bio-ensembl 1.1.0

data/test/release_56/variation/test_variation.rb

@@ -0,0 +1,63 @@
+#
+# = test/unit/release_56/variation/test_variation.tb - Unit test for Ensembl::Variation
+#
+# Copyright::   Copyright (C) 2009
+#               Francesco Strozzi <francesco.strozzi@gmail.com>
+# License::     Ruby's
+#
+require File.expand_path File.join(File.dirname(__FILE__),"../../helper.rb")
+
+include Ensembl::Variation
+
+class TestVariation < Test::Unit::TestCase
+  
+  def setup
+    DBConnection.connect('homo_sapiens',56)
+  end
+  
+  def teardown
+    DBConnection.remove_connection
+  end
+  
+  def test_fetch_region
+    vf = Variation.find_by_name('rs2076175').variation_features[0]
+    slice = vf.fetch_region
+    assert_equal(29708370,slice.start)
+    assert_equal(29718370,slice.stop)
+    assert_equal('6',slice.seq_region.name)
+    slice = vf.fetch_region(30,30)
+    assert_equal(29713340,slice.start)
+    assert_equal(29713400,slice.stop)
+    assert_equal('CTCCCAGGACTGCTTCTGCCCACTGTCCCCGGGGCCCTGCCCTGCCTTTCTGCCTGTCACA',slice.seq.upcase)
+  end
+  
+  def test_flanking_seq
+    vf = Variation.find_by_name('rs2076175').variation_features[0]
+    up,down = vf.flanking_seq
+    assert_equal(29713371,up.start)
+    assert_equal(29713770,up.stop)
+    assert_equal(29712970,down.start)
+    assert_equal(29713369,down.stop)
+    assert_equal('GGGCCCTGCCCTGCCTTTCTGCCTGTCACAGAGCAGGAAGAGCTGACCATCCAGATGTCCCTCAGCGAGAAACCCTGACTGCACAGATCCATCCTGGGACAGCACCGTGAGGTTGTAACAAAGACTGTGGGGCTCTGGGGAAGAGGAAATCACAGATGAAACTTCTTCCTGGAAGTAACTTCACATCAATGTTTAACACACAGGTCTGCTGTCCCGACCTTCCTGAGGAGGCAGGAAATGCACACGGGCAAAGGGACAAGAATGAGGATTTCAGACGCAAGGAAAACTGGGAAGGTGGGAGGATAGAGGAGGGGACTGAGGAACAGAAGAAGGGGGAATGGGGATGGCAAACTTGTAGGCCAGGTGCCAGGGCAGGGCAGCCACAGGCCCCCTCAGGATA',
+                  up.seq.upcase)
+    assert_equal('TCCTGATCTCACAAACCCTAATCTCCTGGAGGGAATGCAAGGCTGCCTGCCCCTACCCAGCAGTGACTTCTCCATTCCAGTCCAAGTGAGGAACTCGGACCAGGAAGGACCCCTCCCTGGCCCTCTTCCATCCCTCCCTGTGTGGGCTGAGCCCCGCTGAGCACCATTCCTCACCCCTACTCACAGCCAAATCCAGTGGGAAGAGACAGGTCCTGCTCTCTGCCCCCAACTCTCCTGGAAAAGGCCTCTCCCATTACTCTTGCCCACTGCCCACTCTCACCTCCTTTCTGGCCCTTGATATGAGCCAGGGTCCTCCTGAGCTCCTGCCCATTCTCTGTCAAGTCTTCAGTCTCTGTGTCCCAGGTCTCAGCTCCCAGGACTGCTTCTGCCCACTGTCCCC',
+                down.seq.upcase)
+                              
+  end
+  
+  def test_slice_variation
+    slice = Ensembl::Core::Slice.fetch_by_region('chromosome',1,100834,101331)
+    variations = slice.get_variation_features
+    assert_equal(6,variations.size)
+    
+    assert_equal('rs3912703',variations[0].variation_name)
+    assert_equal('ENSSNP5435782',variations[1].variation_name)
+    assert_equal('ENSSNP3491774',variations[2].variation_name)
+    assert_equal('ENSSNP283782',variations[3].variation_name)
+    assert_equal('ENSSNP4578340',variations[4].variation_name)
+
+  end
+  
+  
+  
+end

