speconsense 0.7.4__tar.gz → 0.7.5__tar.gz

{speconsense-0.7.4/speconsense.egg-info → speconsense-0.7.5}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.4
 Name: speconsense
-Version: 0.7.4
+Version: 0.7.5
 Summary: High-quality clustering and consensus generation for Oxford Nanopore amplicon reads
 Author-email: Josh Walker <joshowalker@yahoo.com>
 License: BSD-3-Clause
@@ -295,14 +295,14 @@ When using `speconsense-summarize` for post-processing, creates `__Summary__/` d
 |---------------|-------------|------------|-------------|
 | **Original** | Source `cluster_debug/` | `-c1`, `-c2`, `-c3` | Preserves speconsense clustering results |
 | **Summarization** | `__Summary__/`, `FASTQ Files/`, `variants/` | `-1.v1`, `-1.v2`, `-2.v1`, `.raw1` | Post-processing groups and variants |
-| **Full consensus** | `__Summary__/` | `-1.full` | IUPAC consensus from all pre-merge variants in a group |
+| **Full consensus** | `__Summary__/` | `-1.full` | IUPAC consensus from pre-merge components of surviving variants |
 
 ### Example Directory Structure
 ```
 __Summary__/
 ├── sample-1.v1-RiC45.fasta                  # Primary variant (group 1, merged)
 ├── sample-1.v2-RiC23.fasta                  # Additional variant (not merged)
-├── sample-1.full-RiC68.fasta                # Full IUPAC consensus for group 1 (all pre-merge variants)
+├── sample-1.full-RiC68.fasta                # Full IUPAC consensus for group 1 (surviving variants' components)
 ├── sample-2.v1-RiC30.fasta                  # Second organism group, primary variant
 ├── summary.fasta                            # All final consensus sequences (excludes .raw)
 ├── summary.txt                              # Statistics
@@ -829,7 +829,7 @@ For high-throughput workflows (e.g., 100K sequences/year), this prioritization e
 ```bash
 speconsense-summarize --enable-full-consensus
 ```
-- Generates a full IUPAC consensus sequence per variant group from all pre-merge variants
+- Generates a full IUPAC consensus sequence per variant group from pre-merge variants that contributed to surviving post-merge variants
 - Output named `{specimen}-{group}.full-RiC{reads}.fasta` in the `__Summary__/` directory
 - Uses majority voting across all variants in the group; **gaps never win** — at each alignment column, the most common non-gap base is chosen, with IUPAC codes for ties among bases
 - Useful when you want a single representative sequence that captures all variation within a group as IUPAC ambiguity codes
@@ -1073,7 +1073,7 @@ The complete speconsense-summarize workflow operates in this order:
 4. **Homopolymer-aware MSA-based variant merging** within each group, including **overlap merging** for different-length sequences (`--disable-merging`, `--merge-effort`, `--merge-position-count`, `--merge-indel-length`, `--min-merge-overlap`, `--merge-snp`, `--merge-min-size-ratio`, `--disable-homopolymer-equivalence`)
 5. **Selection size ratio filtering** to remove tiny post-merge variants (`--select-min-size-ratio`)
 6. **Variant selection** within each group (`--select-max-variants`, `--select-strategy`)
-7. **Full consensus generation** (optional) — IUPAC consensus from all pre-merge variants per group (`--enable-full-consensus`)
+7. **Full consensus generation** (optional) — IUPAC consensus from pre-merge components of surviving post-merge variants (`--enable-full-consensus`)
