bio-restriction_enzyme 1.0.0

data/test/bio-restriction_enzyme/double_stranded/test_cut_location_pair_in_enzyme_notation.rb

@@ -0,0 +1,56 @@
+load Pathname.new(File.join(File.dirname(__FILE__), ['..']*2, 'helper.rb')).cleanpath.to_s
+
+require 'bio/util/restriction_enzyme/double_stranded/cut_location_pair_in_enzyme_notation'
+
+class TestBioRestrictionEnzymeDoubleStrandedCutLocationPairInEnzymeNotation < Test::Unit::TestCase
+
+  def setup
+    @t = Bio::RestrictionEnzyme::DoubleStranded::CutLocationPairInEnzymeNotation
+
+    @obj_1 = @t.new([3,5])
+    @obj_2 = @t.new(3, 5)
+    @obj_3 = @t.new((3..5))
+    @obj_4 = @t.new(-3..5)
+    @obj_5 = @t.new(3)
+    @obj_6 = @t.new(nil,3)
+    @obj_7 = @t.new(3,nil)
+  end
+
+  def test_contents
+    assert_equal([3,5], @obj_1)
+    assert_equal([3,5], @obj_2)
+    assert_equal([3,5], @obj_3)
+    assert_equal([-3,5], @obj_4)
+    assert_equal([3,nil], @obj_5)
+    assert_equal([nil,3], @obj_6)
+    assert_equal([3,nil], @obj_7)
+  end
+
+  def test_primary
+    assert_equal(3, @obj_1.primary)
+    assert_equal(3, @obj_2.primary)
+    assert_equal(3, @obj_3.primary)
+    assert_equal(-3, @obj_4.primary)
+    assert_equal(3, @obj_5.primary)
+    assert_equal(nil, @obj_6.primary)
+    assert_equal(3, @obj_7.primary)
+  end
+
+  def test_complement
+    assert_equal(5, @obj_1.complement)
+    assert_equal(5, @obj_2.complement)
+    assert_equal(5, @obj_3.complement)
+    assert_equal(5, @obj_4.complement)
+    assert_equal(nil, @obj_5.complement)
+    assert_equal(3, @obj_6.complement)
+    assert_equal(nil, @obj_7.complement)
+  end
+
+  def test_argument_error
+    assert_raise(ArgumentError) { @t.new([3,5,6]) }
+    assert_raise(ArgumentError) { @t.new(0,1) }
+    assert_raise(ArgumentError) { @t.new(0,0) }
+    assert_raise(ArgumentError) { @t.new('3',5) }
+  end
+
+end

data/test/bio-restriction_enzyme/double_stranded/test_cut_locations.rb

@@ -0,0 +1,35 @@
+load Pathname.new(File.join(File.dirname(__FILE__), ['..']*2, 'helper.rb')).cleanpath.to_s
+
+require 'bio/util/restriction_enzyme/double_stranded/cut_locations'
+
+class TestBioRestrictionEnzymeDoubleStrandedCutLocations < Test::Unit::TestCase
+
+  def setup
+    @t = Bio::RestrictionEnzyme::DoubleStranded::CutLocationPair
+    @tt = Bio::RestrictionEnzyme::DoubleStranded::CutLocations
+
+    @obj_1 = @t.new([3,5])
+    @obj_2 = @t.new(3, 5)
+    @obj_3 = @t.new((3..5))
+    @obj_4 = @t.new(3..5)
+    @obj_5 = @t.new(3)
+    @obj_6 = @t.new(nil,3)
+    @obj_7 = @t.new(3,nil)
+
+    @locations = @tt.new(@obj_1, @obj_2, @obj_3, @obj_4, @obj_5, @obj_6, @obj_7)
+  end
+
+  def test_contents
