bio-samtools 2.2.0 → 2.3.0

checksums.yaml

@@ -1,7 +1,7 @@
 ---
 SHA1:
-  metadata.gz: a061cf6e87c05ce1f622d1607878cb68d85f92e0
-  data.tar.gz: 90f4a519c6174d6b8787e42d6be8917f1b5721b1
+  metadata.gz: 95a8754491dfd5146f150c810a425914b86e95b8
+  data.tar.gz: 8fb156bef16dd3a4e8a1d3a06006bf88a6987fcb
 SHA512:
-  metadata.gz: 02168c213254e2f4cbe2b16281c0f92c4dbccf6aaca92c4418457a68b835ac2a07e5cc81d68934f86441fe6fb1578ff08e149a5915262843cec67afd5ccc5e8a
-  data.tar.gz: 02b7cb92700fc834a3425649f8c1df6694cb22b3d6bc805707695f7206d1055ebbe72293e9a577df6766341ab0dbf12fa95992eec0addc7b4f8321219c96c979
+  metadata.gz: 4216233167cc318ad452d3519b74a2e2a29001e078cb9ad3f27c3a29ce8e5355c372908bc090c58b0d2564d90565f15b19b055fca464ce02471b24b2db6173ce
+  data.tar.gz: b3a0aca0dccfde418162ad23a117053121a93f511402034de62640fb4508031fd32f3af9d5ac792a80507884c9fd723a3b5067fd918ea91c22b61f9ebb223807

data/README.md

@@ -25,7 +25,7 @@ Or install it yourself as:
 
     $ gem install bio-samtools
 
-## Usage
+## Getting started
 
 ### Creating a new SAM object
 
@@ -52,7 +52,389 @@ Alignments can be obtained one at a time by looping over a specified region usin
 		#do something with the alignment...
 	end
 