data/test/release_60/core/test_gene.rb

@@ -0,0 +1,61 @@
+#
+# = test/unit/release_53/core/test_gene.rb - Unit test for Ensembl::Core
+#
+# Copyright::   Copyright (C) 2009 Francesco Strozzi <francesco.strozzi@gmail.com>
+#
+# License::     Ruby's
+#
+# $Id:
+
+require File.expand_path File.join(File.dirname(__FILE__),"../../helper.rb")
+
+include Ensembl::Core
+
+class TestGene < Test::Unit::TestCase
+  
+  def setup
+    DBConnection.connect('homo_sapiens', 60)
+  end
+  
+  def teardown
+    DBConnection.remove_connection
+  end
+  
+  def test_gene
+    g = Gene.find_by_stable_id("ENSG00000006451")
+    assert_equal("ENSG00000006451",g.stable_id)
+    assert_equal("7",g.seq_region.name)
+    assert_equal(39663082,g.start)
+    assert_equal(39747723,g.stop)
+    assert_equal(1,g.strand)
+    assert_equal(84642,g.seq.length)
+    assert_equal("v-ral simian leukemia viral oncogene homolog A (ras related) [Source:HGNC Symbol;Acc:9839]",g.description)
+    assert_equal("RALA",g.name)
+  end
+  
+  def test_transcript
+    g = Gene.find_by_stable_id("ENSG00000006451")
+    t = g.transcripts
+    assert_equal(5,t.size)
+    assert_equal("ENST00000005257",t[0].stable_id)
+    t = t[0]
+    assert_equal(2880,t.seq.length)
+  end
+  
+  def test_exons
+    t = Transcript.find_by_stable_id("ENST00000005257")
+    e = t.exons
+    assert_equal(5,e.size)
+    assert_equal("ENSE00001829077",e[0].stable_id)
+    seq1 = "AGGCCCATGATCACCCTCCTCTCAGCCCACGGACAGGAAGTCGCTCCCCAGCTGCCCCGCCCCGCTCCCCAGCGCCCCGGAAGTGATCTGTGGCGGCTGCTGCAGAGCCGCCAGGAGGAGGGTGGATCTCCCCAGAGCAAAGCGTCGGAGTCCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCTCCAGCCGCCCAGGCTCCCCCGCCACCCGTCAGACTCCTCCTTCGACCGCTCCCGGCGCGGGGCCTTCCAGGCGACAAGGACCGAGTACCCTCCGGCCGGAGCCACGCAGCCGCGGCTTCCGGAGCCCTCGGGGCGGCGGACTGGCTCGCGGTGCAG"
+    assert_equal(seq1,e[0].seq.upcase)
+    assert_equal(39663082,e[0].start)
+    assert_equal(39663424,e[0].stop)
+    assert_equal("ENSE00000832451",e[1].stable_id)
+    seq2 = "ATTCTTCTTAATCCTTTGGTGAAAACTGAGACACAAAATGGCTGCAAATAAGCCCAAGGGTCAGAATTCTTTGGCTTTACACAAAGTCATCATGGTGGGCAGTGGTGGCGTGGGCAAGTCAGCTCTGACTCTACAGTTCATGTACGATGAG"
+    assert_equal(seq2,e[1].seq.upcase)
+    assert_equal(39726230,e[1].start)
+    assert_equal(39726380,e[1].stop)
+  end
+
+end

data/test/release_60/core/test_project_human.rb

@@ -0,0 +1,34 @@
+#
+# = test/unit/test_project.rb - Unit test for Ensembl::Core
+#
+# Copyright::   Copyright (C) 2009
+#               Jan Aerts <http://jandot.myopenid.com>
+#               Francesco Strozzi <francesco.strozzi@gmail.com>
+# License::     Ruby's
+#
+# $Id:
+require File.expand_path File.join(File.dirname(__FILE__),"../../helper.rb")
+
+include Ensembl::Core
+
+class AssemblyExceptions < Test::Unit::TestCase
+  
+  def setup
+    DBConnection.connect('homo_sapiens', 60)
+  end
+  
+  def teardown
+    DBConnection.remove_connection
+  end
+  
+  def test_chr_x
+    source_slice = Slice.fetch_by_region('chromosome','X', 2709497, 2709520)
+    assert_equal('ctgaagaattgtgtttcttcccta', source_slice.seq)
+  end
+
+  def test_slice_overlapping_PAR_and_allosome
+    source_slice = Slice.fetch_by_region('chromosome','Y',2709500,2709540)
+    assert_equal('AGAAACTGAAAATGCTAAGAAATTCAGTTCCAGGATATGAA', source_slice.seq.upcase)
+  end
+
+end