+    assert_equal([3,5], @locations[0])
+    assert_equal([3,nil], @locations[-1])
+  end
+
+  def test_primary
+    assert_equal([3, 3, 3, 3, 3, nil, 3], @locations.primary)
+  end
+
+  def test_complement
+    assert_equal([5, 5, 5, 5, nil, 3, nil], @locations.complement)
+  end
+
+end

data/test/bio-restriction_enzyme/double_stranded/test_cut_locations_in_enzyme_notation.rb

@@ -0,0 +1,87 @@
+load Pathname.new(File.join(File.dirname(__FILE__), ['..']*2, 'helper.rb')).cleanpath.to_s
+
+require 'bio/util/restriction_enzyme/double_stranded/cut_locations_in_enzyme_notation'
+
+class TestBioRestrictionEnzymeDoubleStrandedCutLocationsInEnzymeNotation < Test::Unit::TestCase
+
+  def setup
+    @t = Bio::RestrictionEnzyme::DoubleStranded::CutLocationPairInEnzymeNotation
+    @tt = Bio::RestrictionEnzyme::DoubleStranded::CutLocationsInEnzymeNotation
+
+    @obj_1 = @t.new([3,5])
+    @obj_2 = @t.new(3, 5)
+    @obj_3 = @t.new((3..5))
+    @obj_4 = @t.new(-3..5)
+    @obj_5 = @t.new(3)
+    @obj_6 = @t.new(nil,3)
+    @obj_7 = @t.new(3,nil)
+    @obj_8 = @t.new(-8, -7)
+
+    @locations = @tt.new(@obj_1, @obj_2, @obj_3, @obj_4, @obj_5, @obj_6, @obj_7, @obj_8)
+    @loc_2 = @tt.new(@t.new(-2,-2), @t.new(1,1))
+    @loc_3 = @tt.new(@t.new(1,2))
+  end
+
+  def test_contents
+    assert_equal([3,5], @locations[0])
+    assert_equal([3,nil], @locations[-2])
+  end
+
+  def test_primary
+    assert_equal([3, 3, 3, -3, 3, nil, 3, -8], @locations.primary)
+  end
+
+  def test_complement
+    assert_equal([5, 5, 5, 5, nil, 3, nil, -7], @locations.complement)
+  end
+
+  def test_primary_to_array_index
+    assert_equal([10, 10, 10, 5, 10, nil, 10, 0], @locations.primary_to_array_index)
+    assert_equal([0,2], @loc_2.primary_to_array_index)
+    assert_equal([0], @loc_3.primary_to_array_index)
+  end
+
+  def test_primary_to_array_index_class
+    assert_equal(Array, @locations.primary_to_array_index.class)
+    assert_equal(Array, @loc_2.primary_to_array_index.class)
+  end
+
+  def test_complement_to_array_index
+    assert_equal([12, 12, 12, 12, nil, 10, nil, 1], @locations.complement_to_array_index)
+    assert_equal([0,2], @loc_2.complement_to_array_index)
+    assert_equal([1], @loc_3.complement_to_array_index)
+  end
+
+  def test_complement_to_array_index_class
+    assert_equal(Array, @locations.complement_to_array_index.class)
+    assert_equal(Array, @loc_2.complement_to_array_index.class)
+  end
+
+  def test_to_array_index
+    assert_equal(
+      [
+        [10, 12],
+        [10, 12],
+        [10, 12],
+        [5, 12],
+        [10, nil],
+        [nil, 10],
+        [10, nil],