-See more detail on doc/tutorial.html or doc/tutorial.pdf for a walkthrough tutorial. 
+#Tutorial
+##Creating a BAM file
+Often, the output from a next-generation sequence alignment tool will be a file in the [SAM format](http://samtools.github.io/hts-specs/SAMv1.pdf).
+
+Typically, we'd create a compressed, indexed binary version of the SAM file, which would allow us to operate on it in a quicker and more efficient manner, being able to randomly access various parts of the alignment. We'd use the `view` to do this. This step would involve takeing our sam file, sorting it and indexing it.
+
+```ruby
+#create the sam object
+sam = Bio::DB::Sam.new(:bam => 'my.sam', :fasta => 'ref.fasta')
+
+#create a bam file from the sam file
+sam.view(:b=>true, :S=>true, :o=>'bam.bam')
+
+#create a new sam object from the bam file
+unsortedBam = Bio::DB::Sam.new(:bam => 'bam.bam', :fasta => 'ref.fasta')
+
+#the bam file might not be sorted (necessary for samtools), so sort it
+unsortedBam.sort(:prefix=>'sortedBam')
+
+#create a new sam object
+bam = Bio::DB::Sam.new(:bam => 'sortedBam.bam', :fasta => 'ref.fasta')
+#create a new index
+bam.index()
+
+#creates index file sortedBam.bam.bai
+```
+
+
+Working with BAM files
+----------------------
+
+
+### Creating a new SAM object
+
+A SAM object represents the alignments in the BAM file. BAM files (and hence SAM objects here) are what most of SAMtools methods operate on and are very straightforward to create. You will need a sorted and indexed BAM file, to access the alignments and a reference sequence in FASTA format to use the reference sequence. Let's revisit the last few lines of code from the code above.
+
+```ruby
+bam = Bio::DB::Sam.new(:bam => 'sortedBam.bam', :fasta => 'ref.fasta')
+bam.index()
+```
+
+Creating the new Bio::DB::Sam (named 'bam' in this case) only to be done once for multiple operations on it, access to the alignments is random so you don't need to loop over the entries in the file.
+
+### Getting Reference Sequence
+
+The reference is accessed using reference
+name, start, end in 1-based co-ordinates. A standard Ruby String object is returned.
+```ruby
+sequence_fragment = bam.fetch_reference("Chr1", 1, 100)
+puts sequence_fragment
+=> cctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaacccta
+```
+
+A reference sequence can be returned as a Bio::Sequence::NA object buy the use of :as_bio => true
+```ruby
+sequence_fragment = bam.fetch_reference("Chr1", 1, 100, :as_bio => true)
+```
+
+The printed output from this would be a fasta-formatted string
+```ruby
+puts sequence_fragment
+
+=> >Chr1:1-100
+=> cctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaacccta
+```
+
+### Concatenating BAM files
+BAM files may be concatenated using the `cat` command. The sequence dictionary of each input BAM must be identical, although the `cat` method does not check this.
+
+```ruby
+#create an array of BAM files to cat
+bam_files = [bam1, bam2]
+cat_file = "maps_cated.bam" #the outfile
+#cat the files
+@sam.cat(:out=>cat_file, :bams=>bam_files)
+#create a new Bio::DB::Sam object from the new cat file
+cat_bam = Bio::DB::Sam.new(:fasta => "ref.fasta", :bam => cat_file)
+
+```
+
+### Removing duplicate reads
+The `remove_duplicates` method removes potential PCR duplicates: if multiple read pairs have identical external coordinates it only retain the pair with highest mapping quality. It does not work for unpaired reads (e.g. two ends mapped to different chromosomes or orphan reads).
+```ruby
+
+unduped = "dupes_rmdup.bam" #an outfile for the removed duplicates bam
+#remove single-end duplicates
+bam.remove_duplicates(:s=>true, :out=>unduped)
+#create new Bio::DB::Sam object
+unduped_bam = Bio::DB::Sam.new(:fasta => "ref.fasta", :bam => unduped)
+
+```
+
+### Alignment Objects
+
+The individual alignments represent a single read and are returned as
+Bio::DB::Alignment objects. These have numerous methods of their own,
+using `require 'pp'` will allow you to check the attributes contained in
+each object. Here is an example alignment object. Remember `@`
+represents a Ruby instance variable and can be accessed as any other
+method. Thus the `@is_mapped` attribute of an object `a` is accessed
+`a.is_mapped`
+
+```ruby
+require 'pp'
+pp an_alignment_object ##some Bio::DB::Alignment object
+#<Bio::DB::Alignment:0x101113f80
+@al=#<Bio::DB::SAM::Tools::Bam1T:0x101116a50>,
+@calend=4067,
+@cigar="76M",
+@failed_quality=false,
+@first_in_pair=false,
+@flag=163,
+@is_duplicate=false,
+@is_mapped=true,
+@is_paired=true,
+@isize=180,
+@mapq=60,
+@mate_strand=false,
+@mate_unmapped=false,
+@mpos=4096,
+@mrnm="=",
+@pos=3992,
+@primary=true,
+@qlen=76,
+@qname="HWI-EAS396_0001:7:115:17904:15958#0",
+@qual="IIIIIIIIIIIIHHIHGIHIDGGGG...",
+@query_strand=true,
+@query_unmapped=false,
+@rname="1",
+@second_in_pair=true,
+@seq="ACAGTCCAGTCAAAGTACAAATCGAG...",
+@tags=
+    {"MD"=>#<Bio::DB::Tag:0x101114ed0 @tag="MD", @type="Z", @value="76">,
+     "XO"=>#<Bio::DB::Tag:0x1011155d8 @tag="XO", @type="i", @value="0">,
+     "AM"=>#<Bio::DB::Tag:0x101116280 @tag="AM", @type="i", @value="37">,
+     "X0"=>#<Bio::DB::Tag:0x101115fb0 @tag="X0", @type="i", @value="1">,