data/test/release_60/core/test_slice.rb

@@ -0,0 +1,42 @@
+#
+# = test/unit/release_53/core/test_slice.rb - Unit test for Ensembl::Core
+#
+# Copyright::   Copyright (C) 2009
+#               Francesco Strozzi <francesco.strozzi@gmail.com>
+# License::     Ruby's
+#
+# $Id:
+
+require File.expand_path File.join(File.dirname(__FILE__),"../../helper.rb")
+
+include Ensembl::Core
+
+class TestSlice < Test::Unit::TestCase
+  
+  def setup
+    DBConnection.connect('homo_sapiens', 60)
+  end
+  
+  def teardown
+    DBConnection.remove_connection
+  end
+  
+  def test_forward
+    seq1 = "GGCCAAGCTGGTCTCAAACTCCTGACCTCGTGATCCGCCCACCTCGGCCTCCCAAAGTGCTGGGATTACAGGCGTGGGCCACTGGGTCCGGCCGCATGTCTGGCTAATTTTGTAGAGACAGGGCCTCCCTATACTGCCCAGGCTGGTTTCAAGCTCCTGGCTTCAAGGGGTCCTCCTGCCTTGGCCTCCCGAAGTGCTGG"
+    s = Slice.fetch_by_region("chromosome","13",31786617,31786816,1)
+    assert_equal(seq1,s.seq.upcase)
+    assert_equal("13",s.seq_region.name)
+    assert_equal(31786617,s.start)
+    assert_equal(31786816,s.stop)
+  end
+  
+  def test_reverse
+    seq2 = "CCAGCACTTCGGGAGGCCAAGGCAGGAGGACCCCTTGAAGCCAGGAGCTTGAAACCAGCCTGGGCAGTATAGGGAGGCCCTGTCTCTACAAAATTAGCCAGACATGCGGCCGGACCCAGTGGCCCACGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGTGGGCGGATCACGAGGTCAGGAGTTTGAGACCAGCTTGGCC"
+    s_rev = Slice.fetch_by_region("chromosome","13",31786617,31786816,-1)
+    assert_equal(seq2,s_rev.seq.upcase)
+    assert_equal("13",s_rev.seq_region.name)
+    assert_equal(31786617,s_rev.start)
+    assert_equal(31786816,s_rev.stop)
+  end
+
+end

