bio-maf 0.1.0 → 0.2.0

data/man/maf_tile.1.ronn

@@ -0,0 +1,104 @@
+maf_tile(1) -- synthesize an alignment for a given region
+=========================================================
+
+## SYNOPSIS
+
+`maf_tile` [<options>] -i BEGIN:END [-s SPECIES[:NAME] ...] <maf> <index>
+
+`maf_tile` [<options>] --bed BED -o BASE [-s SPECIES[:NAME] ...] <maf> <index>
+
+## DESCRIPTION
+
+**maf_tile** takes a MAF file with index (generated by maf_index(1)),
+extracts alignment blocks overlapping the given genomic interval, and
+constructs a single alignment block covering the entire interval for
+the specified species. Optionally, any gaps in coverage of the MAF
+file's reference sequence can be filled in from a FASTA sequence file.
+
+If a single interval is specified, the output will be written to
+stdout in FASTA format. If the `--output-base` option is specified,
+`_<start>:<end>.fa` will be appended to the given <base> parameter and
+used to construct the output path. If a BED file is specified with
+`--bed`, `--output-base` is also required.
+
+Species can be renamed for output by specifying them as SPECIES:NAME;
+the first component will be used to select the species from the MAF
+file, and the second will be used in the FASTA description line for
+output.
+
+## OPTIONS
+
+ * `-r`, `--reference SEQ`:
+   The FASTA reference sequence file given, which may be gzipped, will
+   be used to fill in any gaps between alignment blocks.
+
+ * `-i`, `--interval BEGIN:END`:
+   The given zero-based genomic interval will be used to select
+   alignment blocks from the MAF file.
+
+ * `-s`, `--species SPECIES[:NAME]`:
+   The given species will be selected for output. If given as
+   `species:name`, it will appear in the FASTA output as <name>.
+
+ * `-b`, `--bed BED`:
+   The given BED file will be used to provide a list of intervals to
+   process. If present, `--interval` will be ignored and
+   `--output-base` must be given as well.
+
+ * `-o`, `--output-base BASE`:
+   The given path will be used as the base name for output files, as
+   described above.
+
+## EXAMPLES
+
+Generate an alignment of the `hg19`, `petMar1`, and `ornAna1`
+sequences from `chrY.maf` over the interval 14400 to 15000 on the
+reference sequence of the MAF file. Fills in gaps from
+`chrY.refseq.fa.gz`. Writes FASTA output to stdout.
+
+    $ maf_tile --reference ~/maf/chrY.refseq.fa.gz \
+      --interval 14400:15000 \
+      -s hg19:human -s petMar1 -s ornAna1 \
+      chrY.maf chrY.kct
+    >human
+    GGGTGACGAAAAGAGCCGA-----[...]
+    >petMar1
+    gagtgccggggagtgccggggagt[...]
+    >ornAna1
+    AGGGATCTGGGAATTCTGG-----[...]
+
+Write out a FASTA file for each interval in the given BED file,
+prefixed with `/tmp/mm8`, and without filling in data from a reference
+sequence:
+
+    $ maf_tile --bed /tmp/mm8.bed --output-base /tmp/mm8 \
+      -s mm8:mouse -s rn4:rat -s hg18:human \
+      mm8_chr7_tiny.maf mm8_chr7_tiny.kct
+
+## FILES
+
+The output is generated in FASTA format, with one sequence per
+species.
+
+The input <maf> file must be a Multiple Alignment Format file.
+
+The <index> must be a MAF index built with maf_index(1).
+
+If `--bed` <bed> is specified, its argument must be a BED file. Only
+the second and third columns will be used, to specify the zero-based
+start and end positions of intervals.
+
+## ENVIRONMENT
+
+`maf_tile` is a Ruby program and relies on ordinary Ruby environment
+variables.
+
+## COPYRIGHT
+
+`maf_tile` is copyright (C) 2012 Clayton Wheeler.
+
+## SEE ALSO
+
+maf_index(1), ruby(1)
+
+ * <https://github.com/csw/bioruby-maf/>