+        [0, 1]
+      ], @locations.to_array_index)
+
+    assert_equal(
+      [
+        [0, 0],
+        [2, 2],
+      ], @loc_2.to_array_index)
+
+    assert_equal([[0,1]], @loc_3.to_array_index)
+  end
+
+  def test_to_array_index_class
+    assert_equal(Bio::RestrictionEnzyme::DoubleStranded::CutLocations, @locations.to_array_index.class)
+    assert_equal(Bio::RestrictionEnzyme::DoubleStranded::CutLocations, @loc_2.to_array_index.class)
+  end
+
+end

data/test/bio-restriction_enzyme/single_strand/test_cut_locations_in_enzyme_notation.rb

@@ -0,0 +1,66 @@
+load Pathname.new(File.join(File.dirname(__FILE__), ['..']*2, 'helper.rb')).cleanpath.to_s
+
+require 'bio/util/restriction_enzyme/single_strand/cut_locations_in_enzyme_notation'
+
+class TestBioRestrictionEnzymeSingleStrandCutLocationsInEnzymeNotation < Test::Unit::TestCase
+
+  def setup
+    @t = Bio::RestrictionEnzyme::SingleStrand::CutLocationsInEnzymeNotation
+    @obj_1 = @t.new([-2,1,3])
+    @obj_2 = @t.new(-2,1,3)
+    @obj_3 = @t.new(7,1,3)
+
+    @obj_4 = @t.new(-7,-8,-2,1,3)
+  end
+
+  def test_max
+    assert_equal(3, @obj_1.max)
+    assert_equal(3, @obj_2.max)
+    assert_equal(7, @obj_3.max)
+  end
+
+  def test_min
+    assert_equal(-2, @obj_1.min)
+    assert_equal(-2, @obj_2.min)
+    assert_equal(1, @obj_3.min)
+  end
+
+  def test_to_array_index
+    assert_equal([0,2,4], @obj_1.to_array_index)
+    assert_equal([0,2,4], @obj_2.to_array_index)
+    assert_equal([0,2,6], @obj_3.to_array_index)
+
+    assert_equal([0, 1, 6, 8, 10], @obj_4.to_array_index)
+  end
+
+  def test_initialize_with_pattern
+    @obj_5 = @t.new('n^ng^arraxt^n')
+    @obj_6 = @t.new('g^arraxt^n')
+    @obj_7 = @t.new('nnn^nn^nga^rraxt^nn')
+    @obj_8 = @t.new('^g^arraxt^n')
+
+    assert_equal([-2,1,7], @obj_5)
+    assert_equal([0,2,8], @obj_5.to_array_index)
+
+    assert_equal([1,7], @obj_6)
+    assert_equal([0,6], @obj_6.to_array_index)
+
+    assert_equal([-4, -2, 2, 7], @obj_7)
+    assert_equal([0, 2, 5, 10], @obj_7.to_array_index)
+
+    assert_equal([-1,1,7], @obj_8)
+    assert_equal([0,1,7], @obj_8.to_array_index)
+  end
+
+  def test_argument_error
+    assert_raise(ArgumentError) { @t.new([0,1,2]) }
+    assert_raise(ArgumentError) { @t.new(0,1,2,0) }
+
+    assert_raise(ArgumentError) { @t.new([nil,1,2]) }
+    assert_raise(ArgumentError) { @t.new(nil,1,2,nil) }
+
+    assert_raise(ArgumentError) { @t.new([1,1,2]) }
+    assert_raise(ArgumentError) { @t.new(1,1,2,2) }
+  end
+
+end

data/test/bio-restriction_enzyme/test_analysis.rb

@@ -0,0 +1,228 @@
+load Pathname.new(File.join(File.dirname(__FILE__), ['..'], 'helper.rb')).cleanpath.to_s