+     "X1"=>#<Bio::DB::Tag:0x101115c68 @tag="X1", @type="i", @value="0">,
+     "XG"=>#<Bio::DB::Tag:0x101115240 @tag="XG", @type="i", @value="0">,
+     "SM"=>#<Bio::DB::Tag:0x1011162f8 @tag="SM", @type="i", @value="37">,
+     "XT"=>#<Bio::DB::Tag:0x1011162a8 @tag="XT", @type="A", @value="U">,
+     "NM"=>#<Bio::DB::Tag:0x101116348 @tag="NM", @type="i", @value="0">,
+     "XM"=>#<Bio::DB::Tag:0x101115948 @tag="XM", @type="i", @value="0">}>
+```
+
+### Getting Alignments
+
+Alignments can be obtained one at a time by looping over a specified region using the `fetch()` function.
+
+```ruby
+bam.fetch("Chr1",3000,4000).each do |alignment|
+	#do something with the alignment...
+end
+```
+
+A separate method `fetch_with_function()` allows you to pass a block (or
+a Proc object) to the function for efficient calculation. This example takes
+an alignment object and returns an array of sequences which exactly match the reference.
+
+```ruby
+#an array to hold the matching sequences
+exact_matches = []
+
+matches = Proc.new do |a|
+	#get the length of each read
+	len = a.seq.length
+	#get the cigar string
+	cigar = a.cigar
+	#create a cigar string which represents a full-length match
+	cstr = len.to_s << "M"
+	if cigar == cstr
+		#add the current sequence to the array if it qualifies
+		exact_matches << a.seq
+	end
+end
+
+bam.fetch_with_function("Chr1", 100, 500, &matches) 
+
+puts exact_matches
+```
+
+###Alignment stats
+
+The SAMtools flagstat method is implemented in bio-samtools to quickly examine the number of reads mapped to the reference. This includes the number of paired and singleton reads mapped and also the number of paired-reads that map to different chromosomes/contigs.
+
+```ruby
+bam.flag_stats()
+```
+
+An example output would be
+```ruby
+34672 + 0 in total (QC-passed reads + QC-failed reads)
+0 + 0 duplicates
+33196 + 0 mapped (95.74%:nan%)
+34672 + 0 paired in sequencing
+17335 + 0 read1
+17337 + 0 read2
+31392 + 0 properly paired (90.54%:nan%)
+31728 + 0 with itself and mate mapped
+1468 + 0 singletons (4.23%:nan%)
+0 + 0 with mate mapped to a different chr
+0 + 0 with mate mapped to a different chr (mapQ>=5)
+```
+
+Getting Coverage Information
+----------------------------
+
+
+### Per Base Coverage
+
+It is easy to get the total depth of reads at a given position, the
+`chromosome_coverage` function is used. This differs from the previous
+functions in that a start position and length (rather than end position)
+are passed to the function. An array of coverages is returned, the first
+position in the array gives the depth of coverage at the given start
+position in the genome, the last position in the array gives the depth
+of coverage at the given start position plus the length given
+
+```ruby
+coverages = bam.chromosome_coverage("Chr1", 3000, 1000)  #=> [16,16,25,25...]
+```
+
+### Average Coverage In A Region
+
+Similarly, average (arithmetic mean) of coverage can be retrieved with the `average_coverage` method.
+
+```ruby
+coverages = bam.average_coverage("Chr1", 3000, 1000)  #=> 20.287
+```
+
+### Coverage from a BED file
+It is possible to count the number of nucleotides mapped to a given region of a BAM file by providing a [BED formatted](http://genome.ucsc.edu/FAQ/FAQformat.html#format1) file and using the `bedcov` method. The output is the BED file with an extra column providing the number of nucleotides mapped to that region.
+
+```ruby
+bed_file =  "test.bed"
+bam.bedcov(:bed=>bed_file)
+
+=> chr_1	1	30	6
+=> chr_1	40	45	8
+
+```
+Alternatively, the `depth` method can be used to get per-position depth information (any unmapped positions will be ignored).
+```ruby
+bed_file =  "test.bed"
+@sam.depth(:b=>bed_file)
+
+=> chr_1	25	1
+=> chr_1	26	1
+=> chr_1	27	1
+=> chr_1	28	1
+=> chr_1	29	1
+=> chr_1	30	1
+=> chr_1	41	1
+=> chr_1	42	1
+=> chr_1	43	2
+=> chr_1	44	2
+=> chr_1	45	2
+```
+##Getting Pileup Information
+
+Pileup format represents the coverage of reads over a single base in the
+reference. Getting a Pileup over a region is very easy. Note that this
+is done with `mpileup` and NOT the now deprecated SAMtools `pileup`
+function. Calling the `mpileup` method creates an iterator that yields a
+Pileup object for each base.
+
+```ruby
+bam.mpileup do |pileup|
+    puts pileup.consensus #gives the consensus base from the reads for that position
+end 
+```
+
+###Caching pileups
+A pileup can be cached, so if you want to execute several operations on the same set of regions, mpilup won't be executed several times. Whenever you finish using a region, call mpileup_clear_cache to free the cache. The argument 'Region' is required, as it will be the key for the underlying hash. We assume that the options (other than the region) are constant. If they are not, the cache mechanism may not be consistent. 
+
+```ruby
+#create an mpileup
+reg = Bio::DB::Fasta::Region.new
+reg.entry = "Chr1"
+reg.start = 1
+reg.end = 334
+
+bam.mpileup_cached(:r=>reg,:g => false, :min_cov => 1, :min_per =>0.2) do |pileup|
+	puts pileup.consensus
+end
+bam.mpileup_clear_cache(reg)
+```
+
+
+#### Pileup options
+
+The `mpileup` function takes a range of parameters to allow SAMtools