data/spec/bio/maf/index_spec.rb

@@ -228,6 +228,7 @@ module Bio
           @p = Parser.new(TestData + 'mm8_chr7_tiny.maf')
           @block = @p.parse_block
           @idx = KyotoIndex.new('%')
+          @idx.ref_seq = 'mm8.chr7'
         end
         context "single ref seq" do
           before(:each) do

data/spec/bio/maf/parser_spec.rb

@@ -25,6 +25,99 @@ module Bio
       it "provides arbitrary parameters"
     end
 
+    describe Block do
+      describe "#find_gaps" do
+        it "finds a single 14-base gap" do
+          p = Parser.new(TestData + 'mm8_chr7_tiny.maf')
+          p.sequence_filter = { :only_species => %w(mm8 rn4 hg18 canFam2 loxAfr1) }
+          block = p.parse_block
+          gaps = block.find_gaps
+          gaps.size.should == 1
+          gaps[0][0].should == 34
+          gaps[0][1].should == 14
+        end
+      end
+      describe "#remove_gaps!" do
+        it "removes a single 14-base gap" do
+          p = Parser.new(TestData + 'mm8_chr7_tiny.maf')
+          p.sequence_filter = { :only_species => %w(mm8 rn4 hg18 canFam2 loxAfr1) }
+          block = p.parse_block
+          block.sequences.size.should == 5
+          block.text_size.should == 54
+          block.remove_gaps!
+          block.text_size.should == 40
+        end
+      end
+    end
+
+    describe Sequence do
+      before(:each) do
+        @parser = DummyParser.new
+      end
+
+      describe "#gapped?" do
+        it "is false for sequences with no gaps" do
+          line = "s human_unc 9077 8 + 10998 ACAGTATT"
+          s = @parser.parse_seq_line(line, nil)
+          s.gapped?.should be_false
+        end
+        it "is true for sequences with gaps" do
+          line = "s human_unc 9077 8 + 10998 AC-AGTATT"
+          s = @parser.parse_seq_line(line, nil)
+          s.gapped?.should be_true
+        end
+      end
+
+      describe "#text_range" do
+        it "returns 0...text.size for a spanning interval" do
+          line = "s human_unc 9077 8 + 10998 ACAGTATT"
+          s = @parser.parse_seq_line(line, nil)
+          range = s.text_range(9077...(9077 + 8))
+          range.should == (0...(s.text.size))
+        end
+        it "returns 0...text.size for a gapped spanning interval" do
+          line = "s human_unc 9077 8 + 10998 AC--AGTATT"
+          s = @parser.parse_seq_line(line, nil)
+          range = s.text_range(9077...(9077 + 8))
+          range.should == (0...(s.text.size))
+        end
+        it "handles a leading subset" do
+          line = "s human_unc 9077 8 + 10998 ACAGTATT"
+          s = @parser.parse_seq_line(line, nil)
+          range = s.text_range(9077...(9077 + 2))
+          range.should == (0...2)
+        end
+        it "handles a trailing subset" do
+          line = "s human_unc 9077 8 + 10998 ACAGTATT"
+          s = @parser.parse_seq_line(line, nil)
+          range = s.text_range(9079...9085)
+          range.should == (2...8)
+        end
+        it "handles a gap in the middle" do
+          line = "s human_unc 9077 8 + 10998 AC--AGTATT"
+          s = @parser.parse_seq_line(line, nil)
+          range = s.text_range(9078...(9077 + 8))
+          range.should == (1...(s.text.size))
+        end
+        it "errors on a range starting before" do
+          expect {
+            line = "s human_unc 9077 8 + 10998 ACAGTATT"
+            s = @parser.parse_seq_line(line, nil)
+            range = s.text_range(9076...(9077 + 8))
+          }.to raise_error
+        end
+        it "errors on a range ending after" do
+          expect {
+            line = "s human_unc 9077 8 + 10998 ACAGTATT"
+            s = @parser.parse_seq_line(line, nil)
+            range = s.text_range(9076...(9077 + 9))
+          }.to raise_error
+        end
+
+      end
+
+    end
+
     describe ParseContext do
       it "tracks the last block position"
     end
@@ -206,6 +299,16 @@ module Bio
           @p.sequence_filter = { :only_species => %w(mm8 hg18) }
           @p.parse_block.sequences.size.should == 2
         end
+        it "sets filtered? when modified" do
+          @p.sequence_filter = { :only_species => %w(mm8 rn4) }
+          @p.parse_block.filtered?.should be_true
+        end
+        it "does not set filtered? when unmodified" do
+          @p.sequence_filter = {
+            :only_species => %w(mm8 rn4 oryCun1 hg18 hg181)
+          }
+          @p.parse_block.filtered?.should be_false
+        end
       end
 
