read(TestDataFileName)
+      gas = Bio::GO::GeneAssociation.parser(file)
+      gas.map{ |ga| assert_equal(Bio::GO::GeneAssociation, ga.class) }
+      Bio::GO::GeneAssociation.parser(file) {|ga| assert_equal(Bio::GO::GeneAssociation, ga.class) }
+    end
+
+    def test_goid
+      assert_equal("0005763", @ga.goid)
+      assert_equal("GO:0005763", @ga.goid(true))
+    end
+    def test_to_str
+      #Bio::GO::GeneAssociation#to_str probably has an error.
+      #
+      assert_equal("SGD\tS000007287\t15S_RRNA\t\tGO:0005763\tSGD_REF:S000073642|PMID:6261980\tISS\t\tC\tRibosomal RNA of the small mitochondrial ribosomal subunit\t15S_rRNA|15S_RRNA_2\tgene\ttaxon:4932\t20040202\tSGD",@ga.to_str)
+    end
+    def test_db
+      assert_equal("SGD",@ga.db)
+    end
+    def test_db_object_id
+      assert_equal("S000007287",@ga.db_object_id)
+    end
+    def test_db_object_symbol
+      assert_equal("15S_RRNA",@ga.db_object_symbol)
+    end
+    def test_qualifier
+      assert_equal("",@ga.qualifier)
+    end
+    def test_db_reference
+      assert_equal(["SGD_REF:S000073642", "PMID:6261980"],@ga.db_reference)
+    end
+    def test_evidence
+      assert_equal("ISS",@ga.evidence)
+    end
+    def test_with
+      assert_equal([],@ga.with)
+    end
+    def test_aspect
+      assert_equal("C",@ga.aspect)
+    end
+    def test_db_object_name
+      assert_equal("Ribosomal RNA of the small mitochondrial ribosomal subunit",@ga.db_object_name)
+    end
+    def test_db_object_synonym
+      assert_equal(["15S_rRNA", "15S_RRNA_2"],@ga.db_object_synonym)
+    end
+    def test_db_object_type
+      assert_equal("gene",@ga.db_object_type)
+    end
+    def test_taxon
+      assert_equal("taxon:4932",@ga.taxon)
+    end
+    def test_date
+      assert_equal("20040202",@ga.date)
+    end
+    def test_assigned_by
+      assert_equal("SGD",@ga.assigned_by)
+    end
+
+  end
+
+  class External2go < Test::Unit::TestCase
+
+    TestDataFileName = File.join(BioRubyTestDataPath,
+                                 'go', "selected_wikipedia2go")
+
+    def setup
+      file = File.read(TestDataFileName)
+      @e2g = Bio::GO::External2go.parser(file)
+    end
+    def test_parser
+      expected = [{:go_id=>"GO:0003845",
+  :db=>"Wikipedia",
+  :db_id=>"11beta-hydroxysteroid_dehydrogenase",
+  :go_term=>"11-beta-hydroxysteroid dehydrogenase activity"},
+ {:go_id=>"GO:0047414",
+  :db=>"Wikipedia",
+  :db_id=>
+   "2-(hydroxymethyl)-3-(acetamidomethylene)succinate_amidohydrolase_(deaminating\\,_decarboxylating)",
+  :go_term=>