+level filtering of reads and alignments. They are specified as key =\>
+value pairs eg
+
+```ruby
+bam.mpileup(:r => "Chr1:1000-2000", :Q => 50) do |pileup|
+    ##only pileups on Chr1 between positions 1000-2000 are considered, 
+    ##bases with Quality Score < 50 are excluded
+    ...
+end 
+```
+
+Not all the options SAMtools allows you to pass to mpileup will return a
+Pileup object, The table below lists the SAMtools flags supported and the symbols you can use to call them in
+the mpileup command.
+
+<table><tr><th>SAMtools options</th><th>description</th><th>short symbol</th><th>long symbol</th><th>default</th><th>example</th></tr>
+<tr><td>r</td><td>limit retrieval to a region</td><td>:r</td><td>:region</td><td>all positions</td><td>:r => "Chr1:1000-2000"</td></tr>
+<tr><td>6</td><td>assume Illumina scaled quality scores</td><td>:six</td><td>:illumina_quals</td><td>false</td><td>:six => true</td></tr>
+<tr><td>A</td><td>count anomalous read pairs scores</td><td>:A</td><td>:count_anomalous</td><td>false</td><td>:A => true</td></tr>
+<tr><td>B</td><td>disable BAQ computation</td><td>:B</td><td>:no_baq</td><td>false</td><td>:no_baq => true</td></tr>
+<tr><td>C</td><td>parameter for adjusting mapQ</td><td>:C</td><td>:adjust_mapq</td><td>0</td><td>:C => 25</td></tr>
+<tr><td>d</td><td>max per-BAM depth to avoid excessive memory usage</td><td>:d</td><td>:max_per_bam_depth</td><td>250</td><td>:d => 123</td></tr>
+<tr><td>E</td><td>extended BAQ for higher sensitivity but lower specificity</td><td>:E</td><td>:extended_baq</td><td>false</td><td>:E => true</td></tr>
+<tr><td>G</td><td>exclude read groups listed in FILE</td><td>:G</td><td>:exclude_reads_file</td><td>false</td><td>:G => my_file.txt</td></tr>
+<tr><td>l</td><td>list of positions (chr pos) or regions (BED)</td><td>:l</td><td>:list_of_positions</td><td>false</td><td>:l => my_posns.bed</td></tr>
+<tr><td>M</td><td>cap mapping quality at value</td><td>:M</td><td>:mapping_quality_cap</td><td>60</td><td>:M => 40 </td></tr>
+<tr><td>R</td><td>ignore RG tags</td><td>:R</td><td>:ignore_rg</td><td>false</td><td>:R => true </td></tr>
+<tr><td>q</td><td>skip alignments with mapping quality smaller than value</td><td>:q</td><td>:min_mapping_quality</td><td>0</td><td>:q => 30 </td></tr>
+<tr><td>Q</td><td>skip bases with base quality smaller than value</td><td>:Q</td><td>:imin_base_quality</td><td>13</td><td>:Q => 30</td></tr>
+</table>
+
+
+##Coverage Plots
+You can create images that represent read coverage over binned regions of the reference sequence. The output format is svg. A number of parameters can be changed to alter the style of the plot. In the examples below the bin size and fill_color have been used to create plots with different colours and bar widths.   
+
+The following lines of code...
+
+```ruby
+bam.plot_coverage("Chr1", 201, 2000, :bin=>20, :svg => "out2.svg", :fill_color => '#F1A1B1')
+bam.plot_coverage("Chr1", 201, 2000, :bin=>50, :svg => "out.svg", :fill_color => '#99CCFF')
+bam.plot_coverage("Chr1", 201, 1000, :bin=>250, :svg => "out3.svg", :fill_color => '#33AD5C', :stroke => '#33AD5C')
+```
+
+![Coverage plot 1](http://ethering.github.io/bio-samtools/images/out2.svg)
+![Coverage plot 2](http://ethering.github.io/bio-samtools/images/out.svg)
+![Coverage plot 2](http://ethering.github.io/bio-samtools/images/out3.svg)
+
+The `plot_coverage` method will also return the raw svg code, for further use. Simply leave out a file name and assign the method to a variable.
+
+```ruby
+svg = bam.plot_coverage("Chr1", 201, 2000, :bin=>50, :fill_color => '#99CCFF')
+
+```
+
+
+#VCF methods
+For enhanced snp calling, we've included a VCF class which reflects each non-metadata line of a VCF file.
+The VCF class returns the eight fixed fields present in VCF files, namely chromosome, position, ID, reference base, alt bases, alt quality score, filter and info along with the genotype fields, format and samples. This information allows the comparison of variants and their genotypes across any number of samples.
+The following code takes a number of VCF objects and examines them for homozygous alt (1/1) SNPs
+
+```ruby
+vcfs = []
+vcfs << vcf1 = Bio::DB::Vcf.new("20	14370	rs6054257	G	A	29	0	NS=3;DP=14;AF=0.5;DB;H2	GT:GQ:DP:HQ	0|0:48:1:51,51	1|0:48:8:51,51	1/1:43:5:-1,-1") #from a 3.3 vcf file
+vcfs << vcf2 = Bio::DB::Vcf.new("19	111	.	A	C	9.6	.	.	GT:HQ	0|0:10,10	0/0:10,10	0/1:3,3") #from a 4.0 vcf file
+vcfs << vcf3 = Bio::DB::Vcf.new("20	14380	rs6054257	G	A	29	PASS	NS=3;DP=14;AF=0.5;DB;H2	GT:GQ:DP:HQ	0|0:48:1:51,51	1|0:48:8:51,51	1/1:43:5:.,") #from a 4.0 vcf file
+
+vcfs.each do |vcf|
+	vcf.samples.each do |sample|
+    	genotype = sample[1]['GT']
+    	if genotype == '1/1' or genotype == '1|1'
+        	print vcf.chrom, " "
+        	puts vcf.pos
+    	end
+	end
+end
+
+=> 20 14370
+=> 20 14380
+```
+
+##Other methods not covered
+The SAMtools methods faidx, fixmate, tview, reheader, calmd, targetcut and phase are all included in the current bio-samtools release.
+
+Tests
+-----
+
+The easiest way to run the built-in unit tests is to change to the
+bio-samtools source directory and running 'rake test'
+
+Each test file tests different aspects of the code.
+
+
 