+
+require 'bio/util/restriction_enzyme/analysis'
+require 'bio/sequence'
+
+class TestBioRestrictionEnzymeAnalysis < Test::Unit::TestCase
+
+  def setup
+    @enz = Bio::RestrictionEnzyme
+    @t = Bio::RestrictionEnzyme::Analysis
+
+    @obj_1 = @t.cut('cagagag', 'ag^ag')
+    @obj_2 = @t.cut('agagag', 'ag^ag')
+    @obj_3 = @t.cut('cagagagt', 'ag^ag')
+
+    e1 = @enz.new('atgcatgc', [3,3])
+    @obj_4 = @t.cut('atgcatgcatgc', e1)
+
+    @obj_4bd = @t.cut('atgcatgcatgccc', e1, 'cc^c') # mix of always cut and sometimes cut
+
+    e2 = @enz.new('atgcatgc', [3,5])
+    @obj_5 = @t.cut('atgcatgcatgc', e2)
+
+    e3 = @enz.new('anna', [1,1], [3,3])
+    e4 = @enz.new('gg', [1,1])
+    @obj_6 = @t.cut('agga', e3, e4)
+
+    @obj_7 = @t.cut('gaccaggaaaaagaccaggaaagcctggaaaagttaac', 'EcoRII')
+    @obj_7b = @t.cut('gaccaggaaaaagaccaggaaagcctggaaaagttaaccc', 'EcoRII', 'HincII', 'cc^c')
+    @obj_7bd = @t.cut_without_permutations('gaccaggaaaaagaccaggaaagcctggaaaagttaaccc', 'EcoRII', 'HincII', 'cc^c')
+
+    @obj_8 = @t.cut('gaccaggaaaaagaccaggaaagcctggaaaagttaac', 'EcoRII', 'HincII')
+
+    @obj_9 = @t.cut('aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa', 'EcoRII')
+    @obj_9 = @t.cut('aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa', 'EcoRII', 'HincII')
+
+    @obj_1d = @t.cut_without_permutations('cagagag', 'ag^ag')
+    @obj_2d = @t.cut_without_permutations('agagag', 'ag^ag')
+    @obj_3d = @t.cut_without_permutations('cagagagt', 'ag^ag')
+
+    e1 = @enz.new('atgcatgc', [3,3])
+    @obj_4d = @t.cut_without_permutations('atgcatgcatgc', e1)
+
+    e2 = @enz.new('atgcatgc', [3,5])
+    @obj_5d = @t.cut_without_permutations('atgcatgcatgc', e2)
+
+    e3 = @enz.new('anna', [1,1], [3,3])
+    e4 = @enz.new('gg', [1,1])
+    @obj_6d = @t.cut_without_permutations('agga', e3, e4)
+
+    @obj_7d = @t.cut_without_permutations('gaccaggaaaaagaccaggaaagcctggaaaagttaac', 'EcoRII')
+    @obj_8d = @t.cut_without_permutations('gaccaggaaaaagaccaggaaagcctggaaaagttaac', 'EcoRII', 'HincII')
+
+    @obj_98 = @t.cut('', 'EcoRII', 'HincII')
+    @obj_99 = @t.cut_without_permutations('', 'EcoRII', 'HincII')
+
+    @obj_vr1 = @t.cut('gaccaggaaaaagaccaggaaagcctggaaaagttaac', 'EcoRII', {:view_ranges => true})
+    @obj_vr2 = @t.cut('cagagag', {:view_ranges => true}, 'ag^ag')
+  end
+
+  def test_cut
+    assert_equal(["ag", "cag"], @obj_1.primary)
+    assert_equal(["gtc", "tc"], @obj_1.complement)
+    assert_equal(2, @obj_1.size)
+    assert_equal(Bio::RestrictionEnzyme::Fragments, @obj_1.class)
+    assert_equal(Bio::RestrictionEnzyme::Fragment, @obj_1[0].class)
+