       context "at end of file" do

data/spec/bio/maf/tiler_spec.rb

@@ -0,0 +1,69 @@
+require 'spec_helper'
+
+module Bio::MAF
+
+  describe Tiler do
+
+    describe "#runs" do
+      it "returns a uniform run properly" do
+        a = Array.new(10, 'a')
+        runs = Tiler.new.enum_for(:runs, a).to_a
+        runs.should == [[0...10, 'a']]
+      end
+      it "yields a trailing item" do
+        a = Array.new(10, 'a')
+        a.fill('b', 8...10)
+        runs = Tiler.new.enum_for(:runs, a).to_a
+        runs.should == [[0...8, 'a'], [8...10, 'b']]
+      end
+      it "handles mixed contents" do
+        spec = [[0...2, 'a'],
+                [2...3, 'b'],
+                [3...4, 'c'],
+                [4...7, 'd']]
+        a = Array.new(7, nil)
+        spec.each { |range, obj| a.fill(obj, range) }
+        runs = Tiler.new.enum_for(:runs, a).to_a
+        runs.should == spec
+      end
+      it "handles overwrites" do
+        spec = [[0...7, 'a'],
+                [2...5, 'b'],
+                [3...4, 'c'],
+                [4...7, 'd']]
+        a = Array.new(7, nil)
+        spec.each { |range, obj| a.fill(obj, range) }
+        runs = Tiler.new.enum_for(:runs, a).to_a
+        runs.should == [[0...2, 'a'],
+                        [2...3, 'b'],
+                        [3...4, 'c'],
+                        [4...7, 'd']]
+      end
+    end
+
+  end
+
+  describe FASTARangeReader do
+    describe "#read" do
+      before(:each) do
+        @r = FASTARangeReader.new('test/data/gap-sp1.fa')
+        @s = 'CCAGGATGCTGGGCTGAGGGCAGTTGTGTCAGGGCGGTCCGGTGCAGGCA'
+      end
+
+      def check_range(z_start, z_end)
+        @r.read_interval(z_start, z_end).should == @s.slice(z_start...z_end)
+      end
+
+      it "returns the entire sequence" do
+        check_range(0, 50)
+      end
+      it "returns an entire line" do
+        check_range(10, 20)
+      end
+      it "returns arbitrary components" do
+        check_range(17, 41)
+      end
+    end
+  end
+
+end