 8. **Output generation** with customizable header fields (`--fasta-fields`) and full traceability
 
 **Key architectural features**:

{speconsense-0.7.4 → speconsense-0.7.5}/README.md

@@ -260,14 +260,14 @@ When using `speconsense-summarize` for post-processing, creates `__Summary__/` d
 |---------------|-------------|------------|-------------|
 | **Original** | Source `cluster_debug/` | `-c1`, `-c2`, `-c3` | Preserves speconsense clustering results |
 | **Summarization** | `__Summary__/`, `FASTQ Files/`, `variants/` | `-1.v1`, `-1.v2`, `-2.v1`, `.raw1` | Post-processing groups and variants |
-| **Full consensus** | `__Summary__/` | `-1.full` | IUPAC consensus from all pre-merge variants in a group |
+| **Full consensus** | `__Summary__/` | `-1.full` | IUPAC consensus from pre-merge components of surviving variants |
 
 ### Example Directory Structure
 ```
 __Summary__/
 ├── sample-1.v1-RiC45.fasta                  # Primary variant (group 1, merged)
 ├── sample-1.v2-RiC23.fasta                  # Additional variant (not merged)
-├── sample-1.full-RiC68.fasta                # Full IUPAC consensus for group 1 (all pre-merge variants)
+├── sample-1.full-RiC68.fasta                # Full IUPAC consensus for group 1 (surviving variants' components)
 ├── sample-2.v1-RiC30.fasta                  # Second organism group, primary variant
 ├── summary.fasta                            # All final consensus sequences (excludes .raw)
 ├── summary.txt                              # Statistics
@@ -794,7 +794,7 @@ For high-throughput workflows (e.g., 100K sequences/year), this prioritization e
 ```bash
 speconsense-summarize --enable-full-consensus
 ```
-- Generates a full IUPAC consensus sequence per variant group from all pre-merge variants
+- Generates a full IUPAC consensus sequence per variant group from pre-merge variants that contributed to surviving post-merge variants
 - Output named `{specimen}-{group}.full-RiC{reads}.fasta` in the `__Summary__/` directory
 - Uses majority voting across all variants in the group; **gaps never win** — at each alignment column, the most common non-gap base is chosen, with IUPAC codes for ties among bases
 - Useful when you want a single representative sequence that captures all variation within a group as IUPAC ambiguity codes
@@ -1038,7 +1038,7 @@ The complete speconsense-summarize workflow operates in this order:
 4. **Homopolymer-aware MSA-based variant merging** within each group, including **overlap merging** for different-length sequences (`--disable-merging`, `--merge-effort`, `--merge-position-count`, `--merge-indel-length`, `--min-merge-overlap`, `--merge-snp`, `--merge-min-size-ratio`, `--disable-homopolymer-equivalence`)
 5. **Selection size ratio filtering** to remove tiny post-merge variants (`--select-min-size-ratio`)
 6. **Variant selection** within each group (`--select-max-variants`, `--select-strategy`)
-7. **Full consensus generation** (optional) — IUPAC consensus from all pre-merge variants per group (`--enable-full-consensus`)
+7. **Full consensus generation** (optional) — IUPAC consensus from pre-merge components of surviving post-merge variants (`--enable-full-consensus`)
 8. **Output generation** with customizable header fields (`--fasta-fields`) and full traceability
 