+   "2-(hydroxymethyl)-3-(acetamidomethylene)succinate hydrolase activity"},
+ {:go_id=>"GO:0043718",
+  :db=>"Wikipedia",
+  :db_id=>"2-hydroxymethylglutarate_dehydrogenase",
+  :go_term=>"2-hydroxymethylglutarate dehydrogenase activity"}]
+      file = File.read(TestDataFileName)
+      e2g = Bio::GO::External2go.parser(file)
+      assert_equal(expected, e2g)
+      assert_raise(RuntimeError){ Bio::GO::External2go.parser("probably this occurs error")}
+    end
+    def test_set_date
+      e2g = Bio::GO::External2go.new
+      e2g.set_date("$Date: 2010/06/11 01:01:37 $")
+      assert_equal("$Date: 2010/06/11 01:01:37 $",e2g.header[:date])
+    end
+    def test_set_desc
+      e2g = Bio::GO::External2go.new
+      e2g.set_desc([" Mapping of Gene Ontology terms to Wikipedia entries."," Wikipedia: http://en.wikipedia.org"])
+      assert_equal([" Mapping of Gene Ontology terms to Wikipedia entries."," Wikipedia: http://en.wikipedia.org"],e2g.header[:desc])
+    end
+    def test_to_str
+      assert_equal("!date: \n! version: $Revision: 1.17 $\n! date: $Date: 2010/06/11 01:01:37 $\n!\n! Generated from file ontology/editors/gene_ontology_write.obo,\n! CVS revision:  1.1296; date:  10:06:2010 16:16\n!\n! Mapping of Gene Ontology terms to Wikipedia entries.\n! Wikipedia: http://en.wikipedia.org\n! Last update at Thu Jun 10 17:21:44 2010 by the script /users/cjm/cvs/go-moose/bin/daily_from_obo.pl\n!\nWikipedia:11beta-hydroxysteroid_dehydrogenase > GO:11-beta-hydroxysteroid dehydrogenase activity ; GO:0003845\nWikipedia:2-(hydroxymethyl)-3-(acetamidomethylene)succinate_amidohydrolase_(deaminating\\,_decarboxylating) > GO:2-(hydroxymethyl)-3-(acetamidomethylene)succinate hydrolase activity ; GO:0047414\nWikipedia:2-hydroxymethylglutarate_dehydrogenase > GO:2-hydroxymethylglutarate dehydrogenase activity ; GO:0043718", @e2g.to_str)
+    end
+    def test_dbs
+      assert_equal(["Wikipedia"], @e2g.dbs)
+    end
+    def test_db_ids
+      assert_equal(["11beta-hydroxysteroid_dehydrogenase",
+ "2-(hydroxymethyl)-3-(acetamidomethylene)succinate_amidohydrolase_(deaminating\\,_decarboxylating)",
+ "2-hydroxymethylglutarate_dehydrogenase"], @e2g.db_ids)
+    end
+    def test_go_terms
+      assert_equal(["11-beta-hydroxysteroid dehydrogenase activity",
+ "2-(hydroxymethyl)-3-(acetamidomethylene)succinate hydrolase activity",
+ "2-hydroxymethylglutarate dehydrogenase activity"], @e2g.go_terms)
+    end
+    def test_go_ids
+      assert_equal(["GO:0003845", "GO:0047414", "GO:0043718"], @e2g.go_ids)
+    end
+  end
+end