 ## Dependencies
 

data/VERSION

@@ -1 +1 @@
-2.2.0
+2.3.0

data/bio-samtools.gemspec

@@ -2,17 +2,17 @@
 # DO NOT EDIT THIS FILE DIRECTLY
 # Instead, edit Jeweler::Tasks in Rakefile, and run 'rake gemspec'
 # -*- encoding: utf-8 -*-
-# stub: bio-samtools 2.2.0 ruby lib
+# stub: bio-samtools 2.3.0 ruby lib
 # stub: ext/mkrf_conf.rb
 
 Gem::Specification.new do |s|
   s.name = "bio-samtools"
-  s.version = "2.2.0"
+  s.version = "2.3.0"
 
   s.required_rubygems_version = Gem::Requirement.new(">= 0") if s.respond_to? :required_rubygems_version=
   s.require_paths = ["lib"]
   s.authors = ["Ricardo Ramirez-Gonzalez", "Dan MacLean", "Raoul J.P. Bonnal"]
-  s.date = "2014-10-16"
+  s.date = "2015-02-18"
   s.description = "Binder of samtools for ruby, on the top of FFI. \n\n  This project was born from the need to add support of BAM files to \n  the gee_fu genome browser (http://github.com/danmaclean/gee_fu)."
   s.email = "ilpuccio.febo@gmail.com"
   s.executables = ["bam_consensus.rb"]
@@ -145,7 +145,7 @@ Gem::Specification.new do |s|
   ]
   s.homepage = "http://github.com/helios/bioruby-samtools"
   s.licenses = ["MIT"]
-  s.rubygems_version = "2.2.1"
+  s.rubygems_version = "2.2.2"
   s.summary = "Binder of samtools for ruby, on the top of FFI."
 