data/test/release_60/core/test_transcript.rb

@@ -0,0 +1,120 @@
+#
+# = test/unit/test_transcript.rb - Unit test for Ensembl::Core
+#
+# Copyright::   Copyright (C) 2007
+#               Jan Aerts <http://jandot.myopenid.com>
+# License::     Ruby's
+#
+# $Id:
+require File.expand_path File.join(File.dirname(__FILE__),"../../helper.rb")
+
+include Ensembl::Core
+
+DBConnection.connect('homo_sapiens', 60)
+
+class CodingPositions < Test::Unit::TestCase
+  def setup
+    # Transcript tr_fw is ENST00000215574
+    @tr_fw = Transcript.find_by_stable_id("ENST00000215574")
+    # Transcript tr_rev is ENST00000358041
+    @tr_rev = Transcript.find_by_stable_id("ENST00000358041")
+  end
+
+  def test_transcript_coords
+    assert_equal(531733, @tr_fw.seq_region_start)
+    assert_equal(542084, @tr_fw.seq_region_end)
+    assert_equal(644371, @tr_rev.seq_region_start)
+    assert_equal(647309, @tr_rev.seq_region_end)
+  end
+
+  def test_coding_regions_genomic_coords_of_fw
+    assert_equal(531932, @tr_fw.coding_region_genomic_start)
+    assert_equal(541552, @tr_fw.coding_region_genomic_end)
+  end
+
+  def test_coding_regions_genomic_coords_of_rev
+    assert_equal(646652, @tr_rev.coding_region_genomic_start)
+    assert_equal(647047, @tr_rev.coding_region_genomic_end)
+  end
+  
+  def test_coding_regions_cdna_coords_of_fw
+    assert_equal(200, @tr_fw.coding_region_cdna_start)
+    assert_equal(910, @tr_fw.coding_region_cdna_end)
+  end
+
+  def test_coding_regions_cdna_coords_of_rev
+    assert_equal(263, @tr_rev.coding_region_cdna_start)
+    assert_equal(658, @tr_rev.coding_region_cdna_end)
+  end
+  
+end
+
+class GenomicVsCDna < Test::Unit::TestCase
+  #From BioMart. Columns:
+  #  Ensembl_Transcript_ID
+  #  Chromosome
+  #  Strand
+  #  Ensembl_Exon_ID
+  #  Exon_Chr_Start
+  #  Exon_Chr_End
+  #  Exon_Rank_in_Transcript
+  #ENST00000215574	19	1	ENSE00000655676	531733	532108	1
+  #ENST00000215574	19	1	ENSE00000655677	535837	535923	2
+  #ENST00000215574	19	1	ENSE00000655678	536243	536340	3
+  #ENST00000215574	19	1	ENSE00000655679	537013	537147	4
+  #ENST00000215574	19	1	ENSE00000655680	541339	542084	5
+  #
+  #ENST00000315489	19	-1	ENSE00001215510	474621	474983	1
+  #ENST00000315489	19	-1	ENSE00001215495	472394	472501	2
+  #ENST00000315489	19	-1	ENSE00001215487	467649	467762	3
+  #ENST00000315489	19	-1	ENSE00001215506	463344	464364	4
+  def setup
+    # Transcript tr_fw is ENST00000215574
+    @tr_fw = Transcript.find_by_stable_id("ENST00000215574")
+    # Transcript tr_rev is ENST00000315489
+    @tr_rev = Transcript.find_by_stable_id("ENST00000315489")
+  end
+  
+  def test_identify_exon
+    assert_equal("ENSE00000655679", @tr_fw.exon_for_cdna_position(601).stable_id)
+    assert_equal("ENSE00000655679", @tr_fw.exon_for_genomic_position(537052).stable_id)
+    assert_equal("ENSE00001215487", @tr_rev.exon_for_cdna_position(541).stable_id)
+    assert_equal("ENSE00001215487", @tr_rev.exon_for_genomic_position(467693).stable_id)
+  end
+  
+  def test_cdna2genomic
+    assert_equal(537052, @tr_fw.cdna2genomic(601))
+    assert_equal(467693, @tr_rev.cdna2genomic(541))
+  end
+  
+  def test_cds2genomic
+    assert_equal(537052, @tr_fw.cds2genomic(401))
+    assert_equal(467693, @tr_rev.cds2genomic(304))
+  end
+  
+  def test_genomic2cdna
+    assert_equal(601, @tr_fw.genomic2cdna(537052))
+    assert_equal(541, @tr_rev.genomic2cdna(467693))
+  end
+  
+  def test_genomic2cds
+    assert_equal(401, @tr_fw.genomic2cds(537052))
+    assert_equal(304, @tr_rev.genomic2cds(467693))
+  end
+end
+
+class TestIntron < Test::Unit::TestCase
+  def setup
+    @transcript = Transcript.find_by_stable_id("ENST00000215574")
+    @introns = @transcript.introns
+  end
+  
+  def test_get_introns
+    assert_equal(4, @introns.length)
+  end
+  
+  def test_intron_slices
+    assert_equal('chromosome:GRCh37:19:532109:535836:1', @introns[0].slice.to_s)
+  end
+end
+

data/test/release_60/core/test_transform.rb

@@ -0,0 +1,57 @@
+#
+# = test/unit/release_53/core/test_transform.rb - Unit test for Ensembl::Core
+#
+# Copyright::   Copyright (C) 2009
+#               Jan Aerts <http://jandot.myopenid.com>
+#               Francesco Strozzi <francesco.strozzi@gmail.com>
+# License::     Ruby's
+#
+# $Id:
+
+require File.expand_path File.join(File.dirname(__FILE__),"../../helper.rb")
+
+include Ensembl::Core
+
+
+# For all tests, the source (i.e. the seq_region that the feature is annotated
+# on initially) remains forward.
+#
+# Same coordinate system: test names refer to direction of gene vs chromosome
+class TransformOntoSameCoordinateSystem < Test::Unit::TestCase
+
+  def setup
+    DBConnection.connect('homo_sapiens', 60)
+  end
+  
+  def teardown
+    DBConnection.remove_connection
+  end
+
+  def test_fw
+    source_gene = Gene.find_by_stable_id("ENSG00000242450")
+    target_gene = source_gene.transform('chromosome')
+
+    assert_equal('22', source_gene.seq_region.name)
+    assert_equal(24349643, source_gene.seq_region_start)
+    assert_equal(24349710, source_gene.seq_region_end)
+    assert_equal(1, source_gene.seq_region_strand)
+    assert_equal('22', target_gene.seq_region.name)
+    assert_equal(24349643, target_gene.seq_region_start)
+    assert_equal(24349710, target_gene.seq_region_end)
+    assert_equal(1, target_gene.seq_region_strand)
+  end
+
+  def test_rev
+    source_gene = Gene.find_by_stable_id("ENSG00000240339")
+    target_gene = source_gene.transform('chromosome')
+    assert_equal('22', source_gene.seq_region.name)
+    assert_equal(24349560, source_gene.seq_region_start)
+    assert_equal(24349631, source_gene.seq_region_end)
+    assert_equal(-1, source_gene.seq_region_strand)
+    assert_equal('22', target_gene.seq_region.name)
+    assert_equal(24349560, target_gene.seq_region_start)
+    assert_equal(24349631, target_gene.seq_region_end)
+    assert_equal(-1, target_gene.seq_region_strand)
+  end
+
+end