data/test/unit/bio/db/test_medline.rb

@@ -12,9 +12,157 @@ load Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 3,
 
 # libraries needed for the tests
 require 'test/unit'
+require 'bio/reference'
 require 'bio/db/medline'
 
 module Bio
+  class TestMEDLINE_20146148 < Test::Unit::TestCase
+
+    def setup
+      filename = File.join(BioRubyTestDataPath, 'medline',
+                           '20146148_modified.medline')
+      @obj = Bio::MEDLINE.new(File.read(filename))
+    end
+
+    def test_self_new
+      assert_instance_of(Bio::MEDLINE, @obj)
+    end
+
+    def test_reference
+      h = {
+        'authors' => ["Mattsson, M.", "Summala, H."],
+        'affiliations' =>
+        [ "Traffic Research Unit, Department of Psychology, University of Helsinki, Finland. markus.mattsson@helsinki.fi" ],
+        'journal' => "Traffic Inj Prev",
+        'title' =>
+        "With power comes responsibility: motorcycle engine power and power-to-weight ratio in relation to accident risk.",
+        'pages' => '87-95',
+        'issue' => "1",
+        'volume' => "11",
+        'year' => "2010",
+        'pubmed' => "20146148",
+        'mesh' =>
+        [ "Accidents, Traffic/mortality/*statistics & numerical data",
+          "Adult",
+          "Age Distribution",
+          "Body Weight",
+          "Female",
+          "Finland/epidemiology",
+          "Humans",
+          "Linear Models",
+          "Male",
+          "Motorcycles/classification/legislation & jurisprudence/*statistics & numerical data",
+          "Questionnaires",
+          "Risk",
+          "Social Responsibility",
+          "Young Adult" ],
+        'abstract' => 
+        "(The abstract is omitted to avoid copyright issues. Please find the abstract at http://www.ncbi.nlm.nih.gov/pubmed/20146148. We believe that other information in this entry is within public domain, according to \"Copyright and Disclaimers\" in http://www.ncbi.nlm.nih.gov/About/disclaimer.html.)"
+      }
+      expected = Bio::Reference.new(h)
+      assert_equal(expected, @obj.reference)
+    end
+
+    def test_pmid
+      assert_equal("20146148", @obj.pmid)
+    end
+
+    def test_ui
+      assert_equal("", @obj.ui)
+    end
+
+    def test_ta
+      assert_equal("Traffic Inj Prev", @obj.ta)
+    end
+
+    def test_vi
+      assert_equal("11", @obj.vi)
+    end
+
+    def test_ip
+      assert_equal("1", @obj.ip)
+    end
+
+    def test_pg
+      assert_equal("87-95", @obj.pg)
+    end
+
+    def test_pages
+      assert_equal("87-95", @obj.pages)
+    end
+
+    def test_dp
+      assert_equal("2010 Feb", @obj.dp)
+    end
+
+    def test_year
+      assert_equal("2010", @obj.year)
+    end
+
+    def test_ti
+      expected = "With power comes responsibility: motorcycle engine power and power-to-weight ratio in relation to accident risk."
+      assert_equal(expected, @obj.ti)
+    end
+
+    def test_ab
+      expected = "(The abstract is omitted to avoid copyright issues. Please find the abstract at http://www.ncbi.nlm.nih.gov/pubmed/20146148. We believe that other information in this entry is within public domain, according to \"Copyright and Disclaimers\" in http://www.ncbi.nlm.nih.gov/About/disclaimer.html.)"
+      assert_equal(expected, @obj.ab)
+    end
+
+    def test_au
+      expected = "Mattsson M\nSummala H"
+      assert_equal(expected, @obj.au)
+    end
+
+    def test_authors
+      expected = ["Mattsson, M.", "Summala, H."]
+      assert_equal(expected, @obj.authors)
+    end
+
+    def test_so
+      expected = "Traffic Inj Prev. 2010 Feb;11(1):87-95."
+      assert_equal(expected, @obj.so)
+    end
+
+    def test_mh
+      expected =
+        [ "Accidents, Traffic/mortality/*statistics & numerical data",
+          "Adult",
+          "Age Distribution",
+          "Body Weight",
+          "Female",
+          "Finland/epidemiology",
+          "Humans",
+          "Linear Models",
+          "Male",
+          "Motorcycles/classification/legislation & jurisprudence/*statistics & numerical data",
+          "Questionnaires",
+          "Risk",
+          "Social Responsibility",
+          "Young Adult"
+        ]
+      assert_equal(expected, @obj.mh)
+    end
+
+    def test_ad
+      expected = [ "Traffic Research Unit, Department of Psychology, University of Helsinki, Finland. markus.mattsson@helsinki.fi" ]
+      assert_equal(expected, @obj.ad)
+    end
+
+    def test_doi
+      assert_equal("10.1080/15389580903471126", @obj.doi)
+    end
+
+    def test_pii
+      assert_equal("919158438", @obj.pii)
+    end
+
+    def test_pt
+      expected = [ "Journal Article", "Research Support, Non-U.S. Gov't" ]
+      assert_equal(expected, @obj.pt)
+    end
+  end #class TestMEDLINE_20146148
+
   class TestMEDLINE < Test::Unit::TestCase
     def test_authors
       assert_equal(["Kane, D. W.",

data/test/unit/bio/db/test_qual.rb

@@ -19,6 +19,8 @@ require 'bio/db/fasta/qual'
 module Bio
   class TestFastaNumericFormat < Test::Unit::TestCase
 
+    DATA = [24, 15, 23, 29, 20, 13, 20, 21, 21, 23, 22, 25, 13, 22, 17, 15, 25, 27, 32, 26, 32, 29, 29, 25].freeze
+
     def setup
       text =<<END
 >CRA3575282.F 
@@ -41,8 +43,7 @@ END
     end
 
     def test_data
-      data = [24, 15, 23, 29, 20, 13, 20, 21, 21, 23, 22, 25, 13, 22, 17, 15, 25, 27, 32, 26, 32, 29, 29, 25]
-      assert_equal(data, @obj.data)
+      assert_equal(DATA, @obj.data)
     end
 
     def test_length
@@ -58,6 +59,12 @@ END
       assert(@obj[-1], '')
     end
 
+    def test_to_biosequence
+      assert_instance_of(Bio::Sequence, s = @obj.to_biosequence)
+      assert_equal(Bio::Sequence::Generic.new(''), s.seq)
+      assert_equal(DATA, s.quality_scores)
+      assert_equal(nil, s.quality_score_type)
+    end
 
