bio-polyploid-tools 0.5.2 → 0.6.0
This diff represents the content of publicly available package versions that have been released to one of the supported registries. The information contained in this diff is provided for informational purposes only and reflects changes between package versions as they appear in their respective public registries.
- checksums.yaml +4 -4
- data/VERSION +1 -1
- data/bin/polymarker.rb +44 -15
- data/bin/snp_position_to_polymarker.rb +1 -1
- data/bio-polyploid-tools.gemspec +7 -3
- data/lib/bio/PolyploidTools/SNP.rb +8 -2
- data/lib/bio/PolyploidTools/SNPMutant.rb +85 -0
- data/lib/bio/PolyploidTools/SNPSequence.rb +8 -8
- data/lib/bio/db/primer3.rb +139 -108
- data/test/data/IWGSC_CSS_1AL_scaff_1455974.fa +112 -0
- data/test/data/IWGSC_CSS_1AL_scaff_1455974_aln_contigs.fa +2304 -0
- data/test/data/test_from_mutant.csv +3 -0
- data/test/test_snp_parsing.rb +27 -0
- metadata +6 -2
    
        data/test/test_snp_parsing.rb
    CHANGED
    
    | @@ -10,6 +10,7 @@ class TestPolyploidTools < Test::Unit::TestCase | |
| 10 10 |  | 
| 11 11 | 
             
              #Set up the paths
         | 
| 12 12 | 
             
              def setup
         | 
| 13 | 
            +
                @data = File.expand_path(File.dirname(__FILE__) + "/data")
         | 
| 13 14 |  | 
| 14 15 | 
             
              end
         | 
| 15 16 |  | 
| @@ -37,5 +38,31 @@ class TestPolyploidTools < Test::Unit::TestCase | |
| 37 38 | 
             
                assert(snp.template_sequence == "CGAAGCGATCCTACTACATTGCGTTCCTTTCCCACTCCCAGGTCCCCCTAYATGCAGGATCTTGATTAGTCGTGTGAACAACTGAAATTTGAGCGCCACAA", "#{snp.template_sequence}!=CGAAGCGATCCTACTACATTGCGTTCCTTTCCCACTCCCAGGTCCCCCTAYATGCAGGATCTTGATTAGTCGTGTGAACAACTGAAATTTGAGCGCCACAA")
         | 
| 38 39 | 
             
                #true
         | 
| 39 40 | 
             
              end
         | 
| 41 | 
            +
             | 
| 42 | 
            +
              def test_mutant_snp
         | 
| 43 | 
            +
             | 
| 44 | 
            +
                ref=@data + "/IWGSC_CSS_1AL_scaff_1455974_aln_contigs.fa"
         | 
| 45 | 
            +
                
         | 
| 46 | 
            +
                fasta_reference_db = Bio::DB::Fasta::FastaFile.new({:fasta=>ref})
         | 
| 47 | 
            +
                fasta_reference_db.load_fai_entries 
         | 
| 48 | 
            +
                
         | 
| 49 | 
            +
                snp = Bio::PolyploidTools::SNPMutant.parse("IWGSC_CSS_1AL_scaff_1455974,Kronos2281,127,C,T")
         | 
| 50 | 
            +
                assert_equal(snp.gene , "1AL_1455974_Kronos2281_127", "The original name was not parsed: #{snp.gene}")
         | 
| 51 | 
            +
                assert_equal(snp.contig, "IWGSC_CSS_1AL_scaff_1455974")
         | 
| 52 | 
            +
                assert_equal(snp.chromosome, "1A", "The chromosome wasnt parsed: #{snp.chromosome}")
         | 
| 53 | 
            +
                assert_equal(snp.position, 127, "The position is not parsed: #{snp.position}")
         | 
| 54 | 
            +
                