+    assert_equal(["ag"], @obj_2.primary)
+    assert_equal(["ag", "agt", "cag"], @obj_3.primary)
+    assert_equal(["atg", "atgcatg", "catg", "catgc"], @obj_4.primary)
+
+=begin
+    A T G^C A T G C
+
+    A T G C A T G C A T G C
+
+    A T G^C A T G^C A T G C
+
+    A T G C A T G^C A T G C
+=end
+
+    assert_equal(["atg", "atgcatg", "catgc", "catgcatgc"], @obj_5.primary)
+    assert_equal(["a", "ag", "g", "ga"], @obj_6.primary)
+    assert_equal(["ccaggaaaaaga", "ccaggaaag", "cctggaaaagttaac", "ga"], @obj_7.primary)
+    assert_equal(["aac", "ccaggaaaaaga", "ccaggaaag", "cctggaaaagtt", "ga"], @obj_8.primary)
+
+=begin
+    e1 = @enz.new('atgcatgc', [3,3])
+    @obj_4bd = @t.cut('atgcatgcatgccc', e1, 'cc^c') # mix of sometimes cut and always cut
+
+    [#<struct Bio::RestrictionEnzyme::Analysis::UniqueFragment
+      primary="atgcatg",
+      complement="tacgtac">,
+     #<struct Bio::RestrictionEnzyme::Analysis::UniqueFragment
+      primary="catgcc",
+      complement="gtacg ">,
+     #<struct Bio::RestrictionEnzyme::Analysis::UniqueFragment
+      primary=" c",
+      complement="gg">,
+     #<struct Bio::RestrictionEnzyme::Analysis::UniqueFragment
+      primary="atg",
+      complement="tac">,
+     #<struct Bio::RestrictionEnzyme::Analysis::UniqueFragment
+      primary="catg",
+      complement="gtac">]
+=end
+    assert_equal(["atg", "atgcatg", "c", "catg", "catgcc"], @obj_4bd.primary)
+    assert_equal(["gg", "gtac", "gtacg", "tac", "tacgtac"], @obj_4bd.complement)
+  end
+
+  def test_cut_without_permutations
+    assert_equal(["ag", "cag"], @obj_1d.primary)
+    assert_equal(["ag"], @obj_2d.primary)
+    assert_equal(["ag", "agt", "cag"], @obj_3d.primary)
+    assert_equal(["atg", "catg", "catgc"], @obj_4d.primary)
+    assert_equal(["atg", "catg", "catgc"], @obj_5d.primary)
+    assert_equal(["a", "g"], @obj_6d.primary)
+    assert_equal(["ccaggaaaaaga", "ccaggaaag", "cctggaaaagttaac", "ga"], @obj_7d.primary)
+    assert_equal(["aac", "ccaggaaaaaga", "ccaggaaag", "cctggaaaagtt", "ga"], @obj_8d.primary)
+  end
+
+  def test_cut_from_bio_sequence_na
+    assert_equal(["ag", "cag"], Bio::Sequence::NA.new('cagagag').cut_with_enzyme('ag^ag').primary )
+    assert_equal(["ag", "cag"], Bio::Sequence::NA.new('cagagag').cut_with_enzymes('ag^ag').primary )
+    assert_equal(["ag", "cag"], Bio::Sequence::NA.new('cagagag').cut_with_enzymes('ag^ag', 'EcoRII').primary )
+
+    # Note how EcoRII needs extra padding on the beginning and ending of the
+    # sequence 'ccagg' to make the match since the cut must occur between
+    # two nucleotides and can not occur on the very end of the sequence.