data/test/data/gap-sp1.fa

@@ -0,0 +1,6 @@
+> sp1.chr1
+CCAGGATGCT
+GGGCTGAGGG
+CAGTTGTGTC
+AGGGCGGTCC
+GGTGCAGGCA

metadata

@@ -1,7 +1,7 @@
 --- !ruby/object:Gem::Specification
 name: bio-maf
 version: !ruby/object:Gem::Version
-  version: 0.1.0
+  version: 0.2.0
   prerelease: 
 platform: ruby
 authors:
@@ -62,11 +62,13 @@ dependencies:
 description: Multiple Alignment Format parser for BioRuby.
 email: cswh@umich.edu
 executables:
+- find_overlaps
 - maf_count
 - maf_dump_blocks
 - maf_extract_ranges_count
 - maf_index
 - maf_parse_bench
+- maf_tile
 - maf_to_fasta
 - maf_write
 - random_ranges
@@ -76,6 +78,7 @@ extra_rdoc_files:
 - README.md
 files:
 - .document
+- .gitignore
 - .simplecov
 - .travis.yml
 - .yardopts
@@ -90,20 +93,27 @@ files:
 - benchmarks/read_bench
 - benchmarks/sort_bench
 - benchmarks/split_bench
+- bin/find_overlaps
 - bin/maf_count
 - bin/maf_dump_blocks
 - bin/maf_extract_ranges_count
 - bin/maf_index
 - bin/maf_parse_bench
+- bin/maf_tile
 - bin/maf_to_fasta
 - bin/maf_write
 - bin/random_ranges
+- bio-maf.gemspec
+- features/gap-filling.feature
+- features/gap-removal.feature
 - features/maf-indexing.feature
 - features/maf-output.feature
 - features/maf-parsing.feature
 - features/maf-querying.feature
 - features/maf-to-fasta.feature
 - features/step_definitions/convert_steps.rb
+- features/step_definitions/gap-filling_steps.rb
+- features/step_definitions/gap_removal_steps.rb
 - features/step_definitions/index_steps.rb
 - features/step_definitions/output_steps.rb
 - features/step_definitions/parse_steps.rb
@@ -115,8 +125,10 @@ files:
 - lib/bio-maf/maf.rb
 - lib/bio/maf.rb
 - lib/bio/maf/index.rb
+- lib/bio/maf/maf.rb
 - lib/bio/maf/parser.rb
 - lib/bio/maf/struct.rb
+- lib/bio/maf/tiler.rb
 - lib/bio/maf/writer.rb
 - lib/bio/ucsc.rb
 - lib/bio/ucsc/genomic-interval-bin.rb
@@ -125,17 +137,21 @@ files:
 - man/maf_index.1
 - man/maf_index.1.markdown
 - man/maf_index.1.ronn
+- man/maf_tile.1
+- man/maf_tile.1.ronn
 - man/maf_to_fasta.1
 - man/maf_to_fasta.1.ronn
 - spec/bio/maf/index_spec.rb
 - spec/bio/maf/parser_spec.rb
 - spec/bio/maf/struct_spec.rb
+- spec/bio/maf/tiler_spec.rb
 - spec/spec_helper.rb
 - test/data/big-block.maf
 - test/data/chr22_ieq.maf
 - test/data/chrY-1block.maf
 - test/data/empty
 - test/data/empty.db
+- test/data/gap-sp1.fa
 - test/data/mm8_chr7_tiny.kct
 - test/data/mm8_chr7_tiny.maf
 - test/data/mm8_mod_a.maf
@@ -165,7 +181,7 @@ required_ruby_version: !ruby/object:Gem::Requirement
       version: '0'
       segments:
       - 0
-      hash: -2212073295752934712
+      hash: 882426960615932212
 required_rubygems_version: !ruby/object:Gem::Requirement
   none: false
   requirements:
@@ -178,4 +194,43 @@ rubygems_version: 1.8.24
 signing_key: 
 specification_version: 3
 summary: MAF parser for BioRuby
-test_files: []
+test_files:
+- features/gap-filling.feature
+- features/gap-removal.feature
+- features/maf-indexing.feature
+- features/maf-output.feature
+- features/maf-parsing.feature
+- features/maf-querying.feature
+- features/maf-to-fasta.feature
+- features/step_definitions/convert_steps.rb
+- features/step_definitions/gap-filling_steps.rb
+- features/step_definitions/gap_removal_steps.rb
+- features/step_definitions/index_steps.rb
+- features/step_definitions/output_steps.rb
+- features/step_definitions/parse_steps.rb
+- features/step_definitions/query_steps.rb
+- features/step_definitions/ucsc_bin_steps.rb
+- features/support/env.rb
+- features/ucsc-bins.feature
+- spec/bio/maf/index_spec.rb
+- spec/bio/maf/parser_spec.rb
+- spec/bio/maf/struct_spec.rb
+- spec/bio/maf/tiler_spec.rb
+- spec/spec_helper.rb
+- test/data/big-block.maf
+- test/data/chr22_ieq.maf
+- test/data/chrY-1block.maf
+- test/data/empty
+- test/data/empty.db
+- test/data/gap-sp1.fa
+- test/data/mm8_chr7_tiny.kct
+- test/data/mm8_chr7_tiny.maf
+- test/data/mm8_mod_a.maf
+- test/data/mm8_single.maf
+- test/data/mm8_subset_a.maf
+- test/data/t1-bad1.maf
+- test/data/t1.fasta
+- test/data/t1.maf
+- test/data/t1a.maf
+- test/helper.rb
+- test/test_bio-maf.rb