         | 
| 55 | 
            +
                region = fasta_reference_db.index.region_for_entry(snp.contig).get_full_region
         | 
| 56 | 
            +
                snp.full_sequence = fasta_reference_db.fetch_sequence(region)
         | 
| 57 | 
            +
             | 
| 58 | 
            +
                assert_equal(snp.template_sequence, "actcgatcgtcagcacccgctggaacttggggaacgtcttgaacgccgcaagcaccggggcgtcctctgactgtatgagcacgcgctgcttacaggtctcYttgtcgtacccggacttgacaagcgctttggagaccgcatccaccacgtcaaggcttctggctataaggtacgtagcatgctgcactcggtaggtacaaga")
         | 
| 59 | 
            +
                assert_equal(snp.sequence_original, "actcgatcgtcagcacccgctggaacttggggaacgtcttgaacgccgcaagcaccggggcgtcctctgactgtatgagcacgcgctgcttacaggtctc[C/T]ttgtcgtacccggacttgacaagcgctttggagaccgcatccaccacgtcaaggcttctggctataaggtacgtagcatgctgcactcggtaggtacaaga")
         | 
| 60 | 
            +
                assert_equal(snp.position, 101)
         | 
| 61 | 
            +
                assert_equal(snp.original, "C")
         | 
| 62 | 
            +
                assert_equal(snp.snp, "T")
         | 
| 63 | 
            +
                
         | 
| 64 | 
            +
                
         | 
| 65 | 
            +
              end
         | 
| 66 | 
            +
             | 
| 40 67 |  | 
| 41 68 | 
             
            end
         | 
    
        metadata
    CHANGED
    
    | @@ -1,14 +1,14 @@ | |
| 1 1 | 
             
            --- !ruby/object:Gem::Specification
         | 
| 2 2 | 
             
            name: bio-polyploid-tools
         | 
| 3 3 | 
             
            version: !ruby/object:Gem::Version
         | 
| 4 | 
            -
              version: 0. | 
| 4 | 
            +
              version: 0.6.0
         | 
| 5 5 | 
             
            platform: ruby
         | 
| 6 6 | 
             
            authors:
         | 
| 7 7 | 
             
            - Ricardo H.  Ramirez-Gonzalez
         | 
| 8 8 | 
             
            autorequire: 
         | 
| 9 9 | 
             
            bindir: bin
         | 
| 10 10 | 
             
            cert_chain: []
         | 
| 11 | 
            -
            date:  | 
| 11 | 
            +
            date: 2015-02-15 00:00:00.000000000 Z
         | 
| 12 12 | 
             
            dependencies:
         | 
| 13 13 | 
             
            - !ruby/object:Gem::Dependency
         | 
| 14 14 | 
             
              name: bio
         | 
| @@ -162,6 +162,7 @@ files: | |
| 162 162 | 
             
            - lib/bio/PolyploidTools/Marker.rb
         | 
| 163 163 | 
             
            - lib/bio/PolyploidTools/PrimerRegion.rb
         | 
| 164 164 | 
             
            - lib/bio/PolyploidTools/SNP.rb
         | 
| 165 | 
            +
            - lib/bio/PolyploidTools/SNPMutant.rb
         | 
| 165 166 | 
             
            - lib/bio/PolyploidTools/SNPSequence.rb
         | 
| 166 167 | 
             
            - lib/bio/db/exonerate.rb
         | 
| 167 168 | 
             
            - lib/bio/db/primer3.rb
         | 
| @@ -172,6 +173,8 @@ files: | |
| 172 173 | 
             
            - test/data/BS00068396_51_contigs.fa
         | 
| 173 174 | 
             
            - test/data/BS00068396_51_exonerate.tab
         | 
| 174 175 | 
             
            - test/data/BS00068396_51_genes.txt
         | 
| 176 | 
            +
            - test/data/IWGSC_CSS_1AL_scaff_1455974.fa
         | 
| 177 | 
            +
            - test/data/IWGSC_CSS_1AL_scaff_1455974_aln_contigs.fa
         | 
| 175 178 | 
             
            - test/data/LIB1716.bam
         | 
| 176 179 | 
             
            - test/data/LIB1716.bam.bai
         | 
| 177 180 | 
             
            - test/data/LIB1719.bam
         | 
| @@ -192,6 +195,7 @@ files: | |
| 192 195 | 
             
            - test/data/patological_cases5D.csv
         | 
| 193 196 | 
             
            - test/data/primer_3_input_header_test
         | 
| 194 197 | 
             
            - test/data/short_primer_design_test.csv
         | 
| 198 | 
            +
            - test/data/test_from_mutant.csv
         | 
| 195 199 | 
             
            - test/data/test_iselect.csv
         | 
| 196 200 | 
             
            - test/data/test_iselect_reference.fa
         | 
| 197 201 | 
             
            - test/data/test_iselect_reference.fa.fai
         |