 **Key architectural features**:

{speconsense-0.7.4 → speconsense-0.7.5}/pyproject.toml

@@ -4,7 +4,7 @@ build-backend = "setuptools.build_meta"
 
 [project]
 name = "speconsense"
-version = "0.7.4"
+version = "0.7.5"
 description = "High-quality clustering and consensus generation for Oxford Nanopore amplicon reads"
 readme = "README.md"
 requires-python = ">=3.8"

{speconsense-0.7.4 → speconsense-0.7.5}/speconsense/__init__.py

@@ -5,7 +5,7 @@ A Python tool for experimental clustering and consensus generation as an alterna
 in the fungal DNA barcoding pipeline.
 """
 
-__version__ = "0.7.4"
+__version__ = "0.7.5"
 __author__ = "Josh Walker"
 __email__ = "joshowalker@yahoo.com"
 

{speconsense-0.7.4 → speconsense-0.7.5}/speconsense/summarize/cli.py

@@ -392,19 +392,19 @@ def process_single_specimen(file_consensuses: List[ConsensusInfo],
             final_consensus.append(renamed_variant)
             group_naming.append((variant.sample_name, new_name))
 
-        # Generate full consensus from PRE-MERGE variants
+        # Generate full consensus from PRE-MERGE variants that contributed
+        # to surviving post-merge variants (after select-min-size-ratio)
         if getattr(args, 'enable_full_consensus', False):
-            pre_merge_variants = variant_groups[group_id]
-
-            # Apply size-ratio filter (same as merge pipeline)
-            if args.merge_min_size_ratio > 0 and len(pre_merge_variants) > 1:
-                largest_size = max(v.size for v in pre_merge_variants)
-                filtered = [v for v in pre_merge_variants
-                            if (v.size / largest_size) >= args.merge_min_size_ratio]
-                if len(filtered) < len(pre_merge_variants):
-                    filtered_count = len(pre_merge_variants) - len(filtered)
-                    logging.debug(f"Full consensus: filtered out {filtered_count} variants with size ratio < {args.merge_min_size_ratio} relative to largest (size={largest_size})")
-                    pre_merge_variants = filtered
+            # Collect original cluster names from surviving post-merge variants
+            surviving_originals = set()
+            for v in group_members:
+                if v.sample_name in all_merge_traceability:
+                    surviving_originals.update(all_merge_traceability[v.sample_name])
+                else:
+                    surviving_originals.add(v.sample_name)
+
+            pre_merge_variants = [v for v in variant_groups[group_id]
+                                  if v.sample_name in surviving_originals]
 
             specimen_base = selected_variants[0].sample_name.rsplit('-c', 1)[0]
             full_name = f"{specimen_base}-{group_idx + 1}.full"

{speconsense-0.7.4 → speconsense-0.7.5/speconsense.egg-info}/PKG-INFO

@@ -1,6 +1,6 @@
 Metadata-Version: 2.4
 Name: speconsense
-Version: 0.7.4
+Version: 0.7.5
 Summary: High-quality clustering and consensus generation for Oxford Nanopore amplicon reads
 Author-email: Josh Walker <joshowalker@yahoo.com>
 License: BSD-3-Clause
@@ -295,14 +295,14 @@ When using `speconsense-summarize` for post-processing, creates `__Summary__/` d
 |---------------|-------------|------------|-------------|
 | **Original** | Source `cluster_debug/` | `-c1`, `-c2`, `-c3` | Preserves speconsense clustering results |
 | **Summarization** | `__Summary__/`, `FASTQ Files/`, `variants/` | `-1.v1`, `-1.v2`, `-2.v1`, `.raw1` | Post-processing groups and variants |
-| **Full consensus** | `__Summary__/` | `-1.full` | IUPAC consensus from all pre-merge variants in a group |
+| **Full consensus** | `__Summary__/` | `-1.full` | IUPAC consensus from pre-merge components of surviving variants |
 