   if s.respond_to? :specification_version then

data/ext/Rakefile

@@ -24,24 +24,24 @@ task :compile do
       when /linux/
         #sh "CFLAGS='-g -Wall -O2 -fPIC' make -e"
         sh "make"
-        cp("libbam.a","/Users/ramirezr/Documents/public_code/bioruby-samtools/ext/../lib/bio/db/sam/external")
+        cp("libbam.a","/home/ramirezr/Documents/public_code/helios/bioruby-samtools/ext/../lib/bio/db/sam/external")
         #sh "CFLAGS='-g -Wall -O2 -fPIC' make -e libbam.so.1-local"
         sh "make libbam.so.1-local"
-        cp("samtools", "/Users/ramirezr/Documents/public_code/bioruby-samtools/ext/../lib/bio/db/sam/external")
-        cp("libbam.so.1","/Users/ramirezr/Documents/public_code/bioruby-samtools/ext/../lib/bio/db/sam/external")
+        cp("samtools", "/home/ramirezr/Documents/public_code/helios/bioruby-samtools/ext/../lib/bio/db/sam/external")
+        cp("libbam.so.1","/home/ramirezr/Documents/public_code/helios/bioruby-samtools/ext/../lib/bio/db/sam/external")
       when /darwin/
         sh "make"
-        cp("libbam.a","/Users/ramirezr/Documents/public_code/bioruby-samtools/ext/../lib/bio/db/sam/external")
+        cp("libbam.a","/home/ramirezr/Documents/public_code/helios/bioruby-samtools/ext/../lib/bio/db/sam/external")
         sh "make libbam.1.dylib-local"
-        cp("libbam.1.dylib","/Users/ramirezr/Documents/public_code/bioruby-samtools/ext/../lib/bio/db/sam/external")
+        cp("libbam.1.dylib","/home/ramirezr/Documents/public_code/helios/bioruby-samtools/ext/../lib/bio/db/sam/external")
         sh "make"
-        cp('samtools', "/Users/ramirezr/Documents/public_code/bioruby-samtools/ext/../lib/bio/db/sam/external")      
+        cp('samtools', "/home/ramirezr/Documents/public_code/helios/bioruby-samtools/ext/../lib/bio/db/sam/external")      
       when /mswin|mingw/ then raise NotImplementedError, "BWA library is not available for Windows platform"  
     end #case
   end #cd
   cd("samtools-0.1.19/bcftools") do
     sh "make"
-    cp('bcftools', "/Users/ramirezr/Documents/public_code/bioruby-samtools/ext/../lib/bio/db/sam/external")
+    cp('bcftools', "/home/ramirezr/Documents/public_code/helios/bioruby-samtools/ext/../lib/bio/db/sam/external")
   end
 end
   

data/lib/bio/db/vcf.rb

@@ -23,7 +23,30 @@ module Bio
       def int_or_raw(x)
         Integer.new(x) rescue x
       end
-    
+      
+      #returns vcf format line
+      def to_s
+        if !@chrom.nil? 
+          str = [@chrom, @pos, @id, @ref, @alt, @qual.to_i, @filter, ""].join("\t")
+          #@format, @samples]
+          infos=[]
+          info.each do|key,val|
+            infos << "#{key}=#{val}"
+          end
+          str << infos.join(";")
+          str << "\t#{@format}\t"
+          samples.each do |key, val|
+            array=[]
+            val.each do |keys, vals|
+              array << "#{vals}"
+            end
+            str << array.join(":")
+            str << "\t"
+          end
+        end
+        str
+      end
+
       #gets the info in the Vcf lines and parses it, setting the attributes
       def parse_line(line, sample_names=nil)
         return false if line[0,1] == '#'

data/test/samples/small/testu.bed

@@ -1,2 +1,2 @@
 chr_1	1	30
-chr_1	40	45
+

metadata

@@ -1,7 +1,7 @@
 --- !ruby/object:Gem::Specification
 name: bio-samtools
 version: !ruby/object:Gem::Version
-  version: 2.2.0
+  version: 2.3.0
 platform: ruby
 authors:
 - Ricardo Ramirez-Gonzalez
@@ -10,7 +10,7 @@ authors:
 autorequire: 
 bindir: bin
 cert_chain: []
-date: 2014-10-16 00:00:00.000000000 Z
+date: 2015-02-18 00:00:00.000000000 Z
 dependencies:
 - !ruby/object:Gem::Dependency
   name: bio-svgenes
@@ -332,7 +332,7 @@ required_rubygems_version: !ruby/object:Gem::Requirement
       version: '0'
 requirements: []
 rubyforge_project: 
-rubygems_version: 2.2.1
+rubygems_version: 2.2.2
 signing_key: 
 specification_version: 4
 summary: Binder of samtools for ruby, on the top of FFI.