data/test/release_60/variation/test_activerecord.rb

@@ -0,0 +1,216 @@
+#
+# = test/unit/release_56/variation/test_activerecord.rb - Unit test for Ensembl::Variation
+#
+# Copyright::   Copyright (C) 2009
+#               Francesco Strozzi <francesco.strozzi@gmail.com>
+#
+# License::     Ruby's
+#
+# $Id:
+require File.expand_path File.join(File.dirname(__FILE__),"../../helper.rb")
+
+include Ensembl::Variation
+
+class ActiveRecordVariation < Test::Unit::TestCase
+  
+  def setup
+    DBConnection.connect('homo_sapiens',60)
+  end
+  
+  def teardown
+    DBConnection.remove_connection
+  end
+  
+  def test_allele
+    allele = Allele.find(1)
+    assert_equal('T', allele.allele)
+    assert_equal(0.04, allele.frequency)
+  end
+
+  def test_sample
+    n = Sample.count(:all)
+    assert_equal(30351,n)
+    individual = Sample.find(12468).individual
+    assert_equal('Male',individual.gender)
+    i = Sample.find(13131).individual_genotype_multiple_bp
+    assert_equal(5,i.size)
+    assert_equal(1688213,i[0].variation_id)
+    syn = Sample.find(21).sample_synonym
+    assert_equal('6',syn.name)
+  end
+  
+  def test_individual
+    n = Individual.count(:all)
+    assert_equal(12307,n)
+  end
+  
+  def test_individual_genotype_multiple_bp
+    n = IndividualGenotypeMultipleBp.count(:all)
+    assert_equal(1009778,n)
+  end
+  
+  def test_compressed_genotype_single_bp
+    n = CompressedGenotypeSingleBp.count(:all)
+    assert_equal(67856517,n)
+  end
+  
+  def test_read_coverage
+    n = ReadCoverage.count(:all)
+    assert_equal(4183832,n)
+  end
+  
+  def test_population
+    n = Population.count(:all)
+    assert_equal(11673,n)
+    p = Population.find(236)
+    ind = p.individuals
+    assert_equal(653,ind.size)
+  end
+  
+  def test_variation
+    n = Variation.count(:all)
+    assert_equal(24623913,n)
+    
+    syn = Variation.find(712422).variation_synonyms
+    assert_equal(1,syn.size)
+    assert_equal('rs56673311',syn[0].name)
+    
+    flanking = Variation.find(10000).flanking_sequence
+    assert_equal(132077099,flanking.up_seq_region_start)
+    assert_equal(132077128,flanking.up_seq_region_end)
+    assert_equal(132077130,flanking.down_seq_region_start)
+    assert_equal(132077159,flanking.down_seq_region_end)
+    assert_equal(27517,flanking.seq_region_id)
+    assert_equal(1,flanking.seq_region_strand)
+    
+    ag = Variation.find(10000).allele_groups
+    assert_nil ag[0]
+    
+    pg = Variation.find(1234).population_genotypes
+    assert_equal(28,pg.size)
+    assert_equal('A',pg[0].allele_1)
+    assert_equal('A',pg[0].allele_2)
+    assert_equal(1,pg[0].frequency)
+    
+    a = Variation.find(115).alleles
+    assert_equal(14,a.size)
+    assert_equal('C',a[0].allele)
+    assert_equal(0.733,a[0].frequency)
+    
+    vf = Variation.find(5345540).variation_features[0]
+    assert_equal('C/T',vf.allele_string)
+    assert_equal('rs8192830',vf.variation_name)
+    assert_equal(27506,vf.seq_region_id)
+    assert_equal(139618573,vf.seq_region_start)
+    assert_equal(139618573,vf.seq_region_end)
+    assert_equal(1,vf.seq_region_strand)
+    
+    vg = Variation.find(1352735).variation_groups
+    assert_nil vg[0]
+    
+    i = Variation.find(243).individual_genotype_multiple_bps
+    assert_equal(68,i.size)
+  end
+  
+  def test_variation_feature