+    #
+    #   EcoRII:
+    #     :blunt: "0"
+    #     :c2: "5"
+    #     :c4: "0"
+    #     :c1: "-1"
+    #     :pattern: CCWGG
+    #     :len: "5"
+    #     :name: EcoRII
+    #     :c3: "0"
+    #     :ncuts: "2"
+    #
+    #        -1 1 2 3 4 5
+    #   5' - n^c c w g g n - 3'
+    #   3' - n g g w c c^n - 5'
+    #
+    #   (w == [at])
+
+    assert_equal(["ag", "agccagg", "cag"], Bio::Sequence::NA.new('cagagagccagg').cut_with_enzymes('ag^ag', 'EcoRII').primary )
+    assert_equal(["ag", "agccagg", "cag"], Bio::Sequence::NA.new('cagagagccagg').cut_with_enzymes('ag^ag').primary )
+    assert_equal(:no_cuts_found, Bio::Sequence::NA.new('cagagagccagg').cut_with_enzymes('EcoRII') )
+
+    assert_equal(["ag", "ag", "cag", "ccaggt"], Bio::Sequence::NA.new('cagagagccaggt').cut_with_enzymes('ag^ag', 'EcoRII').primary )
+    assert_equal(["ag", "agccaggt", "cag"], Bio::Sequence::NA.new('cagagagccaggt').cut_with_enzymes('ag^ag').primary )
+    assert_equal(["cagagag", "ccaggt"], Bio::Sequence::NA.new('cagagagccaggt').cut_with_enzymes('EcoRII').primary )
+    assert_equal(["a", "gtctctcggtcc"], Bio::Sequence::NA.new('cagagagccaggt').cut_with_enzymes('EcoRII').complement )
+  end
+
+  def test_view_ranges
+    assert_equal(["ccaggaaaaaga", "ccaggaaag", "cctggaaaagttaac", "ga"], @obj_vr1.primary)
+    assert_equal(["ctggtcc", "tttcggacc", "ttttcaattg", "tttttctggtcc"], @obj_vr1.complement)
+
+    a0 = @obj_vr1[0]
+    assert_equal('ga     ', a0.primary)
+    assert_equal('ctggtcc', a0.complement)
+    assert_equal(0, a0.p_left)
+    assert_equal(1, a0.p_right)
+    assert_equal(0, a0.c_left)
+    assert_equal(6, a0.c_right)
+
+    a1 = @obj_vr1[1]
+    assert_equal('ccaggaaaaaga     ', a1.primary)
+    assert_equal('     tttttctggtcc', a1.complement)
+    assert_equal(2,  a1.p_left)
+    assert_equal(13, a1.p_right)
+    assert_equal(7,  a1.c_left)
+    assert_equal(18, a1.c_right)
+
+    a2 = @obj_vr1[2]
+    assert_equal('ccaggaaag     ', a2.primary)
+    assert_equal('     tttcggacc', a2.complement)
+    assert_equal(14, a2.p_left)
+    assert_equal(22, a2.p_right)
+    assert_equal(19, a2.c_left)
+    assert_equal(27, a2.c_right)
+
+    a3 = @obj_vr1[3]
+    assert_equal('cctggaaaagttaac', a3.primary)
+    assert_equal('     ttttcaattg', a3.complement)
+    assert_equal(23, a3.p_left)
+    assert_equal(37, a3.p_right)
+    assert_equal(28, a3.c_left)
+    assert_equal(37, a3.c_right)
+
+    a4 = @obj_vr1[4]
+    assert_equal(nil, a4)
+
+    assert_equal(["ag", "ag", "cag"], @obj_vr2.primary)
+    assert_equal(["gtc", "tc", "tc"], @obj_vr2.complement)
+
+    a0 = @obj_vr2[0]
+    assert_equal('cag', a0.primary)
+    assert_equal('gtc', a0.complement)
+    assert_equal(0, a0.p_left)
+    assert_equal(2, a0.p_right)
+    assert_equal(0, a0.c_left)
+    assert_equal(2, a0.c_right)
+
+    a1 = @obj_vr2[1]
+    assert_equal('ag', a1.primary)
+    assert_equal('tc', a1.complement)
+    assert_equal(3, a1.p_left)
+    assert_equal(4, a1.p_right)
+    assert_equal(3, a1.c_left)
+    assert_equal(4, a1.c_right)
+
+    a2 = @obj_vr2[2]
+    assert_equal('ag', a2.primary)
+    assert_equal('tc', a2.complement)
+    assert_equal(5, a2.p_left)
+    assert_equal(6, a2.p_right)
+    assert_equal(5, a2.c_left)
+    assert_equal(6, a2.c_right)
+
+    a3 = @obj_vr2[3]
+    assert_equal(nil, a3)
+  end
+
+end