   end #class TestFastaNumericFormat
 end #module Bio

data/test/unit/bio/sequence/test_sequence_masker.rb

@@ -0,0 +1,169 @@
+#
+# = test/unit/bio/sequence/test_sequence_masker.rb - Unit test for Bio::Sequence::SequenceMasker
+#
+# Copyright::   Copyright (C) 2010
+#               Naohisa Goto <ng@bioruby.org>
+# License::     The Ruby License
+#
+
+# loading helper routine for testing bioruby
+require 'pathname'
+load Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 3,
+                            'bioruby_test_helper.rb')).cleanpath.to_s
+
+# libraries needed for the tests
+require 'test/unit'
+require 'bio/sequence'
+require 'bio/sequence/sequence_masker'  
+
+module Bio
+
+class TestSequenceMasker < Test::Unit::TestCase
+
+  def setup
+    s = "aaacgcattagcaccaccattaccaccacc"
+    @raw = s.dup.freeze
+    @seq = Bio::Sequence.new(s)
+    @seq.quality_scores =
+      (0...30).collect { |i| i * 3 }
+    @seq.error_probabilities = 
+      (0...30).collect { |i| 10 ** -(i * 3 / 10.0) }
+  end
+
+  # Very simple enumerator for testing.
+  class SimpleEnum
+    include Enumerable
+
+    def initialize(ary)
+      @ary = ary
+    end
+
+    def each(&block)
+      @ary.each(&block)
+    end
+  end #class SimpleEnum
+
+  def test_mask_with_enumerator
+    enum = SimpleEnum.new((0..29).to_a)
+    newseq = @seq.mask_with_enumerator(enum, 'n') do |item|
+      i = item % 10
+      i == 9 || i == 0
+    end
+    expected = "naacgcattnncaccaccannaccaccacn"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+  end
+
+  def test_mask_with_enumerator_longer_mask_char
+    enum = SimpleEnum.new((0..29).to_a)
+    newseq = @seq.mask_with_enumerator(enum, '-*-') do |item|
+      i = item % 10
+      i == 9 || i == 0
+    end
+    expected = "-*-aacgcatt-*--*-caccacca-*--*-accaccac-*-"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+  end
+
+  def test_mask_with_enumerator_empty_mask_char
+    enum = SimpleEnum.new((0..29).to_a)
+    newseq = @seq.mask_with_enumerator(enum, '') do |item|
+      i = item % 10
+      i == 9 || i == 0
+    end
+    expected = "aacgcattcaccaccaaccaccac"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+  end
+
+  def test_mask_with_enumerator_shorter
+    enum = SimpleEnum.new((0..10).to_a.freeze)
+    enum.freeze
+    # normal mask char
+    newseq = @seq.mask_with_enumerator(enum, 'n') do |item|
+      item > 5
+    end
+    expected = "aaacgcnnnnncaccaccattaccaccacc"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+    # empty mask char
+    newseq = @seq.mask_with_enumerator(enum, '') do |item|
+      item > 5
+    end
+    expected = "aaacgccaccaccattaccaccacc"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+    # longer mask char
+    newseq = @seq.mask_with_enumerator(enum, '-*-') do |item|
+      item > 5
+    end
+    expected = "aaacgc-*--*--*--*--*-caccaccattaccaccacc"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+  end
+
+  def test_mask_with_enumerator_excess
+    enum = SimpleEnum.new((0..200).to_a.freeze)
+    enum.freeze
+    # normal mask char
+    newseq = @seq.mask_with_enumerator(enum, 'n') do |item|
+      i = item % 10
+      i == 9 || i == 0
+    end
+    expected = "naacgcattnncaccaccannaccaccacn"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+    # empty mask char
+    newseq = @seq.mask_with_enumerator(enum, '') do |item|
+      i = item % 10
+      i == 9 || i == 0
+    end
+    expected = "aacgcattcaccaccaaccaccac"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+    # longer mask char
+    newseq = @seq.mask_with_enumerator(enum, '-*-') do |item|
+      i = item % 10
+      i == 9 || i == 0
+    end
+    expected = "-*-aacgcatt-*--*-caccacca-*--*-accaccac-*-"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+  end
+
+  def test_mask_with_quality_score
+    newseq = @seq.mask_with_quality_score(30, 'n')
+    expected = "nnnnnnnnnngcaccaccattaccaccacc"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+  end
+
+  def test_mask
+    newseq = @seq.mask_with_quality_score(30, 'n')
+    expected = "nnnnnnnnnngcaccaccattaccaccacc"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+  end
+
+  def test_mask_with_error_probability
+    newseq = @seq.mask_with_error_probability(0.001, 'n')
+    expected = "nnnnnnnnnngcaccaccattaccaccacc"
+    assert_equal(expected, newseq.seq)
+    # not breaking original sequence
+    assert_equal(@raw, @seq.seq)
+  end
+
+end #class TestSequenceMasker
+
+end #module Bio