+    vf_sample = VariationFeature.find_by_variation_name('rs167125').samples
+    assert_equal(1,vf_sample.size)
+    assert_equal('CSHL-HAPMAP:HapMap-JPT',vf_sample[0].name)
+  end
+  
+  def test_variation_transcript
+    t = Variation.find_by_name('rs7671997').variation_features[0].transcript_variations
+    assert_equal(7,t.size)
+    assert_equal('WITHIN_NON_CODING_GENE',t[0].consequence_type)
+    assert_equal('5PRIME_UTR',t[2].consequence_type)
+    assert_equal(4079207,t[0].variation_feature_id)
+    transcript = t[0].transcript
+    assert_equal('processed_transcript',transcript.biotype)
+    assert_equal(2158121,transcript.seq_region_start)
+    assert_equal(2243848,transcript.seq_region_end)
+    assert_equal('ENST00000515357',transcript.stable_id)
+    e = transcript.exons
+    assert_equal('AGTGCGAGGCGCGCGGGGCACGGAGGGCGGTGGCGGCGGGCTCCTGCGAGAAGCAAGCGGAACTTCCTGAG',e[0].seq.upcase)
+
+  end
+  
+  def test_source
+    syn = Source.find(1).sample_synonyms
+    assert_equal(23061,syn.size)
+    
+    ag = Source.find(1).allele_groups
+    assert_nil ag[0]
+  end
+  
+  def test_variation_annotation
+    va = VariationAnnotation.find(95)
+    assert_equal(1756227,va.variation_id)
+    assert_equal('EGAS00000000060',va.local_stable_id)
+    assert_equal('rs2306027',va.variation_names)
+    assert_equal(0.218132812399633,va.risk_allele_freq_in_controls.to_f)    
+  end
+  
+  def test_phenotype
+    pheno = Phenotype.find(1527)
+    va = pheno.variation_annotations
+    assert_equal(14,va.size)
+    assert_equal('GATA6,CTAGE1,RBBP8,CABLES1',va[5].associated_gene)
+  end
+  
+  def test_structural_variation
+    sv = StructuralVariation.find(171276)
+    assert_equal('nsv429550',sv.variation_name)
+    assert_equal(224676,sv.seq_region_start)
+    assert_equal(44780026,sv.seq_region_end)
+    assert_equal('11',sv.seq_region.name)
+  end
+  
+  def test_population_genotype
+    v = Variation.find(1082)
+    pg = v.population_genotypes
+    assert_equal(41,pg.size)
+    assert_equal(0.6,pg[0].frequency)
+    pop = Population.find(132)
+    pg = pop.population_genotypes
+    assert_equal(1070,pg.size)
+  end
+  
+  def test_subsnp_handle
+    s = SubsnpHandle.find(946)
+    assert_equal('WIAF',s.handle)
+    pg = s.population_genotypes
+    assert_equal(2,pg.size)
+    assert_equal(0.4,pg[0].frequency)
+    alleles = s.alleles
+    assert_equal(2,alleles.size)
+    assert_equal('A',alleles[0].allele)
+    s = SubsnpHandle.find(107935890)
+    vs = s.variation_synonyms
+    assert_equal(1,vs.size)
+    assert_equal('ENSSNP10154320',vs[0].name)
+  end
+  
+  def test_variation_synonym
+    v = Variation.find(12659557)
+    vs = v.variation_synonyms
+    assert_equal(1,vs.size)
+    assert_equal('rs66792216',vs[0].name)
+  end
+  
+  def test_failed_description
+    v = Variation.find(15005920)
+    fd = v.failed_descriptions
+    assert_equal(1,fd.size)
+    assert_equal('Variation maps to more than 3 different locations',fd[0].description)
+  end
+  
+  def test_variation_set
+    v = Variation.find(8)
+    vs = v.variation_sets
+    assert_equal(5,vs.size)
+    assert_equal("1000 genomes - Trios - CEU",vs[0].name)
+    assert_equal("Variations called by the 1000 genomes project on high coverage sequence data from a CEU population trio",vs[0].description)
+  end
+  
+  
+end