 ### Example Directory Structure
 ```
 __Summary__/
 ├── sample-1.v1-RiC45.fasta                  # Primary variant (group 1, merged)
 ├── sample-1.v2-RiC23.fasta                  # Additional variant (not merged)
-├── sample-1.full-RiC68.fasta                # Full IUPAC consensus for group 1 (all pre-merge variants)
+├── sample-1.full-RiC68.fasta                # Full IUPAC consensus for group 1 (surviving variants' components)
 ├── sample-2.v1-RiC30.fasta                  # Second organism group, primary variant
 ├── summary.fasta                            # All final consensus sequences (excludes .raw)
 ├── summary.txt                              # Statistics
@@ -829,7 +829,7 @@ For high-throughput workflows (e.g., 100K sequences/year), this prioritization e
 ```bash
 speconsense-summarize --enable-full-consensus
 ```
-- Generates a full IUPAC consensus sequence per variant group from all pre-merge variants
+- Generates a full IUPAC consensus sequence per variant group from pre-merge variants that contributed to surviving post-merge variants
 - Output named `{specimen}-{group}.full-RiC{reads}.fasta` in the `__Summary__/` directory
 - Uses majority voting across all variants in the group; **gaps never win** — at each alignment column, the most common non-gap base is chosen, with IUPAC codes for ties among bases
 - Useful when you want a single representative sequence that captures all variation within a group as IUPAC ambiguity codes
@@ -1073,7 +1073,7 @@ The complete speconsense-summarize workflow operates in this order:
 4. **Homopolymer-aware MSA-based variant merging** within each group, including **overlap merging** for different-length sequences (`--disable-merging`, `--merge-effort`, `--merge-position-count`, `--merge-indel-length`, `--min-merge-overlap`, `--merge-snp`, `--merge-min-size-ratio`, `--disable-homopolymer-equivalence`)
 5. **Selection size ratio filtering** to remove tiny post-merge variants (`--select-min-size-ratio`)
 6. **Variant selection** within each group (`--select-max-variants`, `--select-strategy`)
-7. **Full consensus generation** (optional) — IUPAC consensus from all pre-merge variants per group (`--enable-full-consensus`)
+7. **Full consensus generation** (optional) — IUPAC consensus from pre-merge components of surviving post-merge variants (`--enable-full-consensus`)
 8. **Output generation** with customizable header fields (`--fasta-fields`) and full traceability
 
 **Key architectural features**:

{speconsense-0.7.4 → speconsense-0.7.5}/tests/test_summarize.py

@@ -521,7 +521,7 @@ class TestFullConsensus:
 
 
     def test_full_consensus_filters_small_variants(self):
-        """Integration test: merge_min_size_ratio filters small variants from full consensus."""
+        """Integration test: select_min_size_ratio filters small variants from full consensus."""
         temp_dir = tempfile.mkdtemp()
         source_dir = os.path.join(temp_dir, "clusters")
         summary_dir = os.path.join(temp_dir, "__Summary__")
@@ -529,7 +529,7 @@ class TestFullConsensus:
 
         try:
             # Two similar sequences (1 SNP at position 12: G vs A)
-            # Very different sizes so the small one is filtered by merge_min_size_ratio
+            # Very different sizes so the small one is filtered by select_min_size_ratio
             seq_large = "ATCGATCGATCGATCGATCGATCG"  # G at position 12
             seq_small = "ATCGATCGATCAATCGATCGATCG"  # A at position 12
 
@@ -542,7 +542,8 @@ class TestFullConsensus:
             with open(fasta_file, 'w') as f:
                 f.write(fasta_content)
 
-            # merge-min-size-ratio 0.1 filters 5/100=0.05 from full consensus
+            # select-min-size-ratio 0.1 filters 5/100=0.05 post-merge variant,
+            # so its pre-merge components are excluded from .full consensus
             result = subprocess.run(
                 [
                     "speconsense-summarize",
@@ -550,7 +551,7 @@ class TestFullConsensus:
                     "--summary-dir", summary_dir,
                     "--min-ric", "3",
                     "--enable-full-consensus",
-                    "--merge-min-size-ratio", "0.1",
+                    "--select-min-size-ratio", "0.1",
                     "--disable-merging",
                     "--min-merge-overlap", "0",
                 ],
@@ -574,8 +575,8 @@ class TestFullConsensus:
         finally:
             shutil.rmtree(temp_dir)
 
-    def test_full_consensus_no_filter_when_disabled(self):
-        """Integration test: merge_min_size_ratio=0 preserves all variants in full consensus."""
+    def test_full_consensus_no_filter_when_all_survive(self):
+        """Integration test: all post-merge variants surviving means all contribute to .full."""
         temp_dir = tempfile.mkdtemp()
         source_dir = os.path.join(temp_dir, "clusters")
         summary_dir = os.path.join(temp_dir, "__Summary__")
@@ -595,7 +596,7 @@ class TestFullConsensus:
             with open(fasta_file, 'w') as f:
                 f.write(fasta_content)
 
-            # merge-min-size-ratio 0 disables filtering — both contribute to .full
+            # No select-min-size-ratio — both variants survive, both contribute to .full
             result = subprocess.run(
                 [
                     "speconsense-summarize",
@@ -603,7 +604,6 @@ class TestFullConsensus:
                     "--summary-dir", summary_dir,
                     "--min-ric", "3",
                     "--enable-full-consensus",
-                    "--merge-min-size-ratio", "0",
                     "--disable-merging",
                     "--min-merge-overlap", "0",
                 ],